Dataset for CDS BCL-2-like of organism Oncorhynchus tshawytscha

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A8C8CMB3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=888 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgactccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgatttagatgaccgatgcgatgacatgagtttcat
caattctgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagattggcaggggacactgcattgagtctgtgggccaaaagatcaccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcaggaattcag
cagattag
>gnl|bcl2dbcds|A0A8C8CMB3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=1401 residues).
atgagtctgtcgaagtcgattacacgagccacaactacgatgttgaattttcaaaatggagtcgttggaggctcttcgta
ccctgctggtacctctttgtactatttcggcgagactggggctgtacgtgctggggcgtcaccgaagtcaaaagtggata
ctgacttgggtaatgggactggcgacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaacgtcctg
ggtaatcatttgtcagaccgaagcaacaatgacgactctgacggttctttgccctgcactcctcagatggcgtcagaatg
tgggcctgaactatcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaactaattgaaaacgtattgg
tggactatacaggactgactccgtctcgttgtaagcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatata
atagcaaagcaccgatacgcatacaatggtatgatcgccaaacttgatttagatgaccgatgcgatgacatgagtttcat
caattctgtggccaagaccctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggcatttggagcag
tggtgagccagcacttgaaggagattggcaggggacactgcattgagtctgtgggccaaaagatcaccacatacctcctc
tctgaccaaagggactggctggtcaaaaacaatgcttggaatggatttgtagagttctttcatgtgcaagatccagagtc
ctcagtaaggaacaccctcatagcctttgctggatttgctgggcttggggcaactctcgccatgttgatcagccaaccac
caatacagaatcaaatacctgtagctcaggagtggattactagcatacctgtggtggtgttctcttcacccagtggttgc
aagcacactcattacagaataacacctcacctaaggggtgtcagtgtaaatgacgttgggtccttgagccgccacaggct
cccctgcctcagccggctcatcgggctttcatgcctcagccggatcgccagactcccctgcctcagccggctcatcgggc
tttcatgcctctgccagatcgcaagactcccctgcttccaccggcttgtcaggatctcatgcctcagccggtctgtcagg
ttcccgcgccccagccggctcgacaggttcccgcgcctcagccgacgtgacaggtttccacgcttcagcaggggtcacca
atctgctcctgatccctgggtttgtctcccttatcggcgccctgcggctggagccgcgcgtcggggagggggcagtgtca
cgtatactctctctccgacctctaggtcatcaggctgctga
>gnl|bcl2dbcds|A0A8C8D057_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=702 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacacacc
ccaatggcacagtgaacgggacgagtcctgggactccaccgcgacagtctccccccttgtcccctcagcggacaatgggc
ctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtc
ctcccagctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtga
actggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccacta
gtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatggga
ccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgctgg
cggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8D057_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacac
accccaatggcacagtgaacgggacgagtcctgggactccaccgcgacagtctccccccttgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtg
tgaactggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
tggcggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8FJG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtatactatatcacctataaactatcacagagggactaccctttcaacca
catggagctcacagaagcccagaattgtactgagggggggcaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggtaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgccgagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttctggcggggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8GL24_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=687 residues).
atgatggcaaacgagaatccttataacagtcgctttattgtcgaaaaatacatccatcacaaactgttgaaagtgggatt
tgtatggaaatttcaaggagaaaacgattctccaaataatggctttggggacccctctacacccaactcccccgaagttt
ttgcacggaggtcccagcccactgccgcgggagaggacaccgactctccttaccaaaacagcagtccgcaacctgaccca
catgccaggctccacagggtcctgcgcgaggctggtggcgagattgaaagaatgtatcagcgggactttgcagagatgtc
ggggcagttgcattttacacccagcacggcacagagaaggtttaccgctgtaatagatgagctcttcagcgacggggtaa
actggggtcggattgtggctttctttgagtttggagggacaatgtgcgtggagagcgtcaaccgggagatgacgtcccaa
gtagacaacatcgctcgttggatgacggagtacttgaacggacccctacagaactggatccaggagaatggtggctggga
cgcctttgtggagatctatgagcagcagaggatctctcactcctggtcgtacttaaagacagtgttcggcctggccgccc
tgggagccgccggagtcaccatcggagccttgttcacccagaagtga
>gnl|bcl2dbcds|A0A8C8GSY4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggagatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatctttggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C8GSY4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=720 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggagatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatctttggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacatacattctttccaaatggacacttga
>gnl|bcl2dbcds|A0A8C8J941_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacagactgagggagatgaggccatttcaaatgggtctgtggggaactactggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcggtggatgag
tttgagctgcgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccatagctt
tgagagtgtgatggacgaagtgttcagggacggtgtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagattggatgaccacatacctggataac
catatccagccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
>gnl|bcl2dbcds|A0A8C8JWJ1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=675 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttgncacggcggtgccacgggg
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtag
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatggcggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatgggaggcctttgttgagctcta
tgacagacagagggactccgtgttcggttcatggccgtccatcaagactgtctttggcctggctgcactgggggccgcaa
gccttaccatcggagcttaccttacacagaagtga
>gnl|bcl2dbcds|A0A8C8JWJ1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL-2 (length=810 residues).
atggcaaacgacgacaaccgctgtatagtggaaaagtacatttgtcacaaactcttgaaaaggggatatgcgtgggattt
cgagaatgccgaggaagatgctgataataatgggtcgatgatttctcctccgcctggtttgncacggcggtgccacgggg
ccaataacgccagaccgggcagcgtcccccatctttccaaacggctctcccaaacggacccgcatgcagctattcacaga
gttttgcgtgaggccggggacgaactcgaacgactgtaccagcccgactttgcggagatgtcacaccaattgtatctcac
gtcttctatggcagaaaggagattcagagaggtgatagacgagctgttcagggacggggttaactggggacgaattgtag
ccttcttcgagttcggtggcacaatatgtgtggaatgcgtgaacaaggaaatgacgtcgcaggttgaccacatcgccggg
tggatggcggagtatctaaatggaccgctgcacaactggattcaagagaacgggggatggatctgcaggcacttccaaag
gagactccccagaggagaccccccagaggagaccccccaaagggaccccccagaggagaccccccagggagactcccaaa
gtagaccccccaaagggactccccagaggagacccccacaggagaccccccagagggaccccccaaggagaccccccaaa
ggagaccccccgaggaggaccccccagaggagaccccccagaggagacaccccagcaagctttgaacatgggaatacaca
cactgcttga
>gnl|bcl2dbcds|A0A8C8LPV9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=MCL-1 (length=849 residues).
atgagtctgtcgaagtcgattgcacgagccacaactacgatgttgcattttcaaaatggaggatcttcgtacctagctga
tgatgctagccctttgtactatttcgacggggccgtatgtgctggggcgtcaccgaagtctaaagtggacttgggaaatg
ggactggcgatactccacgacccacgacgttaggaatgaatgtcgtgaaaaccaacgtcctcgataatcatttgtcagac
cgaagcaacaatgacgattctttgccctgcactcctcagatggcgtcagaatgtgggcctgaactatcgaattgtccatc
gggcgatgaagtattggaacatgataccagacaactcattgagaattttttgggggactacacaggactgtctcagcctc
gatggaagcaaagcaagcctcttacgaccatgaagcgagtggtggaggacgtaatagcaaagcaccgatatgcatacaat
ggtatggtcgtcaaacttgacttggatgatcgatgcgatgacatgagcgtcgtcaattctgtggccaagaccatgttcag
tgatgggatcacgaactggggtcgcatcgccagcctggtggcatttggcgcagtggtgagccagcacctgaaggagagtg
gcaggggacactgcgttgatttggtgggccaagagattgccacatacctcctctctgaccaaagggactggctggtcaaa
aacaatgcttggaatggatttgtagagttctttcatgttcaagatcctgagtcctcggtaaggaacaccctcctagcctt
tgctggagttgctgggattggggcaacacttgccatgttgatcaggtga
© 1998-2023Legal notice