Dataset for CDS BAX-like of Organism Aotus nancymaae

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A2K5D846_BAX-04       atggacgggtccggggagcagcccag----------aggcgaggg-----
A0A2K5D846_BAX-01       atggacgggtccggggagcagcccag----------aggcgaggg-----
A0A2K5D7G1_BAK1-01      atggcat----cggggcaaggcccag--gtcctcccaggcaggagtgcgg
A0A2K5DQ30_BOK-01       atggagg----tgctgcgccgctcctccgtcttcgccgccgagatcatgg
                        ****        *  *    ** *             * *  *       

A0A2K5D846_BAX-04       ----------------gcccaccagctctgagcagatcatgaagacaggg
A0A2K5D846_BAX-01       ----------------gcccaccagctctgagcagatcatgaagacaggg
A0A2K5D7G1_BAK1-01      a-gagcctgactcaccctctgcttctgaggagcaggtagcccgggacacg
A0A2K5DQ30_BOK-01       acgcctttgaccgctcgcccaccgacaaggagctggtggcccag------
                                          *  *       **** * *      *      

A0A2K5D846_BAX-04       gcccttttgcttcagggtttcatc---------caggatcgagca-gggc
A0A2K5D846_BAX-01       gcccttttgcttcagggtttcatc---------caggatcgagca-gggc
A0A2K5D7G1_BAK1-01      gaggaggttttccaaagctacgttttttaccgccatcggcaggaacagga
A0A2K5DQ30_BOK-01       -----------ccaaag-tacgtg---------cacgcgcggctgctcgc
                                    **  * * * *          **    *        * 

A0A2K5D846_BAX-04       gaatcgggggggagacacccgagctggccctg--------gacccggtgc
A0A2K5D846_BAX-01       gaatcgggggggagacacccgagctggccctg--------gacccggtgc
A0A2K5D7G1_BAK1-01      ggctgaaggggcggccgcccctgctgacccagagatggttagcttgtctc
A0A2K5DQ30_BOK-01       gcccgagcgcgccgcgccgtccgggcgccctgccgaggtcgtggcggccc
                        *       * *  *   *    *    *** *             *   *

A0A2K5D846_BAX-04       cccaggatgcgtccaccaagaagctgagcgagtg---tctcaagcgcatc
A0A2K5D846_BAX-01       cccaggatgcgtccaccaagaagctgagcgagtg---tctcaagcgcatc
A0A2K5D7G1_BAK1-01      tccaacctagcagcaccatggggcaggtgggacggcagctcgccatcatt
A0A2K5DQ30_BOK-01       taca----ggcagcacc------cgggcgggacg--agctggagatgatc
                          **         ****      * *   *   *    **       ** 

A0A2K5D846_BAX-04       ggggacgagctggacag------taacatgga------------gctgca
A0A2K5D846_BAX-01       ggggacgagctggacag------taacatgga------------gctgca
A0A2K5D7G1_BAK1-01      ggggatgacatcaaccggcgctatgactcggagttccagaccatgctgca
A0A2K5DQ30_BOK-01       cggcccagcgtctaccg------caacgtggcgcgcca------gctgca
                         **       *  ** *        **  **             ******

A0A2K5D846_BAX-04       gaggatgattgccgctgtggacacagactccccccgagaggtcttttttc
A0A2K5D846_BAX-01       gaggatgattgccgctgtggacacagactccccccgagaggtcttttttc
A0A2K5D7G1_BAK1-01      gca----cctgcaacccacggcagagaacgcctacgag-----tacttca
A0A2K5DQ30_BOK-01       -catctccctacagtctgagcccgtggtgaccgacgcg-----ttcctgg
                                 * *       * *   *    **  ** *     *   *  

A0A2K5D846_BAX-04       gagtggcagctgacatgttctctgacggcaacttcaactggggccgggtt
A0A2K5D846_BAX-01       gagtggcagctgacatgttctctgacggcaacttcaactggggccgggtt
A0A2K5D7G1_BAK1-01      ccaagatcgcctccagcctgtttgagagtggcatcaactggggccgtgtg
A0A2K5DQ30_BOK-01       ccgtggccggccacatcttctctgca---ggcatcacgtggggcaaggtg
                            *   *    **   * * **       * ***  ******   ** 

A0A2K5D846_BAX-04       gtcgcccttttctactttgccagcaaactggtgctcaa------------
A0A2K5D846_BAX-01       gtcgcccttttctactttgccagcaaactggtgctcaa------------
A0A2K5D7G1_BAK1-01      gtggctct------------------cctgggcttcggctac---cgtct
A0A2K5DQ30_BOK-01       gtgtccctgtacgcggtggccgcagggctggccgtggactgcgtgaggca
                        **  * **                   ****   *               

A0A2K5D846_BAX-04       ggccctgtgtgccaaggtgcccgagctgatcagaaccatcatgg------
A0A2K5D846_BAX-01       ggccctgtgtgccaaggtgcccgagctgatcagaaccatcatgg------
A0A2K5D7G1_BAK1-01      ggccctacatgtctaccagcgcggcctgactgg---cttcctgggccagg
A0A2K5DQ30_BOK-01       ggcccagcctgccatggtccacgcccttgtcga---ctgcctgggagagt
                        *****    ** *      * **  **         *  * ***      

A0A2K5D846_BAX-04       ------gctggactttggacttccttcgggagc--------ggctgttgg
A0A2K5D846_BAX-01       ------gctggactttggacttccttcgggagc--------ggctgttgg
A0A2K5D7G1_BAK1-01      tgacccgcttcgtggtggacttcatgctgcatcactgcatcgcccggtgg
A0A2K5DQ30_BOK-01       ttgtacgcaagaccctggccacctggctgcggag-------gcgcggtgg
                              **       *** *  *   * *            *   * ***

A0A2K5D846_BAX-04       gctggatccaagacca-gggtggttgggtcacactgct------------
A0A2K5D846_BAX-01       gctggatccaagacca-gggtggttggg----atggcc------------
A0A2K5D7G1_BAK1-01      atcgcacagaggg--gcggctgggtgg-cagccctggacttgggcaatgg
A0A2K5DQ30_BOK-01       at-ggactgatgtcctcaagtgtgtggtcagcaccgaccccggcctccgc
                           * *   * *        **  ***        *              

A0A2K5D846_BAX-04       tcccctgcc-catcttcagatcat--------cagat-------------
A0A2K5D846_BAX-01       tcctctcctacttctttgggacacccacgtggcagacagtgaccatcttt
A0A2K5D7G1_BAK1-01      tcccatcctgaatgtgctggtggttctgggtgtgg-------------tt
A0A2K5DQ30_BOK-01       tccca-----------ctggctgctcgccgcactg-------------tg
                        ***               *               *               

A0A2K5D846_BAX-04       ---------gtggtctcta----atgcattt-------------------
A0A2K5D846_BAX-01       gtggctggagtgctcactg----cctcgcttaccatctggaagaacatgg
A0A2K5D7G1_BAK1-01      ctg-ttgggccagtttgtggtacgaagattcttc------------aaat
A0A2K5DQ30_BOK-01       cagcttcggccgcttcctgaaggctgccttcttcgtgctcctgccagaga
                                     *   *           *                    

A0A2K5D846_BAX-04       -----
A0A2K5D846_BAX-01       gctga
A0A2K5D7G1_BAK1-01      catga
A0A2K5DQ30_BOK-01       gatga
                             

© 1998-2020Legal notice