Dataset for CDS BAX of Organism Kryptolebias marmoratus

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|A0A3Q3AK18_BAX-01 BCL2-associated X gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAX (length=618 residues).
atggctgacggccgagaaaaggacagaatggaggacgagcaggaaccgcggggcgccgagggtggagaagttgtcgctga
tgatcccatattggagcagggagtggtggtcttcagagggtacgtaattgagcgtataaacacagaggaccccggccggc
acgtctcctctgaggatctgggaggaaggtcagatgaacaggaggatcagcagatcaaggatgtggttgatcagctgctt
aaaatagctgatgaactgaacaggaatgtggagttccagagactaatcaatcaggttcaagttaactgtgtaaaagaagt
cttcatgatggtgaccaggagcatcttcgttgatggcatcaactggggtcgggtggtggctctcttccatcttgcctaca
gactcatttacagggctctgaccaccaaccatctggagaacatcagagtcgtcatcagctgggttcttcaggtcatcagg
gagcagctttacccctggctggtagagcagggaggctgggtgggggttatccgaaatttttcccgttggaggaacgtagc
catcgcagcgtcgttagtgttggtggcaacttttgtttactacaggaagacgcactga
>gnl|bcl2dbcds|A0A3Q3AK18_BAX-02 BCL2-associated X gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAX (length=573 residues).
atggctgacggccgagaaaaggacagaatggaggacgagcaggaaccgcggggcgccgagggtggagaaggtacgtacgt
aattgagcgtataaacacagaggaccccggccggcacgtctcctctgaggatctgggaggaaggtcagatgaacaggagg
atcagcagatcaaggatgtggttgatcagctgcttaaaatagctgatgaactgaacaggaatgtggagttccagagacta
atcaatcaggttcaagttaactgtgtaaaagaagtcttcatgatggtgaccaggagcatcttcgttgatggcatcaactg
gggtcgggtggtggctctcttccatcttgcctacagactcatttacagggctctgaccaccaaccatctggagaacatca
gagtcgtcatcagctgggttcttcaggtcatcagggagcagctttacccctggctggtagagcagggaggctgggtgggg
gttatccgaaatttttcccgttggaggaacgtagccatcgcagcgtcgttagtgttggtggcaacttttgtttactacag
gaagacgcactga
>gnl|bcl2dbcds|A0A3Q3B600_BAX-01 BCL2-associated X gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAX (length=525 residues).
atggcatctgggggagaagaacctgaaggtcgacatgtagaatccattacattgtccagagaggacctgggttcagaaga
gctgacggaatcaaaccacaaggaggtcgctcagaccatgcagctgatcgcagatgatctggatcgaaatgtacagctac
aaacaatgataaatgatccttcaatccgaccttcatttgaagtgtttatgaacatcgcctccgtgattttttctgatgga
aagttcaactggttcagagtggttacgttcttttactttgtctctaaacttgtcatcagagcttataaaccccaaattct
ggaactcgtcagaaaaataatcaactgggccatcgactacctccaggacaatctgatcaactggataagagagcaaggtg
gctgggagggaatttattcctactttagcaccctgacattgcagacctggttcgttttcctggctgggattttcaccgct
attgggatgggagcaaaaaaaaaccagaagaggatgacagggtga
>gnl|bcl2dbcds|A0A3Q3B600_BAX-02 BCL2-associated X gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAX (length=564 residues).
ttagcattacacgaggggataaatcaaaagagcatatttttattgtgtttctgtgtctttctgtgtagttttatcttcag
atatattcagcgacatgtagaatccattacattgtccagagaggacctgggttcagaagagctgacggaatcaaaccaca
aggaggtcgctcagaccatgcagctgatcgcagatgatctggatcgaaatgtacagctacaaacaatgataaatgatcct
tcaatccgaccttcatttgaagtgtttatgaacatcgcctccgtgattttttctgatggaaagttcaactggttcagagt
ggttacgttcttttactttgtctctaaacttgtcatcagagcttataaaccccaaattctggaactcgtcagaaaaataa
tcaactgggccatcgactacctccaggacaatctgatcaactggataagagagcaaggtggctgggagggaatttattcc
tactttagcaccctgacattgcagacctggttcgttttcctggctgggattttcaccgctattgtggtcatgcggaagat
ctga
>gnl|bcl2dbcds|A0A3Q3B600_BAX-03 BCL2-associated X gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAX (length=576 residues).
aacagatcagatcctggatctgggaatcaagctgttaaaagaagcatatttttattgtgtttctgtgtctttctgtgtag
ttttatcttcagatatattcagcgacatgtagaatccattacattgtccagagaggacctgggttcagaagagctgacgg
aatcaaaccacaaggaggtcgctcagaccatgcagctgatcgcagatgatctggatcgaaatgtacagctacaaacaatg
ataaatgatccttcaatccgaccttcatttgaagtgtttatgaacatcgcctccgtgattttttctgatggaaagttcaa
ctggttcagagtggttacgttcttttactttgtctctaaacttgtcatcagagcttataaaccccaaattctggaactcg
tcagaaaaataatcaactgggccatcgactacctccaggacaatctgatcaactggataagagagcaaggtggctgggag
ggaatttattcctactttagcaccctgacattgcagacctggttcgttttcctggctgggattttcaccgctattgtggt
catgcggaagatctga
>gnl|bcl2dbcds|A0A3Q3BJ60_BAX-01 BCL2-associated X gene OS=[Eukaryota] Kryptolebias marmoratus GN=BAX (length=579 residues).
atggcatcgcagggtggcggcgatcaaggaaactccaaagatcagatcgtagaagtaggaactttattgttaaaggattt
catctatgagcgggtgcggcgacacggaggtggcggtgatgctgtagtgacgagggaacagctgggggcagcagagctgt
gtgacccgaaccacaagaagctcgctcagtgcctacagcagattggagatgagctggacggaaatgtagagctacaaagg
atgataaatgactcgtcacttagtccctcgaaggacatctttatgagagttgccattgagatcttttcagacggaaaatt
caactggggcagggtggttgcactcttttactttgcctgtcgactcgtcatcaaagctcttattaccaaaattcctgaaa
tcatcagaactataatcaactggaccatggactacctccgggaaaatgtgatcaactggataagagatcaaggtggctgg
gagggtattcgttcccattttggcactccgacatggcagacggtgggagttttcctggccggcgttcttaccactgttct
agtcatgcgcaagatgtga
© 1998-2023Legal notice