Dataset for CDS Unclassified of organism Echinococcus granulosus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W6U5B1_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Echinococcus granulosus (length=729 residues).
atggcggcctttccttcgcctgcttgtcacccggtgctagtgttaccagggcgatctgccctgcccagccaagtgccctc
agcccggacggagcctcgtcctgaaagttggttgccggagaacatcagtaacaccaccaaagcagtggcggtggatttgg
tgaacaccttcgagtcgcggtacgcagagggctacaagagtctggtgacagacgcgctgcttgtctacaattcgactgct
tccaattccaccaccactaccccctcctcctcggatgaagcagagcttgatccatctccaccccattccgctcagtactg
tttgccattcatgaatgcgagagaccggtacatcaggattctgcacagtcttttcgtccaacaaatcaactggggccgaa
ttgtggcaatgatgagtttccttcgcgctctctgtgaagtcctcgaagcttcaactcaatcgcagtcttcgtccgacgag
gatgagaacgaggtgcattcgccaccacccttggacaagacagatttcacaccggtggtgaagcaatgtgtagacggctc
tgcaaagaacggcaacgacaacgacgatgacagcaacaaaaaattgacgacggaaatgaaggatcggaggatagcctcgt
tgcactacatcgtgtggacaacggagttcatccacaaggagtcaaagttgggtgactggattgaggagcatggtagttgg
gtgggttga
© 1998-2023Centre National de la Recherche Scientifique logoInstitut national de la sante et de la recherche médicale logoUniversité de Lyon logoLegal notice