Dataset for CDS BCL2L1 of organism Nothobranchius furzeri

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A1A7ZDF6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L1 (length=702 residues).
atgtctcaaaaccaagaactagttcttttctatattagatataaactgtcacagaggaactatcccctcaaccacatagt
cctcaatgaccccctaaacaggactggtgcgggggatgcggtggtggggggtgaggaggagaggacagagacacacgcca
atgggacctttaacaggacgagtcccgggaccccagcggcgtccccgctacggcagcagccgccggcgtccacgacggac
atggaccgggtgaaagaggccctccgagacacggccaacgagttcgagctgcgatacgcccgcgccttcaacgacctgca
cagccagctgcacatcacgcccgccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtca
actgggggcgcatcgtgggactcttcgcgttcggcggcgcgctgtgtgtagagtgcgtggagaaggagatgagtcccctg
gtggtcaggatcgtggagtggatgaccgtctacctggacaaccacattcagccctggatccagagtcagggaggatggga
gcgcttcgccgacatctttgggcacgacgcggcggctgaaagcaggaggttccaggagagctttaggatgtggctgctgg
tgggaatgaccgtgctcacggcggtcgtggcaggctcgctgttcgcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A1A8A2S0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L1 (length=660 residues).
atgccacacagtaacagagagctggtggagtactacatcagctacaagttgtcccaaaggaactgtcccatgtctctgct
ggggccagaggatgggggtaagaagactcgggaggactgggacaattcagctgctagcaatggccggctggtcagcagca
gggacagcccaccagggaagacttgtgccccccgtggtggcatggaggcagtgaaatcagctctaaaggactcagcagat
gagtttgaacttttatacgcacagagttttagtcacctttccctgcagctcgatatcacgccagacacggcctaccacag
cttcaagagcgtgctggacgagctgttcagagatggggtaaactggggacgggtggtgggcctctttgtctttggggggt
tgctgtgtgtgcagtgtaaggagaggaatttaagcgagctggttccccgcattgcagactggatgaccacctacctggat
gatcagatcgggctgtggatcagcagccaaggaggatgggactgttttgcagagatttatgggcgaggagctgcggcaga
ggcaaggaggttccaggagaccctgaagaagtggctgttagcaggagtgctgctgctgtcaggggtgctgctcggtgtgc
tcattgcaaagaaacggtga
© 1998-2021Legal notice