Dataset for CDS Unclassified of organism Marmota marmota marmota

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C5YZ00_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Marmota marmota marmota (length=519 residues).
atgtctcagaggaacgtggaactagtgatcaactttctgtcctacacgcttttccagaaaggatacagctggagccagtt
tagccatgaggaagagaaccaccttcaaggcccagaaagggctgaatcagaagaggggcccagcaatgccaccaacagca
acccatcccggcatcaaggggacagtcccatggtgagtggagccgctggccataacaggagtttggatgccccaaacgtg
gtccccatggtagcagtgaagcaagcgctgagggaggcaggcgacaacttgtaccagcaggcattccatgacctgacagc
agagctccgtctcaccccacagacagcacatcacacttttgaacaggaccactgctgctgggacacttttgtgaaacacc
atgtgaataatgcggcagtgaatagctggatgcgccaggagagcttcaactattatttcctgatgggcatgactgtggct
ggcgtggttctgctgggctggctgttcagttggaagtga
>gnl|bcl2dbcds|A0A8C6A7L3_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Marmota marmota marmota (length=450 residues).
atgtggaagagaacaacattgaaggcccaggagggactgaatcagaggtggagcccaccagtgccatcaatggcaaccca
tcctggaatctgcactgagggagcacatcagacctttgaacaggtagtgaagggactcttccaggatgcggtaagctggg
gtcgcattgtggcctttttctcctttggaggaacactgtgtgtggaaagcatagacaaggagatgcaggcactggagagt
cagatccccagttggatggccacttacctgaatgatcacctagagacttgggtccaggacaatggtggctgggatacttt
tgtggaactccatgggaataatgtggcagtgaatagctggaagggccaggagcacttcaaccattgtttcctgatgggca
tgactgtggctggcgtggttctgctgggctggctgttcagttggaaatga
>gnl|bcl2dbcds|A0A8C6EYW0_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Marmota marmota marmota (length=513 residues).
atgcagctccctcatacatccccaaactcagtgatcaatgatgacatattctcacttgctatgcatacacttaggtggct
gagccctgctgaagaaaatcacacactcaagccaattagaggctactgggatgccatcaatggcaacccatcttggcatc
tggtggacagccccatggagagtggagctcctggccataacaggagtttggatgccccagaggcgatccccatggcagca
gtgaagcaagtgctgagggaggcaggtgaaaagtctgaactgcagtaccagcaggcattcagtgacatggcgtccaagct
ccacctcaccctggagacagcacatcagacctttgaacaggacaacgggggctgggacacttttgtggaactccatggga
acaatgtggcagtgaagagctggaagggccaggagcacttcaacctttgtttcctgatgggcatgattgtggctggcgtg
gttctgctgggctggctgttcagtcggagatga
© 1998-2022Legal notice