Dataset for CDS BCL-2-like of organism Oncorhynchus tshawytscha

[Download (right click)] [Edit] [Sequences] [Repertoires]

12 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C8JWJ1_BCL2-01      ---a---tggc------------------------aaacgacgac-----
A0A8C8JWJ1_BCL2-02      ---a---tggc------------------------aaacgacgac-----
A0A8C8GL24_BCL2-01      atga---tggc------------------------aaacgagaat-----
A0A8C8LPV9_MCL1-01      atgagtctgtcgaagtcgattgcacgagccac----aactacgatgttgc
A0A8C8CMB3_MCL1-01      atgagtctgtcgaagtcgattacacgagccac----aactacgatgttga
A0A8C8CMB3_MCL1-02      atgagtctgtcgaagtcgattacacgagccac----aactacgatgttga
A0A8C8J941_BCL2L1-      ---a---tgtc--------ttacagtaacagg---gaact--ggtggtgt
A0A8C8GSY4_BCL2L1-      ---a---tgtc--------ttacagtaacagg---gaact--ggtggtgt
A0A8C8GSY4_BCL2L1-      ---a---tgtc--------ttacagtaacagg---gaact--ggtggtgt
A0A8C8FJG7_BCL2L1-      atga---tgac--------ttacaacaacaga---gaact--ggtggtat
A0A8C8D057_BCL2L1-      ---------at--------gtgtattaacctacctgaact--ggtggtat
A0A8C8D057_BCL2L1-      atta---tgac--------ttacaacaacaga---gaact--ggtggtat
                                                            ***           

A0A8C8JWJ1_BCL2-01      ----------------------aaccgctgtatagt------ggaaaagt
A0A8C8JWJ1_BCL2-02      ----------------------aaccgctgtatagt------ggaaaagt
A0A8C8GL24_BCL2-01      -ccttataac------------agtcgctttat----tgtcgaaaaatac
A0A8C8LPV9_MCL1-01      attttcaaaa---------tggaggatcttcgtacctagctgatgatgct
A0A8C8CMB3_MCL1-01      attttcaaaatggagtcgttggaggctcttcgtaccctgctgg------t
A0A8C8CMB3_MCL1-02      attttcaaaatggagtcgttggaggctcttcgtaccctgctgg------t
A0A8C8J941_BCL2L1-      tttttataag-----------------ctatagactgtcccagaggaatt
A0A8C8GSY4_BCL2L1-      tttttataag-----------------ctataaactgtcccagagaaatt
A0A8C8GSY4_BCL2L1-      tttttataag-----------------ctataaactgtcccagagaaatt
A0A8C8FJG7_BCL2L1-      actatatcac-----------------ctataaactatcacagagggact
A0A8C8D057_BCL2L1-      actatattac-----------------ctataaactatcacagagagact
A0A8C8D057_BCL2L1-      actatattac-----------------ctataaactatcacagagagact
                                                   **                     

A0A8C8JWJ1_BCL2-01      acatttgt-cacaaact---cttgaaaaggggatatgcgtgggatttcga
A0A8C8JWJ1_BCL2-02      acatttgt-cacaaact---cttgaaaaggggatatgcgtgggatttcga
A0A8C8GL24_BCL2-01      atccat---cacaaact---gttgaaagtgggatttgtatggaaatttca
A0A8C8LPV9_MCL1-01      agccctttgtactatttcgac------ggggc---cgtatgtg---ctg-
A0A8C8CMB3_MCL1-01      acctctttgtactatttcggcgagactggggc---tgtacgtg---ctg-
A0A8C8CMB3_MCL1-02      acctctttgtactatttcggcgagactggggc---tgtacgtg---ctg-
A0A8C8J941_BCL2L1-      attcatgt-tgtcaattggggctggagggtgcaagtggacaga---ctga
A0A8C8GSY4_BCL2L1-      atccatgt-tgtcagttggtgctggagggtgcaagtggacgga---ctga
A0A8C8GSY4_BCL2L1-      atccatgt-tgtcagttggtgctggagggtgcaagtggacgga---ctga
A0A8C8FJG7_BCL2L1-      accctttc-aaccacatggagctcacagaagcccagaattgta---c---
A0A8C8D057_BCL2L1-      accccttc-aaccacattgggctcacagaagctcccagtcgga---ctga
A0A8C8D057_BCL2L1-      accccttc-aaccacattgggctcacagaagctcccagtcgga---ctga
                        *    *       *  *             *                   

A0A8C8JWJ1_BCL2-01      gaatgccgaggaagatgctgataat--------aatgggtcgatgatttc
A0A8C8JWJ1_BCL2-02      gaatgccgaggaagatgctgataat--------aatgggtcgatgatttc
A0A8C8GL24_BCL2-01      aggagaaaacgattctccaaataat---ggctttggggacc-----cctc
A0A8C8LPV9_MCL1-01      gggcgtcaccgaagtctaaagtg------gacttgggaaatgggactggc
A0A8C8CMB3_MCL1-01      gggcgtcaccgaagtcaaaagtggatactgacttgggtaatgggactggc
A0A8C8CMB3_MCL1-02      gggcgtcaccgaagtcaaaagtggatactgacttgggtaatgggactggc
A0A8C8J941_BCL2L1-      gggagatgaggccatttcaaatggg----tctgtggggaactactggaac
A0A8C8GSY4_BCL2L1-      gggagatgaagccattgcaaatggg----tctttggggaacaacaggaac
A0A8C8GSY4_BCL2L1-      gggagatgaagccattgcaaatggg----tctttggggaacaacaggaac
A0A8C8FJG7_BCL2L1-      ------tgagg-gggggcaggtgga-------agggggtgcggcagtcat
A0A8C8D057_BCL2L1-      gggggatgagg-ggggacaggtgga-------agggggggcggcagtcac
A0A8C8D057_BCL2L1-      gggggatgagg-ggggacaggtgga-------agggggggcggcagtcac
                                  *          *              *             

A0A8C8JWJ1_BCL2-01      tcctccgcctggtttgncacggcggtgccacggg-----gccaataacgc
A0A8C8JWJ1_BCL2-02      tcctccgcctggtttgncacggcggtgccacggg-----gccaataacgc
A0A8C8GL24_BCL2-01      tacaccc-----------------------------------------aa
A0A8C8LPV9_MCL1-01      gatact---ccacgacccacgacgttaggaatgaatgtcgtgaaaaccaa
A0A8C8CMB3_MCL1-01      gacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaa
A0A8C8CMB3_MCL1-02      gacactccaccacgacccacgaagttaggagtgaatgtcgtgaaaagcaa
A0A8C8J941_BCL2L1-      agca------------------------------------------gaag
A0A8C8GSY4_BCL2L1-      ggca------------------------------------------gaag
A0A8C8GSY4_BCL2L1-      ggca------------------------------------------gaag
A0A8C8FJG7_BCL2L1-      gacatac--------------------------------gtcaacgggac
A0A8C8D057_BCL2L1-      gacacaccccaatggcaca--------------------gtgaacgggac
A0A8C8D057_BCL2L1-      gacacaccccaatggcaca--------------------gtgaacgggac
                                                                          

A0A8C8JWJ1_BCL2-01      cagaccgggca---------------------------------------
A0A8C8JWJ1_BCL2-02      cagaccgggca---------------------------------------
A0A8C8GL24_BCL2-01      ctcccccgaagtttttgcacggag--------------------------
A0A8C8LPV9_MCL1-01      cgtcctcgataatcatttgtcagaccgaagcaacaatgacga--------
A0A8C8CMB3_MCL1-01      cgtcctgggtaatcatttgtcagaccgaagcaacaatgacgactctgacg
A0A8C8CMB3_MCL1-02      cgtcctgggtaatcatttgtcagaccgaagcaacaatgacgactctgacg
A0A8C8J941_BCL2L1-      caatttggcga---------------------------------------
A0A8C8GSY4_BCL2L1-      caatttgggta---------------------------------------
A0A8C8GSY4_BCL2L1-      caatttgggta---------------------------------------
A0A8C8FJG7_BCL2L1-      gagtcccggtactcctccaccacggca-----------------------
A0A8C8D057_BCL2L1-      gagtcctggga---ctccaccgcgaca-----------------------
A0A8C8D057_BCL2L1-      gagtcctggga---ctccaccgcgaca-----------------------
                               *                                          

A0A8C8JWJ1_BCL2-01      ----gcgtcccccatctttccaaacggctctcccaaacggacccgcat--
A0A8C8JWJ1_BCL2-02      ----gcgtcccccatctttccaaacggctctcccaaacggacccgcat--
A0A8C8GL24_BCL2-01      -gtcccagcccactgccgc-------------gggagaggacaccgac--
A0A8C8LPV9_MCL1-01      -ttctttgccctgcactcctcagatggcgtcagaatgtgggcctgaacta
A0A8C8CMB3_MCL1-01      gttctttgccctgcactcctcagatggcgtcagaatgtgggcctgaacta
A0A8C8CMB3_MCL1-02      gttctttgccctgcactcctcagatggcgtcagaatgtgggcctgaacta
A0A8C8J941_BCL2L1-      ------agccctcatctccacag-------gg------gggcatggag--
A0A8C8GSY4_BCL2L1-      ------tgccttcctctgcacaa-------gg------gggaattgag--
A0A8C8GSY4_BCL2L1-      ------tgccttcctctgcacaa-------gg------gggaattgag--
A0A8C8FJG7_BCL2L1-      -gtcgcccccctcctcccctcgg-------cggacagcgggcctggac--
A0A8C8D057_BCL2L1-      -gtctccccccttgtcccctcag-------cggacaatgggcctggac--
A0A8C8D057_BCL2L1-      -gtctccccccttgtcccctcag-------cggacaatgggcctggac--
                                **     *                      **      *   

A0A8C8JWJ1_BCL2-01      ----------------gcagctattca-----------------------
A0A8C8JWJ1_BCL2-02      ----------------gcagctattca-----------------------
A0A8C8GL24_BCL2-01      tctccttaccaaaacagcagtccgcaacctgacccacatgccaggctcca
A0A8C8LPV9_MCL1-01      tcgaattgtccatcgggcgatgaagtattggaacatgataccagacaact
A0A8C8CMB3_MCL1-01      tcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaact
A0A8C8CMB3_MCL1-02      tcgaattgtcaatcgggcgatgaagtattggaacatgatacaagacaact
A0A8C8J941_BCL2L1-      ----------------ccagtgaa--------------------------
A0A8C8GSY4_BCL2L1-      ----------------gcggtgaa--------------------------
A0A8C8GSY4_BCL2L1-      ----------------gcggtgaa--------------------------
A0A8C8FJG7_BCL2L1-      ----------------gcagtgaa--------------------------
A0A8C8D057_BCL2L1-      ----------------gcagtgaa--------------------------
A0A8C8D057_BCL2L1-      ----------------gcagtgaa--------------------------
                                         *                                

A0A8C8JWJ1_BCL2-01      -----------------------------------------------cag
A0A8C8JWJ1_BCL2-02      -----------------------------------------------cag
A0A8C8GL24_BCL2-01      -----------------------------------------------cag
A0A8C8LPV9_MCL1-01      cattgagaattttttgggggactacacaggactgtctcagcctcgatgga
A0A8C8CMB3_MCL1-01      aattgaaaacgtattggtggactatacaggactgactccgtctcgttgta
A0A8C8CMB3_MCL1-02      aattgaaaacgtattggtggactatacaggactgactccgtctcgttgta
A0A8C8J941_BCL2L1-      -----------------------------------------------agc
A0A8C8GSY4_BCL2L1-      -----------------------------------------------agc
A0A8C8GSY4_BCL2L1-      -----------------------------------------------agc
A0A8C8FJG7_BCL2L1-      -----------------------------------------------aga
A0A8C8D057_BCL2L1-      -----------------------------------------------aga
A0A8C8D057_BCL2L1-      -----------------------------------------------aga
                                                                          

A0A8C8JWJ1_BCL2-01      agttttgcgtgaggccgggga--------cgaac-tcgaacgac--tgta
A0A8C8JWJ1_BCL2-02      agttttgcgtgaggccgggga--------cgaac-tcgaacgac--tgta
A0A8C8GL24_BCL2-01      ggtcctgcgcgaggctggtgg--------cgagattgaaagaatgtatca
A0A8C8LPV9_MCL1-01      agcaaagcaagcctcttacgaccatgaagcgagtggtggaggacgtaata
A0A8C8CMB3_MCL1-01      agcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatataata
A0A8C8CMB3_MCL1-02      agcaaagcaaggctcttacgacgatgaagcgagtggtgaaggatataata
A0A8C8J941_BCL2L1-      agcactacgggactcggtgga--------tgagt-ttgagctgcgctaca
A0A8C8GSY4_BCL2L1-      agcactacgggactcagtgga--------tgagt-ttgagctgcgttaca
A0A8C8GSY4_BCL2L1-      agcactacgggactcagtgga--------tgagt-ttgagctgcgttaca
A0A8C8FJG7_BCL2L1-      ggcattgcgggactctgccaa--------cgagt-ttgagctgcgttatg
A0A8C8D057_BCL2L1-      ggcattgcgggactctgccaa--------cgagt-ttgagctgcgttatg
A0A8C8D057_BCL2L1-      ggcattgcgggactctgccaa--------cgagt-ttgagctgcgttatg
                         *     *  *   *               **                  

A0A8C8JWJ1_BCL2-01      ccagccc--------gactttgcggagatgtcacaccaattgtat----c
A0A8C8JWJ1_BCL2-02      ccagccc--------gactttgcggagatgtcacaccaattgtat----c
A0A8C8GL24_BCL2-01      gcgg-----------gactttgcagagatgtcggggcagttgcat----t
A0A8C8LPV9_MCL1-01      gcaaagcaccgatatgcatacaatggtatggtcgtcaaacttgacttgga
A0A8C8CMB3_MCL1-01      gcaaagcaccgatacgcatacaatggtatgatcgccaaacttgatttaga
A0A8C8CMB3_MCL1-02      gcaaagcaccgatacgcatacaatggtatgatcgccaaacttgatttaga
A0A8C8J941_BCL2L1-      cccgc----------gccttcagtgacctctcctcccagctccac----a
A0A8C8GSY4_BCL2L1-      cccgc----------gccttcagtgacctctgctcccagctccac----a
A0A8C8GSY4_BCL2L1-      cccgc----------gccttcagtgacctctgctcccagctccac----a
A0A8C8FJG7_BCL2L1-      ccaga----------gctttcagtgacctgtcctcccagctacac----a
A0A8C8D057_BCL2L1-      ccaga----------gcgttcagtgacctgtcctcccagctacac----a
A0A8C8D057_BCL2L1-      ccaga----------gcgttcagtgacctgtcctcccagctacac----a
                         *             *  *     *   *        *  *  *      

A0A8C8JWJ1_BCL2-01      tcacgtcttctatggcagaaaggagattcagagaggtgatagacgagc--
A0A8C8JWJ1_BCL2-02      tcacgtcttctatggcagaaaggagattcagagaggtgatagacgagc--
A0A8C8GL24_BCL2-01      ttacacccagcacggcacagagaaggtttaccgctgtaatagatgagc--
A0A8C8LPV9_MCL1-01      tgatcgatgcgatgacat----gagcgtcgtcaattctgtggccaagacc
A0A8C8CMB3_MCL1-01      tgaccgatgcgatgacat----gagtttcatcaattctgtggccaagacc
A0A8C8CMB3_MCL1-02      tgaccgatgcgatgacat----gagtttcatcaattctgtggccaagacc
A0A8C8J941_BCL2L1-      tcacccctgccacagcctaccatagctttgagagtgtgatggacgaag--
A0A8C8GSY4_BCL2L1-      tcacccctgccacagcctaccacagctttgagagcgtgatggacgaag--
A0A8C8GSY4_BCL2L1-      tcacccctgccacagcctaccacagctttgagagcgtgatggacgaag--
A0A8C8FJG7_BCL2L1-      tcacgccgtccacagcctatcagagctttgagaacgtgatggacgagg--
A0A8C8D057_BCL2L1-      tcacgccggccacagcctaccagagcttcgagaacgtgatggatgagg--
A0A8C8D057_BCL2L1-      tcacgccggccacagcctaccagagcttcgagaacgtgatggatgagg--
                        * *        *   *       **  *           * *   *    

A0A8C8JWJ1_BCL2-01      -tgttcagggacggggtt---aactggggacgaattgtagccttcttcga
A0A8C8JWJ1_BCL2-02      -tgttcagggacggggtt---aactggggacgaattgtagccttcttcga
A0A8C8GL24_BCL2-01      -tcttcagcgacggggta---aactggggtcggattgtggctttctttga
A0A8C8LPV9_MCL1-01      atgttcagtgatgggatcacgaactggggtcgcatcgccagcctggtggc
A0A8C8CMB3_MCL1-01      ctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggc
A0A8C8CMB3_MCL1-02      ctgttcagtgatgggaccacgaactggggtcgcatcgccagcctggtggc
A0A8C8J941_BCL2L1-      -tgttcagggacggtgtc---aactggggtcgcgtggtgggtctgtttgc
A0A8C8GSY4_BCL2L1-      -tgttcagggacggggtc---aactggggtcgcgtggtgggcctgtttgc
A0A8C8GSY4_BCL2L1-      -tgttcagggacggggtc---aactggggtcgcgtggtgggcctgtttgc
A0A8C8FJG7_BCL2L1-      -tgttccgggacggtgtc---aactggggacgggtggtgggcctgtttgc
A0A8C8D057_BCL2L1-      -ttttccgtgacggtgtg---aactggggacgtgtggtgggcctgtttgc
A0A8C8D057_BCL2L1-      -ttttccgtgacggtgtg---aactggggacgtgtggtgggcctgtttgc
                         * *** * ** **       ******** **  * *      *  * * 

A0A8C8JWJ1_BCL2-01      gttcggtggcacaatatgtgtggaatgcgtg-aacaaggaaatgacgtcg
A0A8C8JWJ1_BCL2-02      gttcggtggcacaatatgtgtggaatgcgtg-aacaaggaaatgacgtcg
A0A8C8GL24_BCL2-01      gtttggagggacaatgtgcgtggagagcgtc-aaccgggagatgacgtcc
A0A8C8LPV9_MCL1-01      atttggcg-------cagtggtgagccagcacctgaaggagag-------
A0A8C8CMB3_MCL1-01      atttggag-------cagtggtgagccagcacttgaaggagat-------
A0A8C8CMB3_MCL1-02      atttggag-------cagtggtgagccagcacttgaaggagat-------
A0A8C8J941_BCL2L1-      tttcggcggggccttgtgtgttgagtgtgtt-gagaaggatatgagccca
A0A8C8GSY4_BCL2L1-      ttttggcggggccctgtgtgttgagtgtgtt-gagaaggatatgagccac
A0A8C8GSY4_BCL2L1-      ttttggcggggccctgtgtgttgagtgtgtt-gagaaggatatgagccac
A0A8C8FJG7_BCL2L1-      tttcggaggggccctctgtgtagaatgtgtg-gacaaggagatgaacccc
A0A8C8D057_BCL2L1-      cttcggaggggccctctgtgtagagtgtgtg-gagaaggagatgagccca
A0A8C8D057_BCL2L1-      cttcggaggggccctctgtgtagagtgtgtg-gagaaggagatgagccca
                         ** ** *         * *  **    *        *** *        

A0A8C8JWJ1_BCL2-01      caggttgaccacatcgcc--gggt------------ggatggcggagtat
A0A8C8JWJ1_BCL2-02      caggttgaccacatcgcc--gggt------------ggatggcggagtat
A0A8C8GL24_BCL2-01      caagtagacaacatcgct--cgtt------------ggatgacggagtac
A0A8C8LPV9_MCL1-01      -tggcaggggacactgcgttgatttggtgggccaagagattgccacatac
A0A8C8CMB3_MCL1-01      -tggcaggggacactgcattgagtctgtgggccaaaagatcaccacatac
A0A8C8CMB3_MCL1-02      -tggcaggggacactgcattgagtctgtgggccaaaagatcaccacatac
A0A8C8J941_BCL2L1-      ctggtggcgcgcatcgca--gatt------------ggatgaccacatac
A0A8C8GSY4_BCL2L1-      ctggtgacgcgcatcgca--gact------------ggatggccacctac
A0A8C8GSY4_BCL2L1-      ctggtgacgcgcatcgca--gact------------ggatggccacctac
A0A8C8FJG7_BCL2L1-      ttggtgggtaggatcaca--gact------------ggatgaccgtctat
A0A8C8D057_BCL2L1-      ctagtgggacggattgca--gact------------ggatgactgtatac
A0A8C8D057_BCL2L1-      ctagtgggacggattgca--gact------------ggatgactgtatac
                           *        *   *      *             ***  *    ** 

A0A8C8JWJ1_BCL2-01      ctaaatggaccgctgcacaa-------ctggattcaag----agaacggg
A0A8C8JWJ1_BCL2-02      ctaaatggaccgctgcacaa-------ctggattcaag----agaacggg
A0A8C8GL24_BCL2-01      ttgaacggacccctacagaa-------ctggatccagg----agaatggt
A0A8C8LPV9_MCL1-01      ct-------cctctctgaccaaagggactggct----ggtcaaaaacaat
A0A8C8CMB3_MCL1-01      ct-------cctctctgaccaaagggactggct----ggtcaaaaacaat
A0A8C8CMB3_MCL1-02      ct-------cctctctgaccaaagggactggct----ggtcaaaaacaat
A0A8C8J941_BCL2L1-      ctggataaccatatccagcc-------ctggatccagagccaaggagga-
A0A8C8GSY4_BCL2L1-      ctggacaaccatatccagcc-------ctggatccagagccaaggagga-
A0A8C8GSY4_BCL2L1-      ctggacaaccatatccagcc-------ctggatccagagccaaggagga-
A0A8C8FJG7_BCL2L1-      ctggacaaccacatccagcc-------ctggatccagagccaaggagga-
A0A8C8D057_BCL2L1-      ctggacaaccacattcagcc-------ctggatccagagccaaggagga-
A0A8C8D057_BCL2L1-      ctggacaaccacattcagcc-------ctggatccagagccaaggagga-
                         *       *   *             **** *         *  *    

A0A8C8JWJ1_BCL2-01      ggatggg-----aggcctttgttgag--------------------ctct
A0A8C8JWJ1_BCL2-02      ggatggatctgcaggcacttccaaaggagactccccagaggagacccccc
A0A8C8GL24_BCL2-01      ggctggg-----acgcctttgtggag------------------atctat
A0A8C8LPV9_MCL1-01      gcttgga-----atggatttgtagag------------------ttcttt
A0A8C8CMB3_MCL1-01      gcttgga-----atggatttgtagag------------------ttcttt
A0A8C8CMB3_MCL1-02      gcttgga-----atggatttgtagag------------------ttcttt
A0A8C8J941_BCL2L1-      ---tggg-----accgttttgcagag------------------atcttt
A0A8C8GSY4_BCL2L1-      ---tggg-----accgttttgcggag------------------atcttt
A0A8C8GSY4_BCL2L1-      ---tggg-----accgttttgcggag------------------atcttt
A0A8C8FJG7_BCL2L1-      ---tggg-----accggtttgccgag------------------atcttt
A0A8C8D057_BCL2L1-      ---tggg-----accggtttgcagag------------------atcttt
A0A8C8D057_BCL2L1-      ---tggg-----accggtttgcagag------------------atcttt
                           ***      *     **    **                    *   

A0A8C8JWJ1_BCL2-01      atgacaga-----cagagg--gactcc-----gtgttcggttcatgg---
A0A8C8JWJ1_BCL2-02      agaggagaccccccaaagg--gaccccccagaggagaccccccagggaga
A0A8C8GL24_BCL2-01      ga----------gcagcagaggatctc-----tcactcctggtcgta---
A0A8C8LPV9_MCL1-01      catgttca-----------a-gatcct-----gagtcctcggtaagg---
A0A8C8CMB3_MCL1-01      catgtgca-----------a-gatcca-----gagtcctcagtaagg---
A0A8C8CMB3_MCL1-02      catgtgca-----------a-gatcca-----gagtcctcagtaagg---
A0A8C8J941_BCL2L1-      ggcagagatgctgctgcaga-cgttcg-----acggtcccaggagag---
A0A8C8GSY4_BCL2L1-      ggcagagatgcagctgcaga-cgtccg-----acggtcccaggagag---
A0A8C8GSY4_BCL2L1-      ggcagagatgcagctgcaga-cgtccg-----acggtcccaggagag---
A0A8C8FJG7_BCL2L1-      gggatggacgctgcagccga-gagcag-----gaagtctcaggagag---
A0A8C8D057_BCL2L1-      gggaaggacgctgcagctga-gagcag-----gaagtctcaggagag---
A0A8C8D057_BCL2L1-      gggaaggacgctgcagctga-gagcag-----gaagtctcaggagag---
                                                             *            

A0A8C8JWJ1_BCL2-01      -------------ccgtccatcaagactgtctttggcctggctgcactgg
A0A8C8JWJ1_BCL2-02      ctcccaaagtagaccccccaaagggactccccagaggagacccccacagg
A0A8C8GL24_BCL2-01      ------------------cttaaagacagtgttcggcctggccgccctgg
A0A8C8LPV9_MCL1-01      ------------------aacaccctcc----------tagcctttgctg
A0A8C8CMB3_MCL1-01      ------------------aacaccctca----------tagcctttgctg
A0A8C8CMB3_MCL1-02      ------------------aacaccctca----------tagcctttgctg
A0A8C8J941_BCL2L1-      ------------------cataattaaa----------tggctgctagtt
A0A8C8GSY4_BCL2L1-      ------------------cttaaaaaaa----------tggctgctagtt
A0A8C8GSY4_BCL2L1-      ------------------cttaaaaaaa----------tggctgctagtt
A0A8C8FJG7_BCL2L1-      ------------------ctttaagaag----------tggtttctggcg
A0A8C8D057_BCL2L1-      ------------------ctttaagaag----------tggttgctggcg
A0A8C8D057_BCL2L1-      ------------------ctttaagaag----------tggttgctggcg
                                                                          

A0A8C8JWJ1_BCL2-01      gggcc---------------------------------------------
A0A8C8JWJ1_BCL2-02      agaccccccagagggaccccccaaggagaccccccaaaggagaccccccg
A0A8C8GL24_BCL2-01      gagcc------------------------------------g--------
A0A8C8LPV9_MCL1-01      gagtt------------------------------------g---ctggg
A0A8C8CMB3_MCL1-01      gattt------------------------------------g---ctggg
A0A8C8CMB3_MCL1-02      gattt------------------------------------g---ctggg
A0A8C8J941_BCL2L1-      ggggt------------------------------------gattctgct
A0A8C8GSY4_BCL2L1-      ggggt------------------------------------gatgctgct
A0A8C8GSY4_BCL2L1-      ggggt------------------------------------gatgctgct
A0A8C8FJG7_BCL2L1-      gggat------------------------------------gaccctggt
A0A8C8D057_BCL2L1-      gggat------------------------------------gacactggt
A0A8C8D057_BCL2L1-      gggat------------------------------------gacactggt
                                                                          

A0A8C8JWJ1_BCL2-01      -gcaagccttaccatcggagcttaccttacacagaag-------------
A0A8C8JWJ1_BCL2-02      aggaggaccccccagaggag---accccccagaggagac-----------
A0A8C8GL24_BCL2-01      --ccggagtcaccatcggagccttgttcacccagaag-------------
A0A8C8LPV9_MCL1-01      attggg----------gcaacacttgccatgttgatcag-----------
A0A8C8CMB3_MCL1-01      cttggg----------gcaactctcgccatgttgatcag-----------
A0A8C8CMB3_MCL1-02      cttggg----------gcaactctcgccatgttgatcagccaaccaccaa
A0A8C8J941_BCL2L1-      ttcaggagtgctggtcggcactctcatcatgaagaaacg-----------
A0A8C8GSY4_BCL2L1-      ttcaggagtactggtcggcactctcatcatgaagaaatg-----------
A0A8C8GSY4_BCL2L1-      ttcaggagtactggtcggcactctcatcatgaagaaatg-----------
A0A8C8FJG7_BCL2L1-      cacaggagtcgtcgtagggtcactcttcgctcagaaacg-----------
A0A8C8D057_BCL2L1-      tacaggagtcatcgtagggtcactcattgctcagaaacg-----------
A0A8C8D057_BCL2L1-      tacaggagtcatcgtagggtcactcattgctcagaaacg-----------
                             *          *                *                

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      tacagaatcaaatacctgtagctcaggagtggattactagcatacctgtg
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      -------------------------------------------gaa----
A0A8C8CMB3_MCL1-02      gtggtgttctcttcacccagtggttgcaagcacactcattacagaataac
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      acctcacctaaggggtgtcagtgtaaatgacgttgggtccttgagccgcc
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      acaggctcccctgcctcagccggctcatcgggctttcatgcctcagccgg
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      atcgccagactcccctgcctcagccggctcatcgggctttcatgcctctg
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      ccagatcgcaagactcccctgcttccaccggcttgtcaggatctcatgcc
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      tcagccggtctgtcaggttcccgcgccccagccggctcgacaggttcccg
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      ------------------------------ttcagcag------------
A0A8C8CMB3_MCL1-02      cgcctcagccgacgtgacaggtttccacgcttcagcaggggtcaccaatc
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------------------------------
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      tgctcctgatccctgggtttgtctcccttatcggcgccctgcggctggag
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      --------------------------------------------------
A0A8C8JWJ1_BCL2-02      --------------------------accccagcaagctttgaacatggg
A0A8C8GL24_BCL2-01      --------------------------------------------------
A0A8C8LPV9_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-01      --------------------------------------------------
A0A8C8CMB3_MCL1-02      ccgcgcgtcggggagggggcagtgtcacgtatactctctctccgacctct
A0A8C8J941_BCL2L1-      -ccaa---------------------------------------------
A0A8C8GSY4_BCL2L1-      -ccag---------------------------------------------
A0A8C8GSY4_BCL2L1-      -ccagtttgtgtgttaccctgtataccctaggaccaactacatacattct
A0A8C8FJG7_BCL2L1-      -cctg---------------------------------------------
A0A8C8D057_BCL2L1-      -cctg---------------------------------------------
A0A8C8D057_BCL2L1-      -cctg---------------------------------------------
                                                                          

A0A8C8JWJ1_BCL2-01      ---------------tga
A0A8C8JWJ1_BCL2-02      aatacacacactgcttga
A0A8C8GL24_BCL2-01      ---------------tga
A0A8C8LPV9_MCL1-01      --------------gtga
A0A8C8CMB3_MCL1-01      -----attag--------
A0A8C8CMB3_MCL1-02      aggtcatcaggctgctga
A0A8C8J941_BCL2L1-      ---------------tga
A0A8C8GSY4_BCL2L1-      ---------------tga
A0A8C8GSY4_BCL2L1-      ttccaaatggacacttga
A0A8C8FJG7_BCL2L1-      ---------------tga
A0A8C8D057_BCL2L1-      ---------------tga
A0A8C8D057_BCL2L1-      ---------------tga
                                          

© 1998-2023Legal notice