Dataset for CDS Unclassified of organism Sinocyclocheilus grahami

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|A0A672PR31_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus grahami (length=645 residues).
atgcgggtcgagatggcacaggagaatgtgtatgataaccgcagcatagtggtgaagtacatccagcataagctctggaa
gaggggatacgtgtgggacgtggacggacacgaggacagcgtctcgaatggactgatgatggagaggcgggaggaccgcg
gcatctctcccagctcccgtcacgacccgtgcagggctcttcagagggtgctgcgggaggccggggatgaactggagcgg
ctttatcagtcggactttgcggagatgtccaaacagctgcatctcacgtccatcacggcgcaccagcgcttcaccgcggt
catagacgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggactgtttgtgtcg
agtgcgtgagtaaggagatgacggcgcatgtggataacattgcgggctggatgacagagtatctgaacgggccgctgcac
ggctggatccaggagaacggcggatgggaggcgtttgtggagctctacagcaggcagagggactctgtgtttcgcagctc
gtggtcatcaatagtaacggtcttcggtctagcggctctcggggccgttggcttgaccataggagcctaccttgctcaga
aatga
>gnl|bcl2dbcds|A0A672RJN9_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus grahami (length=690 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttctggggaggatgatgacaccgtcaatacaggagtggaggactcctctccaaactcaggcagga
ggctccaggctccctcagccggaggggggaacaactctgaatgcctgatagcaaaccgggtcacacgttcagactcttat
tcgaggatctacggggcgttacgcgaggctggagaccagatagaaaggatgcaccagcgtgaatttgaggagatgtccca
ccagatgatattcagtcgcaatgcagaacaacgcagcttcttagctgtggctgaagagctcttcagagacgaagtgaact
gggggcggatcgtcgctttctttgagtttggtgggatcatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggcctctggaaaactggatcgaggaaaatggaggctgggatgc
cttcgtggagttgtacggtcagcagagagattctatgttccacccattgtcgtacctaacgaaagtgcttggattggcag
cactaggcttggcaggagtgaccatcggagcctttttcgctcagaagtga
>gnl|bcl2dbcds|A0A672RJN9_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus grahami (length=738 residues).
atggccaacgaaattcgctatgacaatcggaatattgtggagaaatacctcaatcacaaactttcaaagaagggatatga
gtggaaatttcaatcttctggggaggatgatgacaccgtcaatacaggagtggaggactcctctccaaactcaggcagga
ggctccaggctccctcagccggaggggggaacaactctgaatgcctgatagcaaaccgggtcacacgttcagactcttat
tcgaggatctacggggcgttacgcgaggctggagaccagatagaaaggatgcaccagcgtgaatttgaggagatgtccca
ccagatgatattcagtcgcaatgcagaacaacgcagcttcttagctgtggctgaagagctcttcagagacgaagtgaact
gggggcggatcgtcgctttctttgagtttggtgggatcatgtgtgtggagagcttcaaccgggagatggcgtcccaggta
gataatattgcacactggatgacagactacctgaacgggcctctggaaaactggatcgaggaaaatggaggctggacctt
ttttccattgcacctgttcactgtggaatatagaaacaaaggaggagggcgacatgctcatggacgtttgccaacatata
tggtcctaattcctggtttggagcatctgtctggcccggtggactcaatggcccctcacccccaacacattagattaatg
accagatcattatctttt
>gnl|bcl2dbcds|A0A672S3K4_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Sinocyclocheilus grahami (length=801 residues).
atgtgtcatttttcggagctcttctctgtgagagaacgttttttccgttacgatgtacttcgaataaccgactttttcct
gctcgcgctcgttttatcgcgtttaataacgatggccaccgaaattcgctttgacaatcggaatattgtggagaaataca
tcaatcacaaactttcaaagaagggatatgtgtggaaatcgcaatcttctggggaggatgatgacaccgtcgataaagga
gtcgaggggtcctctctaaactctgacaggaggcttcaggctccctcagccggaggggggaacaactctgaatgcctgat
agctcaccgggtcactcgttcagacccttattcaaggatctaccgggcgctacgcgaggctggagacgagatagaaagga
tataccagcgtgaatttgaggagatgtcccaccgcatgatattcagtcccaatacaacgcaacgcagcttcttagccgtg
gcagaagagctctttatagacggagtgaactgggggcggatcgtcgctttctttgagtttggtgggaccatgtgtgtgga
gagcgtcaaccgggagatggcgtcccaggtagataatattgcacactggatgacagactacctgaacgggcctctggaaa
actggatcgaggaaaatggaggctgggatgccttcgtggagttgtacagtcagcagagagactcagtgttccacccattt
tcgtacctaactaaagtacttggattggcagtgctcggcttagcaggagtgaccatcggagcctttttcgctcagaagtg
a
© 1998-2020Legal notice