Dataset for CDS BCL-2 of organism Vombatus ursinus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A4X2L5Q0_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Vombatus ursinus GN=BCL-2 (length=771 residues).
atggctcaccctggaagaagagggtacgataatcgggagatagtgatgaagtacattcattataagttgtcacagagagg
gtacgagtgggatgctggaaatctgagggcaccagcctctccaagccttccttctgttgttgcttctgcccctgctgttg
gggtcttctctacccagccaagacatacacctctgcctgctgaaccccaggacttggccacttctacgactgctgctgct
agaaactcacctttgcctcctcctcctgccgttgctgctgctactgctgccgctggacctgctgtcagtccagtgccacc
tgtggtccacctgacccttcgtcaagctggagatgatttctctcgaaggtaccggagagactttgatgaaatgtcaggtc
agctgcacctgacccctgttactgctaggggacgctttgccacagtggtggaggagttgttcagggatggggtgaactgg
gggcggatcgtggccttctttgaatttggtggtgtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtgga
cagcattgccctgtggatgactgagtacctgaaccggcacctgcacaactggatccaggataatggaggatgggtagcaa
aggttttctctatgttttcctttacttttctttcccccttccctttcacaccccactggacgacccctttccatcaacgt
ggtttcaaagtattgttgcaagtgaagcatttactaacttgtgccttctga
© 1998-2020Legal notice