Dataset for CDS BCL2L2 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A287ATE4_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A3Q9B4M8_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A482LX62_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A4D6NWN1_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A287ATE4_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A287ATE4_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
                        **************************************************

A0A287ATE4_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
A0A3Q9B4M8_BCL2L2-      tgtgggctataagatgaggcagaagggttatgtctgtggagctggccccg
A0A482LX62_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
A0A4D6NWN1_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
A0A287ATE4_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
A0A287ATE4_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
                        ************* ************************************

A0A287ATE4_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A3Q9B4M8_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A482LX62_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A4D6NWN1_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A287ATE4_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A287ATE4_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                        **************************************************

A0A287ATE4_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A3Q9B4M8_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A482LX62_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A4D6NWN1_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A287ATE4_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A287ATE4_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
                        **************************************************

A0A287ATE4_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A3Q9B4M8_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A482LX62_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A4D6NWN1_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A287ATE4_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A287ATE4_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
                        **************************************************

A0A287ATE4_BCL2L2-      atgaactcttccaaggaggccccaactggggccgccttgtggccttcttt
A0A3Q9B4M8_BCL2L2-      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
A0A482LX62_BCL2L2-      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
A0A4D6NWN1_BCL2L2-      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
A0A287ATE4_BCL2L2-      atgaactcttccaaggaggccccaactggggccgccttgtggccttcttt
A0A287ATE4_BCL2L2-      atgaactcttccaaggaggccccaactggggccgccttgtggccttcttt
                        **************** *********************************

A0A287ATE4_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A3Q9B4M8_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A482LX62_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A4D6NWN1_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A287ATE4_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A287ATE4_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
                        **************************************************

A0A287ATE4_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
A0A3Q9B4M8_BCL2L2-      actcgtgggacaagtgccggagtggatggtgacctacctggagacacggc
A0A482LX62_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
A0A4D6NWN1_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagtcacggc
A0A287ATE4_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
A0A287ATE4_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
                        ***************** ************************* ******

A0A287ATE4_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg------gagttcaca
A0A3Q9B4M8_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg------gagttcaca
A0A482LX62_BCL2L2-      tggccgactggatccacagcagc---------------------------
A0A4D6NWN1_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaa
A0A287ATE4_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaa
A0A287ATE4_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaa
                        **********************                            

A0A287ATE4_BCL2L2-      gctctatacggg--------------------------gacggggcc---
A0A3Q9B4M8_BCL2L2-      gctctatacggg--------------------------gacggggcc---
A0A482LX62_BCL2L2-      gcttcacccagg--------------------------------tct---
A0A4D6NWN1_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
A0A287ATE4_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
A0A287ATE4_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
                        ***  *  * **                                 *    

A0A287ATE4_BCL2L2-      ----------------ctggaggaggcgcggc------------------
A0A3Q9B4M8_BCL2L2-      ----------------ctggaggaggcgcggc------------------
A0A482LX62_BCL2L2-      ----------------ctgatgaac-------------------------
A0A4D6NWN1_BCL2L2-      gaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctg
A0A287ATE4_BCL2L2-      gaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctg
A0A287ATE4_BCL2L2-      gaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctg
                                        * *  * *                          

A0A287ATE4_BCL2L2-      -------------gtctgcgggaggg-------------------gaact
A0A3Q9B4M8_BCL2L2-      -------------gtctgcgggaggg-------------------gaact
A0A482LX62_BCL2L2-      --------------tcttccaaggag-------------------gcccc
A0A4D6NWN1_BCL2L2-      gcccagttatcatgtccattgaggagaagatggaggcagatgcccgatct
A0A287ATE4_BCL2L2-      gcccagttatcatgtccattgaggagaagatggaggcagatgcccgatct
A0A287ATE4_BCL2L2-      gcccagttatcatgtccattgaggagaagatggaggcagatgcccgatct
                                      **       * *                   *  * 

A0A287ATE4_BCL2L2-      -----gggcctcagtgaggacagtgctg----------------------
A0A3Q9B4M8_BCL2L2-      -----gggcctcagtgaggacagtgctg----------------------
A0A482LX62_BCL2L2-      aactggggccgccttgtggccttctttg----------------------
A0A4D6NWN1_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
A0A287ATE4_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
A0A287ATE4_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
                              *    *  ** ** *     **                      

A0A287ATE4_BCL2L2-      -----acgggggccgtgg---------------cactgggggccctggta
A0A3Q9B4M8_BCL2L2-      -----acgggggccgtgg---------------cactgggggccctggta
A0A482LX62_BCL2L2-      ---tcttcggagctg------------------cactgtgtgctg-----
A0A4D6NWN1_BCL2L2-      acactttcatggctgtggttcagtcaaccgcgttactatactctgtgaca
A0A287ATE4_BCL2L2-      acactttcatggctgtggttcagtcaaccgcgttactatactctgtgaca
A0A287ATE4_BCL2L2-      acactttcatggctgtggttcagtcaaccgcgttactatactctgtgaca
                                   ** *                   ***     *       

A0A287ATE4_BCL2L2-      actgta--------------------------------------------
A0A3Q9B4M8_BCL2L2-      actgta--------------------------------------------
A0A482LX62_BCL2L2-      -----------------------------------------------aga
A0A4D6NWN1_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
A0A287ATE4_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
A0A287ATE4_BCL2L2-      aatttagtggccatcccaaagggtttgcatatatagagttctcagacaaa
                                                                          

A0A287ATE4_BCL2L2-      ------------------------------ggggccttttttgctag---
A0A3Q9B4M8_BCL2L2-      ------------------------------ggggccttttttgctag---
A0A482LX62_BCL2L2-      gtgtcaataagg--------------agatggagcc--actcgtggga--
A0A4D6NWN1_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
A0A287ATE4_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
A0A287ATE4_BCL2L2-      gagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
                                                      *   **    *     *   

A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A287ATE4_BCL2L2-      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
A0A287ATE4_BCL2L2-      acaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcacaa
                                                                          

A0A287ATE4_BCL2L2-      -------------------------------------------caagtga
A0A3Q9B4M8_BCL2L2-      -------------------------------------------caagtga
A0A482LX62_BCL2L2-      -------------------------------------------caagtgc
A0A4D6NWN1_BCL2L2-      cagaccggggttttccacgagctcgataccgtgcccggaccaccaactac
A0A287ATE4_BCL2L2-      cagaccggggttttccacgagctcgataccgtgcccggaccaccaactac
A0A287ATE4_BCL2L2-      cagaccggggttttccacgagctcgataccgtgcccggaccaccaactac
                                                                   *** *  

A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      aggagt-----------------------------------------gga
A0A4D6NWN1_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A287ATE4_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
A0A287ATE4_BCL2L2-      aacagttcccgctctcgattctacagtggttttaacagcaggccccgggg
                                                                          

A0A287ATE4_BCL2L2-      --------------------------------------------------
A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      tggtga--------------------------------------------
A0A4D6NWN1_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
A0A287ATE4_BCL2L2-      tcgtgtctaca--ggtcaggatag--------------------------
A0A287ATE4_BCL2L2-      tcgtgtctacaggggccgggctagagcgacatcatggtattccccttact
                                                                          

A0A287ATE4_BCL2L2-      --
A0A3Q9B4M8_BCL2L2-      --
A0A482LX62_BCL2L2-      --
A0A4D6NWN1_BCL2L2-      aa
A0A287ATE4_BCL2L2-      --
A0A287ATE4_BCL2L2-      aa
                          

© 1998-2020Legal notice