Dataset for CDS BAX of Organism Kryptolebias marmoratus

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q3AK18_BAX-01      atggctgacggccgagaaaaggacagaatggaggacgagcaggaacc---
A0A3Q3AK18_BAX-02      atggctgacggccgagaaaaggacagaatggaggacgagcaggaacc---
A0A3Q3BJ60_BAX-01      atggca--------------tcgcagggtggcggcgatcaaggaaactcc
A0A3Q3B600_BAX-01      atggca--------------tctggggg-----------agaagaac---
A0A3Q3B600_BAX-02      ttagca---------ttacacgaggggataaatc-----aaaagagc---
A0A3Q3B600_BAX-03      --aacagatcagatcctggatctgggaatcaagctgttaaaagaagc---
                           *                    *                  * *   

A0A3Q3AK18_BAX-01      ------------------gcggggcgccgagggtggagaagttgtcgctg
A0A3Q3AK18_BAX-02      ------------------gcggggcgccgagggtggagaaggtac-----
A0A3Q3BJ60_BAX-01      aaagatcagatcgtagaagtaggaactttattgttaaaggatttc-----
A0A3Q3B600_BAX-01      --------------------------------------------------
A0A3Q3B600_BAX-02      -atatttttattgtgtttctgtgtctttctgtgt-----agtttt-----
A0A3Q3B600_BAX-03      -atatttttattgtgtttctgtgtctttctgtgt-----agtttt-----
                                                                         

A0A3Q3AK18_BAX-01      atgatcccatattggagcagggagtggtggtcttcagagggtacgtaatt
A0A3Q3AK18_BAX-02      ----------------------------------------gtacgtaatt
A0A3Q3BJ60_BAX-01      ----------------------------------------atctatgagc
A0A3Q3B600_BAX-01      ------------------------------------------ctgaaggt
A0A3Q3B600_BAX-02      ----------------------------------------atcttcagat
A0A3Q3B600_BAX-03      ----------------------------------------atcttcagat
                                                                         

A0A3Q3AK18_BAX-01      gagcgtataaacacagaggaccccgg---ccggcacgtctcctctgagga
A0A3Q3AK18_BAX-02      gagcgtataaacacagaggaccccgg---ccggcacgtctcctctgagga
A0A3Q3BJ60_BAX-01      gggtgcggcgacacggaggtggcggtgatgctgta-gtgacgagggaaca
A0A3Q3B600_BAX-01      --------cgacatgtagaatcc------attaca-ttgtccagagagga
A0A3Q3B600_BAX-02      atattcagcgacatgtagaatcc------attaca-ttgtccagagagga
A0A3Q3B600_BAX-03      atattcagcgacatgtagaatcc------attaca-ttgtccagagagga
                                 ***   **    *           *  *  *    **  *

A0A3Q3AK18_BAX-01      tctgggaggaaggtcagatgaacaggaggatcagcagatcaaggatgtgg
A0A3Q3AK18_BAX-02      tctgggaggaaggtcagatgaacaggaggatcagcagatcaaggatgtgg
A0A3Q3BJ60_BAX-01      gctgg------gggcagcagagctgtgtgacccgaaccacaagaagctcg
A0A3Q3B600_BAX-01      cctgg------gttcagaagagctgacggaatcaaaccacaaggaggtcg
A0A3Q3B600_BAX-02      cctgg------gttcagaagagctgacggaatcaaaccacaaggaggtcg
A0A3Q3B600_BAX-03      cctgg------gttcagaagagctgacggaatcaaaccacaaggaggtcg
                        ****      *  ***  ** * *   **     *   **** *  * *

A0A3Q3AK18_BAX-01      ttgatcagctgcttaaaatagctgatgaactgaacaggaatgtggagttc
A0A3Q3AK18_BAX-02      ttgatcagctgcttaaaatagctgatgaactgaacaggaatgtggagttc
A0A3Q3BJ60_BAX-01      ctcagtgcctacagcagattggagatgagctggacggaaatgtagagcta
A0A3Q3B600_BAX-01      ctcagaccatgcagctgatcgcagatgatctggatcgaaatgtacagcta
A0A3Q3B600_BAX-02      ctcagaccatgcagctgatcgcagatgatctggatcgaaatgtacagcta
A0A3Q3B600_BAX-03      ctcagaccatgcagctgatcgcagatgatctggatcgaaatgtacagcta
                        * *     * *     ** *  ***** *** *  * *****  ** * 

A0A3Q3AK18_BAX-01      cagagactaatcaatcaggttcaagttaactgtgtaaaagaagtcttcat
A0A3Q3AK18_BAX-02      cagagactaatcaatcaggttcaagttaactgtgtaaaagaagtcttcat
A0A3Q3BJ60_BAX-01      caaaggatgataaatgactcgtcacttagtccctcgaaggacatctttat
A0A3Q3B600_BAX-01      caaacaatgataaatgatccttcaatccgaccttcatttgaagtgtttat
A0A3Q3B600_BAX-02      caaacaatgataaatgatccttcaatccgaccttcatttgaagtgtttat
A0A3Q3B600_BAX-03      caaacaatgataaatgatccttcaatccgaccttcatttgaagtgtttat
                       ** *   * ** *** *      * *             **  * ** **

A0A3Q3AK18_BAX-01      gatggtgaccaggagcatcttcgttgatggca---tcaactggggtcggg
A0A3Q3AK18_BAX-02      gatggtgaccaggagcatcttcgttgatggca---tcaactggggtcggg
A0A3Q3BJ60_BAX-01      gagagttgccattgagatcttttcagacggaaaattcaactggggcaggg
A0A3Q3B600_BAX-01      gaacatcgcctccgtgattttttctgatggaaagttcaactggttcagag
A0A3Q3B600_BAX-02      gaacatcgcctccgtgattttttctgatggaaagttcaactggttcagag
A0A3Q3B600_BAX-03      gaacatcgcctccgtgattttttctgatggaaagttcaactggttcagag
                       **   *  **      ** **    ** ** *   ********    * *

A0A3Q3AK18_BAX-01      tggtggctctcttccatcttgcctacagactcatttacagggctctgacc
A0A3Q3AK18_BAX-02      tggtggctctcttccatcttgcctacagactcatttacagggctctgacc
A0A3Q3BJ60_BAX-01      tggttgcactcttttactttgcctgtcgactcgtcatcaaagctcttatt
A0A3Q3B600_BAX-01      tggttacgttcttttactttgtctctaaacttgtcatcagagcttataaa
A0A3Q3B600_BAX-02      tggttacgttcttttactttgtctctaaacttgtcatcagagcttataaa
A0A3Q3B600_BAX-03      tggttacgttcttttactttgtctctaaacttgtcatcagagcttataaa
                       ****  *  ****  *  *** **    ***  *   **  ***   *  

A0A3Q3AK18_BAX-01      accaaccatctggagaacatcagagtcgtcatcagctgggttcttcaggt
A0A3Q3AK18_BAX-02      accaaccatctggagaacatcagagtcgtcatcagctgggttcttcaggt
A0A3Q3BJ60_BAX-01      accaaaattcctgaaatcatcagaactataatcaactggaccatggacta
A0A3Q3B600_BAX-01      ccccaaattctggaactcgtcagaaaaataatcaactgggccatcgacta
A0A3Q3B600_BAX-02      ccccaaattctggaactcgtcagaaaaataatcaactgggccatcgacta
A0A3Q3B600_BAX-03      ccccaaattctggaactcgtcagaaaaataatcaactgggccatcgacta
                        ** *   **  **   * *****    * **** ****    *  *   

A0A3Q3AK18_BAX-01      catcagggagcagctttacccctggctggtagagcagggaggctgggtgg
A0A3Q3AK18_BAX-02      catcagggagcagctttacccctggctggtagagcagggaggctgggtgg
A0A3Q3BJ60_BAX-01      cctccgggaaaatgtgatcaactggataagagatcaaggtggctgggagg
A0A3Q3B600_BAX-01      cctccaggacaatctgatcaactggataagagagcaaggtggctgggagg
A0A3Q3B600_BAX-02      cctccaggacaatctgatcaactggataagagagcaaggtggctgggagg
A0A3Q3B600_BAX-03      cctccaggacaatctgatcaactggataagagagcaaggtggctgggagg
                       * **  ***  *  *   *  **** *   *** ** ** ******* **

A0A3Q3AK18_BAX-01      gggttatccgaaatttttcccgttggaggaacgtagccatcgcag-cgtc
A0A3Q3AK18_BAX-02      gggttatccgaaatttttcccgttggaggaacgtagccatcgcag-cgtc
A0A3Q3BJ60_BAX-01      g----------tattcgttcccattttggcactccgacatggcagacggt
A0A3Q3B600_BAX-01      g----------aatttattcctactttagcaccctgacattgcagacctg
A0A3Q3B600_BAX-02      g----------aatttattcctactttagcaccctgacattgcagacctg
A0A3Q3B600_BAX-03      g----------aatttattcctactttagcaccctgacattgcagacctg
                       *           ***  * **       * **   * *** **** *   

A0A3Q3AK18_BAX-01      gttagtgttggtggc--aacttttgtttacta------------------
A0A3Q3AK18_BAX-02      gttagtgttggtggc--aacttttgtttacta------------------
A0A3Q3BJ60_BAX-01      gggagttttcctggccggcgttcttaccactgttctagt-----------
A0A3Q3B600_BAX-01      gttcgttttcctggctgggattttcaccgctattgggatgggagcaaaaa
A0A3Q3B600_BAX-02      gttcgttttcctggctgggattttcaccgctattgtggt-----------
A0A3Q3B600_BAX-03      gttcgttttcctggctgggattttcaccgctattgtggt-----------
                       *   ** **  ****     ** *     **                   

A0A3Q3AK18_BAX-01      ----caggaagacgca------ctga
A0A3Q3AK18_BAX-02      ----caggaagacgca------ctga
A0A3Q3BJ60_BAX-01      ----catgcgcaagat------gtga
A0A3Q3B600_BAX-01      aaaaccagaagaggatgacagggtga
A0A3Q3B600_BAX-02      ----catgcggaagat------ctga
A0A3Q3B600_BAX-03      ----catgcggaagat------ctga
                           *  *   * *         ***

© 1998-2023Legal notice