Dataset for CDS BCL2L1 of organism Canis lupus familiaris

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C0TGM4_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
Q76LT7_BCL2L1-01        atgtctcagagcaaccgggagctggtggttgactttctctcctacaagct
                        **************************************************

A0A8C0TGM4_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
Q76LT7_BCL2L1-01        ttcccagaaaggatacagctggagtcagtttagtgatgtggaagagaaca
                        **************************************************

A0A8C0TGM4_BCL2L1-      gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
Q76LT7_BCL2L1-01        gaactgaggccccagaagggactgaatcagagatggagacccccagtgcc
                        **************************************************

A0A8C0TGM4_BCL2L1-      atcaatggcaacccatcctggcacttggcagacagccctgcggtgaatgg
Q76LT7_BCL2L1-01        atcaatggcaacccatcctggcacttggcagacagccctgcggtgaatgg
                        **************************************************

A0A8C0TGM4_BCL2L1-      agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
Q76LT7_BCL2L1-01        agccactggccacagcagcagcttggatgcccgggaggtgatccccatgg
                        **************************************************

A0A8C0TGM4_BCL2L1-      cagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgagg
Q76LT7_BCL2L1-01        cagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgagg
                        **************************************************

A0A8C0TGM4_BCL2L1-      taccggcgggcattcagtgacctgacatcccagcttcacatcaccccagg
Q76LT7_BCL2L1-01        taccggcgggcattcagtgacctgacatcccagcttcacatcaccccagg
                        **************************************************

A0A8C0TGM4_BCL2L1-      gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
Q76LT7_BCL2L1-01        gacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
                        **************************************************

A0A8C0TGM4_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
Q76LT7_BCL2L1-01        gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
                        **************************************************

A0A8C0TGM4_BCL2L1-      tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
Q76LT7_BCL2L1-01        tgcgtggagagcgtagacaaggagatgcaggtattggtgagtcggatcgc
                        **************************************************

A0A8C0TGM4_BCL2L1-      agcttggatggccacttacctgaatgaccacctagagccttggatccagg
Q76LT7_BCL2L1-01        agcttggatggccacttacctgaatgaccacctagagccttggatccagg
                        **************************************************

A0A8C0TGM4_BCL2L1-      agaacggcggctgggatacttttgtggaactctacgggaacaatgcagca
Q76LT7_BCL2L1-01        agaacggcggctgggatacttttgtggaactctacgggaacaatgcagca
                        **************************************************

A0A8C0TGM4_BCL2L1-      gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacagg
Q76LT7_BCL2L1-01        gccgagagccggaagggccaggagcgcttcaaccgctggttcctgacagg
                        **************************************************

A0A8C0TGM4_BCL2L1-      catgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaat
Q76LT7_BCL2L1-01        catgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaat
                        **************************************************

A0A8C0TGM4_BCL2L1-      ga
Q76LT7_BCL2L1-01        ga
                        **

© 1998-2023Legal notice