Dataset for CDS BCL2L2 of organism Nomascus leucogenys

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2I3GEA7_BCL2L2-      -------------------------------gggctgcg--ggcgg---t
A0A2I3GEA7_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
A0A2I3GEA7_BCL2L2-      atggcgaccccagcctcggccccagacacacgggctctggtggcagactt
                                                       *****  *  *** *   *

A0A2I3GEA7_BCL2L2-      tcggggctccgggccggggcggcggcgccatct-tgt-------gccccg
A0A2I3GEA7_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
A0A2I3GEA7_BCL2L2-      tgtaggttataagctgaggcagaagggttatgtctgtggagctggccccg
                        *   ** *    ** * *** *  * *  ** * ***       ******

A0A2I3GEA7_BCL2L2-      ggg-----ccggtggggaggccggggaggggggccccgggggc-------
A0A2I3GEA7_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A2I3GEA7_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                        ***     ** *  *     ***  *      ***  * ****       

A0A2I3GEA7_BCL2L2-      ------ctgaggagctgctgctggagc-------ccgagccgg-------
A0A2I3GEA7_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
A0A2I3GEA7_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctctgatctggcggctca
                               *   ** * *** * ** **       * ** * **       

A0A2I3GEA7_BCL2L2-      ---------------agcccgagcccgaagaggagccgccccggcccc--
A0A2I3GEA7_BCL2L2-      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
A0A2I3GEA7_BCL2L2-      gctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccg
                                       ** *  ***** *  * *   * *** ** * *  

A0A2I3GEA7_BCL2L2-      ----------------gcgcccccccgggagctccgggccctg-ggcctg
A0A2I3GEA7_BCL2L2-      atgaactttttcaagggggccccaactggggcc----gccttgtagcctt
A0A2I3GEA7_BCL2L2-      atgaactttttcaagggggccccaactggggcc----gccttgtagcctt
                                        * *****  * ** **     *** **  **** 

A0A2I3GEA7_BCL2L2-      gttcg-----ggagc--ccccggcagccaagag-------gaggaggagg
A0A2I3GEA7_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
A0A2I3GEA7_BCL2L2-      ctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatgg
                         ** *     ** **  * * *   **  ****        *****  **

A0A2I3GEA7_BCL2L2-      agcc------gggac--------tggtcgagggtgacccg---ggggacg
A0A2I3GEA7_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacttggagacg
A0A2I3GEA7_BCL2L2-      aaccactggtgggacaagtgcaggagtggatggtggcctacttggagacg
                        * **      *****          ** ** **** **     ** ****

A0A2I3GEA7_BCL2L2-      gcgc-------------------cattgaggacccggagctggaagctat
A0A2I3GEA7_BCL2L2-      cggctggctgactggatccacagcagtgggggctgggagctggaagctat
A0A2I3GEA7_BCL2L2-      cggctggctgactggatccacagcagtgggggctgggcg------gagtt
                          **                   ** ** ** *  ** *      *   *

A0A2I3GEA7_BCL2L2-      caaagctcgagtcagggagatgga---ggaagaagctgagaagctaaagg
A0A2I3GEA7_BCL2L2-      caaagctcgagtcagggagatgga---ggaagaagctgagaagctaaagg
A0A2I3GEA7_BCL2L2-      cacagctctatacggggacggggccctggaggaggcgcggcgtctgcggg
                        ** ***** *  * ****   **    *** ** **   *   **   **

A0A2I3GEA7_BCL2L2-      agctacagaacgaggtagagaagcagatgaatatgagtccacctccaggc
A0A2I3GEA7_BCL2L2-      agctacagaacgaggtagagaagcagatgaatatgagtccacctccaggc
A0A2I3GEA7_BCL2L2-      ag---------------gggaactgggcatcagtgag----------gac
                        **               * ***   *       ****          * *

A0A2I3GEA7_BCL2L2-      aatgctggcccagtgatcatgtccattgaggagaagatggaggctgatgc
A0A2I3GEA7_BCL2L2-      aatgctggcccagtgatcatgtccattgaggagaagatggaggctgatgc
A0A2I3GEA7_BCL2L2-      agtgctgac-----------------------------gggggccg----
                        * ***** *                             ** *** *    

A0A2I3GEA7_BCL2L2-      ccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagc
A0A2I3GEA7_BCL2L2-      ccgttccatctatgttggcaatgtggactatggtgcaacagcagaagagc
A0A2I3GEA7_BCL2L2-      ---------------tggcactgggggccctggt----------------
                                       ***** ** ** *  ****                

A0A2I3GEA7_BCL2L2-      tggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactc
A0A2I3GEA7_BCL2L2-      tggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactc
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3GEA7_BCL2L2-      tgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctc
A0A2I3GEA7_BCL2L2-      tgtgacaaatttagtggccatcccaaagggtttgcatatatagagttctc
A0A2I3GEA7_BCL2L2-      ------aactgtaggggcctt-----------------------------
                              ** * *** **** *                             

A0A2I3GEA7_BCL2L2-      agacaaagagtcagtgaggacttccttggccttagatgagtccctgttta
A0A2I3GEA7_BCL2L2-      agacaaagagtcagtgaggacttccttggccttagatgagtccctgttta
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3GEA7_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2I3GEA7_BCL2L2-      gaggaaggcaaatcaaggtgatcccaaaacgaaccaacagaccaggcatc
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3GEA7_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2I3GEA7_BCL2L2-      agcacaacagaccggggttttccacgagcccgctaccgcgcccggaccac
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3GEA7_BCL2L2-      caactacaacagttcccgctctcgattctacagtggttttaacagcaggc
A0A2I3GEA7_BCL2L2-      caactacaacagttcccgctctcgattctacagtggttttaacagcaggc
A0A2I3GEA7_BCL2L2-      ------------------------------------ttttgctagcaag-
                                                            ****   **** * 

A0A2I3GEA7_BCL2L2-      cccggggtcgcgtctacaggggccgggctagagcgacatcatggtattcc
A0A2I3GEA7_BCL2L2-      cccggggtcgcgtctacaggggccgggctagagcgacatcatggtattcc
A0A2I3GEA7_BCL2L2-      --------------------------------------------------
                                                                          

A0A2I3GEA7_BCL2L2-      ccttactaa
A0A2I3GEA7_BCL2L2-      ccttactaa
A0A2I3GEA7_BCL2L2-      ------tga
                              * *

© 1998-2020Legal notice