Dataset for CDS BCL2L1 of organism Nothobranchius furzeri

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A1A7ZDF6_BCL2L1-      atgtctcaa---aaccaagaactagttcttttctatattagatataaact
A0A1A8A2S0_BCL2L1-      atgccacacagtaacagagagctggtggagtactacatcagctacaagtt
                        *** * **    ***  *** ** **    * *** ** ** ** **  *

A0A1A7ZDF6_BCL2L1-      gtcacagaggaactatcccctcaaccacatagtcctcaatgaccccctaa
A0A1A8A2S0_BCL2L1-      gtcccaaaggaactgtccc-------------------atgtctc-----
                        *** ** ******* ****                   *** * *     

A0A1A7ZDF6_BCL2L1-      acaggactggtgcgggggatgcggtggtggggggtgaggag----gagag
A0A1A8A2S0_BCL2L1-      ----------tgctggggc--cagaggatgggggtaagaagactcgggag
                                  *** ****   * * **  ****** ** **    * ***

A0A1A7ZDF6_BCL2L1-      gacagagacacacgccaatgggacctttaaca--ggacgagtcccgggac
A0A1A8A2S0_BCL2L1-      gactggga-------caattcagctgctagcaatggccgg----ctggtc
                        *** * **       ****    *   ** **  ** **     * ** *

A0A1A7ZDF6_BCL2L1-      cccagcggcgtc--cccgctacggcagcagccgccggcgtccacgacg--
A0A1A8A2S0_BCL2L1-      agcagcagggacagcccaccagggaag-----acttgtgccccccgtggt
                          **** * * *  *** * * ** **      *  * * ** *   *  

A0A1A7ZDF6_BCL2L1-      gacatggaccgggtgaaagaggccctccgagacacggccaacgagttcga
A0A1A8A2S0_BCL2L1-      ggcatggaggcagtgaaatcagctctaaaggactcagcagatgagtttga
                        * ******    ******   ** **    *** * **  * ***** **

A0A1A7ZDF6_BCL2L1-      gctgcgatacgcccgcgccttcaacgacctgcacagccagctgcacatca
A0A1A8A2S0_BCL2L1-      acttttatacgcacagagttttagtcacctttccctgcagctcgatatca
                         **   ****** *     ** *   ****   *   *****  * ****

A0A1A7ZDF6_BCL2L1-      cgcccgccacggcctaccaaagcttcgagaacgtgatggacgaggtgttc
A0A1A8A2S0_BCL2L1-      cgccagacacggcctaccacagcttcaagagcgtgctggacgagctgttc
                        **** * ************ ****** *** **** ******** *****

A0A1A7ZDF6_BCL2L1-      cgggacggcgtcaactgggggcgcatcgtgggactcttcgcgttcggcgg
A0A1A8A2S0_BCL2L1-      agagatggggtaaactggggacgggtggtgggcctctttgtctttggggg
                         * ** ** ** ******** **  * ***** ***** *  ** ** **

A0A1A7ZDF6_BCL2L1-      cgcgctgtgtgtagagtgcgtggagaaggagatgagtcccctggtggtca
A0A1A8A2S0_BCL2L1-      gttgctgtgtgtgcagtgtaaggagaggaatttaagcgagctggttcccc
                           *********  ****   ***** * *  * **    *****   * 

A0A1A7ZDF6_BCL2L1-      ggatcgtggagtggatgaccgtctacctggacaaccacattcagccctgg
A0A1A8A2S0_BCL2L1-      gcattgcagactggatgaccacctacctggatgatcagatcgggctgtgg
                        * ** *  ** *********  *********  * ** **   **  ***

A0A1A7ZDF6_BCL2L1-      atccagagtcagggaggatgggagcgcttcgccgacatctttgggcacga
A0A1A8A2S0_BCL2L1-      atcagcagccaaggaggatgggactgttttgcagagatttatgggcgagg
                        ***   ** ** ***********  * ** ** ** ** * *****  * 

A0A1A7ZDF6_BCL2L1-      cgcggcggctgaaagcaggaggttccaggagagctttaggatgtggctgc
A0A1A8A2S0_BCL2L1-      agctgcggcagaggcaaggaggttccaggagaccctgaagaagtggctgt
                         ** ***** **    **************** * * * ** ******* 

A0A1A7ZDF6_BCL2L1-      tggtgggaatgaccgtgctcacggcggtcgtggcaggctcgctgttcgcg
A0A1A8A2S0_BCL2L1-      tagcaggagtgctgctgctgtcaggggtgctgctcggtgtgctcattgca
                        * *  *** **    ****  * * ***  **   **   ***  * ** 

A0A1A7ZDF6_BCL2L1-      cagaaacgcctgtga
A0A1A8A2S0_BCL2L1-      aagaaacg---gtga
                         *******   ****

© 1998-2021Legal notice