Dataset for CDS BCL2L2 of organism Sus scrofa

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3Q9B4M8_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
A0A4D6NWN1_BCL2L2-      atggcgaccccggcctcagccccagacacacgggctctagtggcagactt
                                                                          

A0A3Q9B4M8_BCL2L2-      tgtgggctataagatgaggcagaagggttatgtctgtggagctggccccg
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
A0A4D6NWN1_BCL2L2-      tgtgggctataagctgaggcagaagggttatgtctgtggagctggccccg
                                                                          

A0A3Q9B4M8_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A7T8CLX7_BCL2L2-      -----------------------------------atgcgggcagctgga
A0A482LX62_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
A0A4D6NWN1_BCL2L2-      gggagggcccagcagctgacccgctgcaccaagccatgcgggcagctgga
                                                           ***************

A0A3Q9B4M8_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A7T8CLX7_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A482LX62_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
A0A4D6NWN1_BCL2L2-      gatgagttcgagacccgcttccggcgcaccttctcagatttggcagctca
                        **************************************************

A0A3Q9B4M8_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A7T8CLX7_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A482LX62_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
A0A4D6NWN1_BCL2L2-      gttgcatgtgaccccgggctcggcccagcagcgcttcacccaggtctctg
                        **************************************************

A0A3Q9B4M8_BCL2L2-      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
A0A7T8CLX7_BCL2L2-      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
A0A482LX62_BCL2L2-      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
A0A4D6NWN1_BCL2L2-      atgaactcttccaagggggccccaactggggccgccttgtggccttcttt
                        **************************************************

A0A3Q9B4M8_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A7T8CLX7_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A482LX62_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
A0A4D6NWN1_BCL2L2-      gtcttcggagctgcactgtgtgctgagagtgtcaataaggagatggagcc
                        **************************************************

A0A3Q9B4M8_BCL2L2-      actcgtgggacaagtgccggagtggatggtgacctacctggagacacggc
A0A7T8CLX7_BCL2L2-      actcgtgggacaagtgccggagtggatggtgacctacctggagacacggc
A0A482LX62_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagacacggc
A0A4D6NWN1_BCL2L2-      actcgtgggacaagtgcaggagtggatggtgacctacctggagtcacggc
                        ***************** ************************* ******

A0A3Q9B4M8_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg---------------
A0A7T8CLX7_BCL2L2-      tggccgactggatccacagcagtgggggctgggcg---------------
A0A482LX62_BCL2L2-      tggccgactggatccacagcagcg--------------------------
A0A4D6NWN1_BCL2L2-      tggccgactggatccacagcagtgggggctgggagctggaagcgatcaaa
                        ********************** *                          

A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      gctcgagtcagggagatggaggaagaagctgagaagctaaaggagctaca
                                                                          

A0A3Q9B4M8_BCL2L2-      ---------------------------gagttcacagct-----------
A0A7T8CLX7_BCL2L2-      ---------------------------gagttcacagct-----------
A0A482LX62_BCL2L2-      --------------------------------cttcacc-----------
A0A4D6NWN1_BCL2L2-      gaacgaagtagagaagcagatgaatatgagtccaccaccaggcaatgctg
                                                        *    *            

A0A3Q9B4M8_BCL2L2-      -------------------------ctatacggggacggggccctgga--
A0A7T8CLX7_BCL2L2-      -------------------------ctatacggggacggggccctgga--
A0A482LX62_BCL2L2-      ------------------------------------caggtctctgat--
A0A4D6NWN1_BCL2L2-      gcccagttatcatgtccattgaggagaagatggaggcagatgcccgatct
                                                            * *    * *    

A0A3Q9B4M8_BCL2L2-      --------------------------------------------ggaggc
A0A7T8CLX7_BCL2L2-      --------------------------------------------ggaggc
A0A482LX62_BCL2L2-      ------------------------------------------------ga
A0A4D6NWN1_BCL2L2-      atctatgttggcaatgtggactatggtgcaacagcagaagagctggaagc
                                                                        * 

A0A3Q9B4M8_BCL2L2-      gcggcgtctgcgggaggggaactg--------------------------
A0A7T8CLX7_BCL2L2-      gcggcgtctgcgggaggggaactg--------------------------
A0A482LX62_BCL2L2-      ac-tcttccaagga------------------------------------
A0A4D6NWN1_BCL2L2-      ac-actttcatggctgtggttcagtcaaccgcgttactatactctgtgac
                         *  * *    **                                     

A0A3Q9B4M8_BCL2L2-      ---------ggcc-------------------------------------
A0A7T8CLX7_BCL2L2-      ---------ggcc-------------------------------------
A0A482LX62_BCL2L2-      ---------ggcc--ccaactggggccgcct-------------------
A0A4D6NWN1_BCL2L2-      aaatttagtggccatcccaaagggtttgcatatatagagttctcagacaa
                                 ****                                     

A0A3Q9B4M8_BCL2L2-      ----tcagtgagga------------------------------------
A0A7T8CLX7_BCL2L2-      ----tcagtgagga------------------------------------
A0A482LX62_BCL2L2-      --------tgtggccttctttgtcttcgg---------------------
A0A4D6NWN1_BCL2L2-      agagtcagtgaggacttccttggccttagatgagtccctatttagaggaa
                                ** **                                     

A0A3Q9B4M8_BCL2L2-      ----------------------------------------------cagt
A0A7T8CLX7_BCL2L2-      ----------------------------------------------cagt
A0A482LX62_BCL2L2-      -----------------------------------------agctgcact
A0A4D6NWN1_BCL2L2-      gacaaatcaaggtgatcccaaaacgaaccaacagaccaggcatcagcaca
                                                                      **  

A0A3Q9B4M8_BCL2L2-      gctgacgggggccgtg---------------gcactgggggccc------
A0A7T8CLX7_BCL2L2-      gctgacgggggccgtg---------------gcactgggggccc------
A0A482LX62_BCL2L2-      gtgtgctgagagtgtcaataag---------gagatggagccac------
A0A4D6NWN1_BCL2L2-      acagaccggggttttccacgagctcgataccgtgcccggaccaccaacta
                             * * *    *                *     *   * *      

A0A3Q9B4M8_BCL2L2-      --------------------------------------------------
A0A7T8CLX7_BCL2L2-      --------------------------------------------------
A0A482LX62_BCL2L2-      --------------------------------------------------
A0A4D6NWN1_BCL2L2-      caacagttcccgctctcgattctacagtggttttaacagcaggccccggg
                                                                          

A0A3Q9B4M8_BCL2L2-      -tggtaactgtaggggccttttttgctagc--------------------
A0A7T8CLX7_BCL2L2-      -tggtaactgtaggggccttttttgctagc--------------------
A0A482LX62_BCL2L2-      -tcgtgg-gacaagtgca----ggagtgga--------------------
A0A4D6NWN1_BCL2L2-      gtcgtgtctacaggggcc----gggctagagcgacatcatggtattcccc
                         * **      * * **         * *                     

A0A3Q9B4M8_BCL2L2-      -aagtga
A0A7T8CLX7_BCL2L2-      -aagtga
A0A482LX62_BCL2L2-      -tggtga
A0A4D6NWN1_BCL2L2-      ttactaa
                            * *

© 1998-2022Legal notice