Dataset for CDS BAX-like of Organism Ficedula albicollis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


U3JLA0_BOK-01       atg------------gaggtgctgcgccgctcctcagtctttgctgcagaggtgatggag
U3JMQ7_BAK1-01      atggcctcggggaatgagggg----gaccctccaca------gctggaggaacgccgggg
                    ***            **** *    * * **** **      **** **    *  ** *

U3JLA0_BOK-01       gtttttgacaggtctcccactga---caaagagc----ttgtgtcccaagccaaggctct
U3JMQ7_BAK1-01      gagcc--acagg-cgccggctcagctcagagggccgggtggcggaggaggctgaggaggt
                    *      ***** * **  ** *   ** ** **    * * *    * **  ***   *

U3JLA0_BOK-01       ctgcagagactacataaactcaaggctgattcaggcaggtgtcagctggagcaaacccga
U3JMQ7_BAK1-01      gttcaggagctacgccttcc----accgctaccagcaggag-cgccaggagcgag---gg
                     * ***   ****     *      * * * *  ***** * *  * ***** *    * 

U3JLA0_BOK-01       gcacaac-gcc-ccagtgcctgggggcaagctggcc------gaggtgtccaccatactg
U3JMQ7_BAK1-01      gcagagctgccgcccgaccccgagatcgagcaaatccagcaggacctggacagcac-cgg
                    *** * * *** ** *  ** * *  * ***    *      **  **  ** **  * *

U3JLA0_BOK-01       ctgagacttggggatgagctggagta-cattcgccccaacgtctacaggaacatcgcccg
U3JMQ7_BAK1-01      cagccaggtggggcagcgcttggccatcatcggcgatgacatctaccggcgctacgac--
                    * *  *  *****  * *** *   * ***  **    ** ***** **  *  ** *  

U3JLA0_BOK-01       ccagctgaacatctctctgcactctgagaccgtggtgtctgacgccttcc--tggcagtg
U3JMQ7_BAK1-01      ---gccgag-----ttccgcaccatg---ctggagagcctgcagcccacccgcgacaacg
                       ** **       ** ****  **   * *  * * ***  ***  **   * **  *

U3JLA0_BOK-01       gctgcacagattttcactgca------------ggcataacgtggggcaaggtggtgtct
U3JMQ7_BAK1-01      cctacg-agaacttcaccaaaatcgcctccagcggcatcaactggggccgggtgatcgcc
                     ** *  ***  *****   *            ***** *  ******  **** *  * 

U3JLA0_BOK-01       ctgtacgccgtggcagccgggctggccgtggactgcgtgcggca-cgcgcagccagccat
U3JMQ7_BAK1-01      ctgctggcctttggctaccgcctggccatgca---cgtgtggcagcgcggggtcagc--g
                    ***   *** * *    * * ****** ** *   **** **** ****  * ****   

U3JLA0_BOK-01       ggttcacac----catcgtggactgcctgggagagtttgtgaggaagac-----------
U3JMQ7_BAK1-01      gcttcctgcggcgcatcgcgcagcacctggcgcagttcatgctgcagaaccgcatcgccc
                    * ***   *    ***** * *   *****   ****  **  * ***            

U3JLA0_BOK-01       -cttggtgacgtggctgaaaaggagaggag----gctgggcagacatcaccaagtgcgtg
U3JMQ7_BAK1-01      gctggatcgcccagcagggaggatggagggccgcgctgcgccgctacaacgaagtttaca
                     ** * *  *   ** *  * *  *  * *    **** ** *  *  ** ****     

U3JLA0_BOK-01       gtgaatactgaccccagccttcgctcccactggc--tcgtggctgctgtttgcagttttg
U3JMQ7_BAK1-01      tcaagtac---------------ctgctggtggccgccgcgg-tgctgctggcacacctg
                       * ***               ** *   ****   ** ** ***** * ***    **

U3JLA0_BOK-01       gt-------cacttcctcaaggccatcttctttgtcctgctgcctgagagatga
U3JMQ7_BAK1-01      gcggtgcggcgcttcctca--------------------cctcctga-------
                    *        * ********                    *  *****       

© 1998-2023Legal notice