Dataset for CDS BOK of Organism Gouania willdenowi

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8C5ELB2_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gouania willdenowi GN=BOK (length=630 residues).
atggacgtcctgcgtaagtcttccgtgtttgctgcagaggtcctggatgtgtttgaccgatcagtgaccgagaaggatct
ggtgtcccagtccaggacgctgtgcagagactacatcctgtctaggatcaaccagaatggactgggatggtccaaaaacg
agcttaattttcctccctccactgcagcacttgctgaggtgtctgtggtgcttctgtgtcttggcgacgagctggaaagc
cttcagccggctttgtacaggaacgtggcgcggcagctcaacatctctgtttccatggagaacatggtgtctgatgcttt
tatcggcgtggcaacagagatatttgcaacaggtgtaacgtggggtaaagtggtcgctatgtatgcagtagctggagctc
tggcagtggactgtgtccggcatggccaaccagccacagttcacatcctggtggataacttgacacagtttgttaggaaa
tacctggtttcgtggctgaagaggcgtggaggatgggcccaaaggcttgggttgcagaaacaccctgacacgcagggaca
tgactgggaaccttcactgagattacatgatgtaatctttaaaaaagagatatcacaaagtgtgtggtga
>gnl|bcl2dbcds|A0A8C5ELB2_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Gouania willdenowi GN=BOK (length=642 residues).
atggacgtcctgcgtaagtcttccgtgtttgctgcagaggtcctggatgtgtttgaccgatcagtgaccgagaaggatct
ggtgtcccagtccaggacgctgtgcagagactacatcctgtctaggatcaaccagaatggactgggatggtccaaaaacg
agcttaattttcctccctccactgcagcacttgctgaggtgtctgtggtgcttctgtgtcttggcgacgagctggaaagc
cttcagccggctttgtacaggaacgtggcgcggcagctcaacatctctgtttccatggagaacatggtgtctgatgcttt
tatcggcgtggcaacagagatatttgcaacaggtgtaacgtggggtaaagtggtcgctatgtatgcagtagctggagctc
tggcagtggactgtgtccggcatggccaaccagccacagttcacatcctggtggataacttgacacagtttgttaggaaa
tacctggtttcgtggctgaagaggcgtggaggatggagagatatcacaaagtgtgtggtgaagaaagatctcacccctga
acaaaactggatgtcctcagccatcgagtccctgaaatacttcctcaccacaatatacgtctacgtcatgaaggagttgt
ga
>gnl|bcl2dbcds|A0A8C5GDW0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Gouania willdenowi GN=BOK (length=630 residues).
atggagatgttacgccgttcctccgtgttcgccgccgaggtgttcgaccgttcccccaccgataaggagctggtgtccca
ggggaaggctctgtgcagggactacatccactccaggctccacagggccgggataggatggaccaaagcagagcagcccg
ggaccctggcggaggtctcctctgtgctgctgtggctgggtgatgagttggagtaccttcgtcctaacgtgtaccgtaac
gtggctcggcagctcaacatcacagtggcctcagagagtgtggtgtcagacgccttcctggctgtggctgctgacatttt
ctccacaggtaggacacacacgtgtgtgacgtgggggaaggtggtttccttgtacgccgtggctggagccctagcggtgg
actgtgtgcgtcatggtcacccagccatggtccacaccatcgtagactgtatgggagagtttgtcaggaagagcctcacc
tcgtggttaaagaaaagaggaggatggacggacctcacaaagtgtgtggtgaacactgactccagcttccgctctcactg
gctggtgtcggccgcctgtacctgtggacactacatgaaggctgtggtgttgtacatcctcagggagtga
>gnl|bcl2dbcds|A0A8C5GDW0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Gouania willdenowi GN=BOK (length=588 residues).
atgttacgccgttcctccgtgttcgccgccgaggtgttcgaccgttcccccaccgataaggagctggtgtcccaggggaa
ggctctgtgcagggactacatccactccaggctccacagggccgggataggatggaccaaaaaaaattacacaaaagaga
atgtttggttaggtgatgagttggagtaccttcgtcctaacgtgtaccgtaacgtggctcggcagctcaacatcacagtg
gcctcagagagtgtggtgtcagacgccttcctggctgtggctgctgacattttctccacaggtgtgacgtgggggaaggt
ggtttccttgtacgccgtggctggagccctagcggtggactgtgtgcgtcatggtcacccagccatggtccacaccatcg
tagactgtatgggagagtttgtcaggaagagcctcacctcgtggttaaagaaaagaggaggatggacggacctcacaaag
tgtgtggtgaacactgactccagcttccgctctcactggctggtgtcggccgcctgtacctgtggacactacatgaaggc
tgtggtgttgtacatcctcagggagtga
© 1998-2023Legal notice