Dataset for CDS BAX-like of Organism Electrophorus electricus

[Download (right click)] [Edit] [Sequences] [Repertoires]

7 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A4W4EE96_BOK-01      atgaa------------------ggggatgga-ggtgttgcgccgctcgt
A0A4W4H2R3_BOK-02      ------------------------------------------attctaat
A0A4W4H2R3_BOK-01      atgaa-------------------------------------ctccttca
A0A4W4H2R3_BOK-03      atgaatcgggtatttttcagtgaacaaataac-tgggtcgttttccttga
A0A4W4GLW7_BAX-01      atggcagacgctcatgaaaacgatagaacggacgacggtgaatcgttagg
A0A4W4E583_BAX-01      atggcggcgcc---------------atcgggcgaaggcga---------
A0A4W4E583_BAX-02      cgtttaactac---------------accagac-----------------
                                                                         

A0A4W4EE96_BOK-01      cggtgttcgcagc---------agaagtgatggaggtgtttgatc--gct
A0A4W4H2R3_BOK-02      gctgcaacgc-at---------gaatgaaatggaattgttcaacc--gaa
A0A4W4H2R3_BOK-01      aacgcagtaaaat---------aaaacagatggaattgttcaacc--gaa
A0A4W4H2R3_BOK-03      cgttcgtcgctgt---------ggtggagatggaattgttcaacc--gaa
A0A4W4GLW7_BAX-01      agccacgggcggcgaagatgttacggatgataggattatagaggaaggcg
A0A4W4E583_BAX-01      ---tgtgggcaac---------accaatgaccaaatactacaagtaggaa
A0A4W4E583_BAX-02      -------ggcaac---------accaatgaccaaatactacaagtaggaa
                                                    *        *        *  

A0A4W4EE96_BOK-01      ctccgacagacaaagagctggtctctcaatccaaggtgctgtgtagagac
A0A4W4H2R3_BOK-02      ctttcacggacagagatctagtttcccagtccatgatgctttgtaggtac
A0A4W4H2R3_BOK-01      ctttcacggacagagatctagtttcccagtccatgatgctttgtaggtac
A0A4W4H2R3_BOK-03      ctttcacggacagagatctagtttcccagtccatgatgctttgtaggtac
A0A4W4GLW7_BAX-01      caatagtactgagagggtatgttatcgagcggtt------taatgcggag
A0A4W4E583_BAX-01      cagcactactaaaagactttatctatgagcggattcatcgtcatggggac
A0A4W4E583_BAX-02      cagcactactaaaagactttatctatgagcggattcatcgtcatggggac
                       *          * **      *     *               *    * 

A0A4W4EE96_BOK-01      tacattcactcg-------aggcttagtcgcattggatttggatggtcta
A0A4W4H2R3_BOK-02      ttcatgtgctct-------cgaatcattcgggaaggactcagttggtcaa
A0A4W4H2R3_BOK-01      ttcatgtgctct-------cgaatcattcgggaaggactcagttggtcaa
A0A4W4H2R3_BOK-03      ttcatgtgctct-------cgaatcattcgggaaggactcagttggtcaa
A0A4W4GLW7_BAX-01      aacccagccatg-------caggtgagtccggtggccctcgggggaacag
A0A4W4E583_BAX-01      agcagcgccatggttaccagaagtcagctgggtgggact-----------
A0A4W4E583_BAX-02      agcagcgccatggttaccagaagtcagctgggtgggact-----------
                         *     *              * *        *   *           

A0A4W4EE96_BOK-01      agcctgaccatggactgtc--ttccggaggga-cactcggagaagtctcg
A0A4W4H2R3_BOK-02      aagtggaacctggtctaccagccccagatggagcgcttggagatgtatta
A0A4W4H2R3_BOK-01      aagtggaacctggtctaccagccccagatggagcgcttggagatgtatta
A0A4W4H2R3_BOK-03      aagtggaacctggtctaccagccccagatggagcgcttggagatgtatta
A0A4W4GLW7_BAX-01      ccgacga----gggatccgatccccatgtgaa--------ggaggtcgtc
A0A4W4E583_BAX-01      -----ga----gttatgcgaccccagccataa--------gagacttgca
A0A4W4E583_BAX-02      -----ga----gttatgcgaccccagccataa--------gagacttgca
                            **    *   *       *       *             *    

A0A4W4EE96_BOK-01      tctgtccttctctggttaggtgatgagctagaatacttgcgccccaattt
A0A4W4H2R3_BOK-02      agggtgcttcttaagttaggtgatgaactggattacttgcagccatactt
A0A4W4H2R3_BOK-01      agggtgcttcttaagttaggtgatgaactggattacttgcagccatactt
A0A4W4H2R3_BOK-03      agggtgcttcttaagttaggtgatgaactggattacttgcagccatactt
A0A4W4GLW7_BAX-01      gatcagctccttaggatcgctgatgatctgaaccgc--------------
A0A4W4E583_BAX-01      cagtgtctgcagcagattggtgatgagctggacaac--------------
A0A4W4E583_BAX-02      cagtgtctgcagcagattggtgatgagctggacaac--------------
                             ** *    * * * ****** **  *   *              

A0A4W4EE96_BOK-01      gtatcgcaacgtggctcgccagctgaatatcaccgttgcttcagagagtg
A0A4W4H2R3_BOK-02      gtatcgaaatgttgcaaagcagctcagaatatctgtggcaacggagacca
A0A4W4H2R3_BOK-01      gtatcgaaatgttgcaaagcagctcagaatatctgtggcaacggagacca
A0A4W4H2R3_BOK-03      gtatcgaaatgttgcaaagcagctcagaatatctgtggcaacggagacca
A0A4W4GLW7_BAX-01      -------aacgctgagcttcaacacctgatcaacaccgtggaggccaact
A0A4W4E583_BAX-01      -------aacgtgcagctgcagagtatgataaacgactctgcgctacagc
A0A4W4E583_BAX-02      -------aacgtgcagctgcagagtatgataaacgactctgcgctacagc
                              ** *        **       **                    

A0A4W4EE96_BOK-01      tggtttctgacgcgttccttgccgtagctgcggaaatattctccaca---
A0A4W4H2R3_BOK-02      tggtgatagatgcatttctatctgtagcaacagagatcctctccttgggt
A0A4W4H2R3_BOK-01      tggtgatagatgcatttctatctgtagcaacagagatcctctccttg---
A0A4W4H2R3_BOK-03      tggtgatagatgcatttctatctgtagcaacagagatcctctccttg---
A0A4W4GLW7_BAX-01      gtgctcaggatgtgttcatgacggtggccaggaatatcttcacagat---
A0A4W4E583_BAX-01      ccacgaaagacgtgttcatgaaagtcgcctttgaaatcttctcggat---
A0A4W4E583_BAX-02      ccacgaaagacgtgttcatgaaagtcgcctttgaaatcttctcggat---
                               ** *  **  *    ** **     * **  ** *       

A0A4W4EE96_BOK-01      ------------------------------gggg---tcacatggggtaa
A0A4W4H2R3_BOK-02      aatagagaccttctgcctctgcctcccttaggaa---tcacatggggtaa
A0A4W4H2R3_BOK-01      ------------------------------ggaa---tcacatggggtaa
A0A4W4H2R3_BOK-03      ------------------------------ggaa---tcacatggggtaa
A0A4W4GLW7_BAX-01      ------------------------------ggca---ttaactggggacg
A0A4W4E583_BAX-01      ------------------------------gggaagtttaactggggtag
A0A4W4E583_BAX-02      ------------------------------gggaagtttaactggggtag
                                                     **     * *  *****   

A0A4W4EE96_BOK-01      gattgtgtctctctatgcggtggctggagctttgg----cggtggactgc
A0A4W4H2R3_BOK-02      ggtggtggccatctttgcagtcgcaggaggccttg----cagtggactgt
A0A4W4H2R3_BOK-01      ggtggtggccatctttgcagtcgcaggaggccttg----cagtggactgt
A0A4W4H2R3_BOK-03      ggtggtggccatctttgcagtcgcaggaggccttg----cagtggactgt
A0A4W4GLW7_BAX-01      tgtggtggctctctttcacctggcatatcgactcatctacaaggcactga
A0A4W4E583_BAX-01      agtggtggcacttttctacttcgcttgtcggcttgtcatcaaggctcttg
A0A4W4E583_BAX-02      agtggtggcacttttctacttcgcttgtcggcttgtcatcaaggctcttg
                         * *** *  * *      * **        *      *   *  **  

A0A4W4EE96_BOK-01      gttcgctatggcaacccagccatggttcatgccattgtggattgcatggg
A0A4W4H2R3_BOK-02      gtgagacagggccatccagccatgctgcacaccatagtggagagtcttgg
A0A4W4H2R3_BOK-01      gtgagacagggccatccagccatgctgcacaccatagtggagagtcttgg
A0A4W4H2R3_BOK-03      gtgagacagggccatccagccatgctgcacaccatagtggagagtcttgg
A0A4W4GLW7_BAX-01      ctcagcaaca---ct-ttgaagtcatcaggaccatcattagctgggtatt
A0A4W4E583_BAX-01      -taaccaaag---ttcctgacattatccgaaccatcatcacctgg--act
A0A4W4E583_BAX-02      -taaccaaag---ttcctgacattatccgaaccatcatcacctgg--act
                        *     *          *   *  *     ****  *     *      

A0A4W4EE96_BOK-01      agaattcgtccgcaagagcctagtgtcc--tggttaaagaagagaggagg
A0A4W4H2R3_BOK-02      ggagctagttgggaagagcctggcatcc--tggcttaagaagagaggagg
A0A4W4H2R3_BOK-01      ggagctagttgggaagagcctggcatcc--tggcttaagaagagaggagg
A0A4W4H2R3_BOK-03      ggagctagttgggaagagcctggcatcc--tggcttaagaagagaggagg
A0A4W4GLW7_BAX-01      acagtttatcagggagaacatttcctca--tggatcagacagcagggagg
A0A4W4E583_BAX-01      actgactacttgcgtgataatgtgattaattggatcagggaacagggagg
A0A4W4E583_BAX-02      actgactacttgcgtgataatgtgattaattggatcagggaacagggagg
                                  *   **   *    *    *** * *   *    *****

A0A4W4EE96_BOK-01      atggactgacatcacaaagtgcgtagtcaacacagaccccagcttccgtt
A0A4W4H2R3_BOK-02      atggggggacatttcaaagtgtgtgacaagcttggacaatactgcacaat
A0A4W4H2R3_BOK-01      atggggggacatttcaaagtgtgtgacaagcttggacaatactgcacaat
A0A4W4H2R3_BOK-03      atggggggacatttcaaagtgtgtgacaagcttggacaatactgcacaat
A0A4W4GLW7_BAX-01      atggg------------agggcgtcatccg---------cagcgtgt---
A0A4W4E583_BAX-01      ctggg------------aagg---aatccgctcctacttcggtacgc---
A0A4W4E583_BAX-02      ctggg------------aagg---aatccgctcctacttcggtacgc---
                        ***             *  *                             

A0A4W4EE96_BOK-01      cccattggttgatggtgacagcctgcacgtgcgtacactacctgaaggcc
A0A4W4H2R3_BOK-02      accattggttatcagcagttgtgtcaacctggagacaccttgtgaagact
A0A4W4H2R3_BOK-01      accattggttatcagcagttgtgtcaacctggagacaccttgtgaagact
A0A4W4H2R3_BOK-03      accattggttatcagcagttgtgtcaacctggagacaccttgtgaagact
A0A4W4GLW7_BAX-01      ccaggtggcgcactgtggccctcgttgctgcggtggccttcgtcgcggcc
A0A4W4E583_BAX-01      ctacctggcagactgttggcgtttttctggctggagttctcaccac----
A0A4W4E583_BAX-02      ctacctggcagactgttggcgtttttctggctggagttctcaccac----
                            ***      *                                   

A0A4W4EE96_BOK-01      gtggtcttctatctgctga---gggagaaatga
A0A4W4H2R3_BOK-02      atgtatgtctacctaatga---agtag------
A0A4W4H2R3_BOK-01      atgtatgtctacctaatga---agtag------
A0A4W4H2R3_BOK-03      atgtatgtctacctaatga---agtag------
A0A4W4GLW7_BAX-01      gtcgtgtactggagaaggacccgc------tga
A0A4W4E583_BAX-01      ----tgtactgg----tcattcgcaagatgtga
A0A4W4E583_BAX-02      ----tgtactgg----tcattcgcaagatgtga
                               **        *              

© 1998-2023Legal notice