Dataset for CDS MCL-1 of organism Oryzias latipes

[Download (right click)] [Edit] [Sequences] [Repertoires]

6 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P9ILF6_MCL1-01      atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactg
A0A3P9ILF6_MCL1-02      atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactg
A0A3B3IJ04_MCL1-01      atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactg
A0A3B3IJ04_MCL1-02      atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactg
A0A3P9L1F3_MCL1-01      atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactg
A0A3P9L1F3_MCL1-02      atgtttcctttgcaaaaacagatggttaacagctacatcacgtctaactg

A0A3P9ILF6_MCL1-01      tggatttacgggacacatcctcg---gcagagcgggagagatgtccgcgc
A0A3P9ILF6_MCL1-02      tggatttacgggacacatcctcg---gcagagcgggagagatgtccgcgc
A0A3B3IJ04_MCL1-01      tggatttacgggacacatcctcggcagcagagcgggagagatgtccgcgc
A0A3B3IJ04_MCL1-02      tggatttacgggacacatcctcggcagcagagcgggagagatgtccgcgc
A0A3P9L1F3_MCL1-01      tggatttacgggacacatcctcggcagcagagcgggagagatgtccgcgc
A0A3P9L1F3_MCL1-02      tggatttacgggacacatcctcggcagcagagcgggagagatgtccgcgc
                        ***********************   ************************

A0A3P9ILF6_MCL1-01      gcgtgcctctgccgtccacattggcctctcgcgtggcaaatcccgacccg
A0A3P9ILF6_MCL1-02      gcgtgcctctgccgtccacattggcctctcgcgtggcaaatcccgacccg
A0A3B3IJ04_MCL1-01      gcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccg
A0A3B3IJ04_MCL1-02      gcgtgcctctgccgtccacattagcctctcacgtggcaaaccccgacccg
A0A3P9L1F3_MCL1-01      gcgtccctctgccgtccacattagcctctcgcgtggcaaaccccgacccg
A0A3P9L1F3_MCL1-02      gcgtccctctgccgtccacattagcctctcgcgtggcaaaccccgacccg
                        **** ***************** ******* ********* *********

A0A3P9ILF6_MCL1-01      tccgatcagttcaaaagaccgcaggacctcgagtattccgcgaggaggtt
A0A3P9ILF6_MCL1-02      tccgatcagttcaaaagaccgcaggacctcgagtattccgcgaggaggtt
A0A3B3IJ04_MCL1-01      tccgatcagctcaaaagaccgcaggacctcgagtattccgcgaggaggtt
A0A3B3IJ04_MCL1-02      tccgatcagctcaaaagaccgcaggacctcgagtattccgcgaggaggtt
A0A3P9L1F3_MCL1-01      tccgatcagctcaaaagaccgcaggacctcgagtactccgcgaggaggtt
A0A3P9L1F3_MCL1-02      tccgatcagctcaaaagaccgcaggacctcgagtactccgcgaggaggtt
                        ********* ************************* **************

A0A3P9ILF6_MCL1-01      tcacgacgtcgacgacgatggctctctcccgaacaccccggagctggagt
A0A3P9ILF6_MCL1-02      tcacgacgtcgacgacgatggctctctcccgaacaccccggagctggagt
A0A3B3IJ04_MCL1-01      tcacgacgtcgacgacgatggctctctccccaacaccccggagttggagt
A0A3B3IJ04_MCL1-02      tcacgacgtcgacgacgatggctctctccccaacaccccggagttggagt
A0A3P9L1F3_MCL1-01      tcacgacgtcgacgacgatggctctctcccgaacacccccgagctggagt
A0A3P9L1F3_MCL1-02      tcacgacgtcgacgacgatggctctctcccgaacacccccgagctggagt
                        ****************************** ******** *** ******

A0A3P9ILF6_MCL1-01      gcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgag
A0A3P9ILF6_MCL1-02      gcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgag
A0A3B3IJ04_MCL1-01      gcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgag
A0A3B3IJ04_MCL1-02      gcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgag
A0A3P9L1F3_MCL1-01      gcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgag
A0A3P9L1F3_MCL1-02      gcgaggccagcgtttccggcgacaactcgggaatcgacgctttaaacgag

A0A3P9ILF6_MCL1-01      gacaccacggaattcctcaccaatttctttaggaactttgttggaatttc
A0A3P9ILF6_MCL1-02      gacaccacggaattcctcaccaatttctttaggaactttgttggaatttc
A0A3B3IJ04_MCL1-01      gacaccacggaattcctcaccaatttctttaggaactttgttggaatttc
A0A3B3IJ04_MCL1-02      gacaccacggaattcctcaccaatttctttaggaactttgttggaatttc
A0A3P9L1F3_MCL1-01      gacaccacggaattcctcaccaatttctttaggaactttgttggaatttc
A0A3P9L1F3_MCL1-02      gacaccacggaattcctcaccaatttctttaggaactttgttggaatttc

A0A3P9ILF6_MCL1-01      tcagtatccacaccgggataataaatacatgtcgaccgcgaaaagagtgg
A0A3P9ILF6_MCL1-02      tcagtatccacaccgggataataaatacatgtcgaccgcgaaaagagtgg
A0A3B3IJ04_MCL1-01      tcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
A0A3B3IJ04_MCL1-02      tcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
A0A3P9L1F3_MCL1-01      tcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
A0A3P9L1F3_MCL1-02      tcagtatcggcaccgggataataaatacatgtcgaccgcgaaaagagtgg
                        ********  ****************************************

A0A3P9ILF6_MCL1-01      tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtc
A0A3P9ILF6_MCL1-02      tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtc
A0A3B3IJ04_MCL1-01      tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtc
A0A3B3IJ04_MCL1-02      tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtc
A0A3P9L1F3_MCL1-01      tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtc
A0A3P9L1F3_MCL1-02      tgaacgacgtgttagagaaacacaagattacttacaacggtatgatcgtc

A0A3P9ILF6_MCL1-01      agactgtcgttggacgaccagggggatgatatgtcatttgtcagcagcgt
A0A3P9ILF6_MCL1-02      agactgtcgttggacgaccagggggatgatatgtcatttgtcagcagcgt
A0A3B3IJ04_MCL1-01      agactgtcgttggacgaccagggggatgatatgtcatttgtcagcagcgt
A0A3B3IJ04_MCL1-02      agactgtcgttggacgaccagggggatgatatgtcatttgtcagcagcgt
A0A3P9L1F3_MCL1-01      agactgtcgttggacgaccagggggatgatatgtcatttgtcagcagcgt
A0A3P9L1F3_MCL1-02      agactgtcgttggacgaccagggggatgatatgtcatttgtcagcagcgt

A0A3P9ILF6_MCL1-01      agcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtca
A0A3P9ILF6_MCL1-02      agcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtca
A0A3B3IJ04_MCL1-01      agcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtca
A0A3B3IJ04_MCL1-02      agcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtca
A0A3P9L1F3_MCL1-01      agcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtca
A0A3P9L1F3_MCL1-02      agcgaagagcctttttgcggatgggaccaccaactggggccgcatcgtca

A0A3P9ILF6_MCL1-01      gcctgctggccttcggggcggcggtgtgtcagtccttgaaggaaaagggc
A0A3P9ILF6_MCL1-02      gcctgctggccttcggggcggcggtgtgtcagtccttgaaggaaaagggc
A0A3B3IJ04_MCL1-01      gcctgctggccttcggggcggcggtgtgtcagtccttgaaggaaaagggc
A0A3B3IJ04_MCL1-02      gcctgctggccttcggggcggcggtgtgtcagtccttgaaggaaaagggc
A0A3P9L1F3_MCL1-01      gcctgctggccttcggggcggcggtgtgtcagtccttgaaggaaaagggc
A0A3P9L1F3_MCL1-02      gcctgctggccttcggggcggcggtgtgtcagtccttgaaggaaaagggc

A0A3P9ILF6_MCL1-01      agaggtcactgcgtggacctggtcagtcaggagatctgcacgtacctgct
A0A3P9ILF6_MCL1-02      agaggtcactgcgtggacctggtcagtcaggagatctgcacgtacctgct
A0A3B3IJ04_MCL1-01      agaggtcactgcgtggacctggtcagtcaggagatctgcacgtacctgct
A0A3B3IJ04_MCL1-02      agaggtcactgcgtggacctggtcagtcaggagatctgcacgtacctgct
A0A3P9L1F3_MCL1-01      agaggtcactgcgtggacctggtcagtcaggagatctgcacgtacctgct
A0A3P9L1F3_MCL1-02      agaggtcactgcgtggacctggtcagtcaggagatctgcacgtacctgct

A0A3P9ILF6_MCL1-01      gagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcg
A0A3P9ILF6_MCL1-02      gagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcg
A0A3B3IJ04_MCL1-01      gagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcg
A0A3B3IJ04_MCL1-02      gagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcg
A0A3P9L1F3_MCL1-01      gagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcg
A0A3P9L1F3_MCL1-02      gagtgagcagcggaactggctggtcaacaacaactcctgggatggtttcg

A0A3P9ILF6_MCL1-01      tagagttctttcgcgtttcagacccagaaactacagtcaggaacactttg
A0A3P9ILF6_MCL1-02      tagagttctttcgcgtttcagacccagaaactacagtcaggaacactttg
A0A3B3IJ04_MCL1-01      tagagttctttcgcgtttcagacccagaaacgacagtcaggaacactttg
A0A3B3IJ04_MCL1-02      tagagttctttcgcgtttcagacccagaaacgacagtcaggaacactttg
A0A3P9L1F3_MCL1-01      tagagttctttcgcgtttcagacccagaatctacagtcaggaacactttg
A0A3P9L1F3_MCL1-02      tagagttctttcgcgtttcagacccagaatctacagtcaggaacactttg
                        ***************************** * ******************

A0A3P9ILF6_MCL1-01      gtggccttccttggaattgctggcgttggggctttactggcccagcttag
A0A3P9ILF6_MCL1-02      gtggccttccttggaattgctggcgttggggctttactggcccagcttaa
A0A3B3IJ04_MCL1-01      gtggccttccttggaattgctggcgttggggctttactggcccagcttag
A0A3B3IJ04_MCL1-02      gtggccttccttggaattgctggcgttggggctttactggcccagcttaa
A0A3P9L1F3_MCL1-01      gtggccttccttggaattgctggcgttggggctttactggcccagcttag
A0A3P9L1F3_MCL1-02      gtggccttccttggaattgctggcgttggggctttactggcccagcttaa

A0A3P9ILF6_MCL1-01      t-------------------------------------------------
A0A3P9ILF6_MCL1-02      tatgatggccatttttaaaggacttcctgcttctgccagacttcacaact
A0A3B3IJ04_MCL1-01      t-------------------------------------------------
A0A3B3IJ04_MCL1-02      tatgatggccatttttaaaggacttcctgcttctaccagacttcacaact
A0A3P9L1F3_MCL1-01      t-------------------------------------------------
A0A3P9L1F3_MCL1-02      tatgatggccatttttaaaggacttcctgcttctgccagacttcacaact

A0A3P9ILF6_MCL1-01      --aggtga
A0A3P9ILF6_MCL1-02      cgagatag
A0A3B3IJ04_MCL1-01      --aggtga
A0A3B3IJ04_MCL1-02      cgagatag
A0A3P9L1F3_MCL1-01      --aggtga
A0A3P9L1F3_MCL1-02      ggagatag
                          ** *  

© 1998-2021Legal notice