Dataset for CDS MCL-1 of organism Loxodonta africana

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


G3T756_MCL1-01      atgttcggcttcaagagaaacgcagtaatcggactcaacctttactgtgggggggccggc
G3TVG9_MCL1-01      ------------------------------------------------------------
                                                                                

G3T756_MCL1-01      ttgggggccggcggctgcgccacccctccgggagggcgacttccagctcctggaaaggag
G3TVG9_MCL1-01      ------------------------------------------------------------
                                                                                

G3T756_MCL1-01      gccacggcccggcaagaggtagggggaggggacgccggcgcgagccccccggccgctgtc
G3TVG9_MCL1-01      ------------------------------------------------------------
                                                                                

G3T756_MCL1-01      gctccggacggccggagggtcgtgcggccggcgcccattggcgccgagggccccgacgtc
G3TVG9_MCL1-01      ---------------------------------------ggagcccagggccccagcgtc
                                                           ** *** ********  ****

G3T756_MCL1-01      actgcgattcccgcgaggccgacgttctttgcgcccacccgccgcgcgtcgccgcctgtg
G3TVG9_MCL1-01      accgcgacccctgcgaggcccatgctctttgcatccatcccctgcacgtcgccgcctgag
                    ** ****  ** ******** * * *******  *** ** * ** ************ *

G3T756_MCL1-01      gagatggaggctctagccgccgacgccatcatgtcgcccgaagaggagctggacgggtac
G3TVG9_MCL1-01      gaggcgaatgcctcagttgcggaggccatcatgtcagctgaagaggagctgggcaggtac
                    ***  * * **   **  ** ** ***********  * ************* * *****

G3T756_MCL1-01      gagccggagccgctcgggaagcggccggctgtttttccccggctggggctggtcggggag
G3TVG9_MCL1-01      aagctggagacgctggggaagcggccagctgcccttcccctgctggtgcttgtgggggaa
                     *** **** **** *********** ****   ****** ***** *** ** ***** 

G3T756_MCL1-01      gccagtaatggccccggtaccgacgggtcactaccctcgacgccgcccctagcagaggag
G3TVG9_MCL1-01      gccagtaactgccctggtacgcacggggcacttccctcaacgcagcccccagcagaggaa
                    ********  **** *****  ***** **** ***** **** ***** ********* 

G3T756_MCL1-01      gaggaggacgagttgtaccggcagtcgctagagattatctctcggtaccttcaggagcag
G3TVG9_MCL1-01      gaagaagacaagttgtacccgcaatcgctggatattatctttcggtaccttcacgagcag
                    ** ** *** ********* *** ***** ** ******* ************ ******

G3T756_MCL1-01      gcaaccggcgccaaggacaccaagccaatgggcgggtctggggcggccagcaggaaggcg
G3TVG9_MCL1-01      gccatcggcgcca-----------------------cccagggccgccagctggaagggg
                    ** * ********                        *  **** ****** ****** *

G3T756_MCL1-01      ttagagaccctccggcgagtcgcggacggggtgcagcgcaaccacgagacggccttccaa
G3TVG9_MCL1-01      tgagaaacctgcc-gcgggtcgcagacggtgtgcagcgcaacgaggagacggtctcccaa
                    * *** ***  ** *** ***** ***** ************ * ******* ** ****

G3T756_MCL1-01      ggaatgcttcggaaactggacatcaaaaacgaagatgatgtcaaatctttatctcgagta
G3TVG9_MCL1-01      ggcatgcttcggaaaccggacttcaaaaacgaaaatgatgtgaaatctttgtctggagcg
                    ** ************* **** *********** ******* ******** *** ***  

G3T756_MCL1-01      atggcccatgttttcagtgacgggataacaaactggggcagaattgtgactctcatatct
G3TVG9_MCL1-01      atggtccatgttttcagtggtggaataacaaaatggggcagaattgtgact---atatct
                    **** **************  ** ******** ******************   ******

G3T756_MCL1-01      tttggtgcctttgtggccaaacacttgaagagcgtaaaccaagaaagccgcatcgaacca
G3TVG9_MCL1-01      tttggtgcctttgtggtcaaacacttcgggagcataaaccaag-aagctgc---------
                    **************** *********   **** ********* **** **         

G3T756_MCL1-01      ttagcagaaagtatcacagatgttctcgtaaggacgaaaagggactggttagtcaaacaa
G3TVG9_MCL1-01      --agcagaatgtatcacagatgttctcctaag---gaaacggtactgcttagacaaacga
                      ******* ***************** ****   **** ** **** **** ***** *

G3T756_MCL1-01      agaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcaga
G3TVG9_MCL1-01      aggggcggggatgggcttgtggagttcgtccacgtaaaggacccacagggcgactgtaga
                    ** *** ******** *********** **** *** ****** * * ** * *   ***

G3T756_MCL1-01      aatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaata
G3TVG9_MCL1-01      aatgtgcagctggcttttgcaggt------------------------------------
                    ******* ****************                                    

G3T756_MCL1-01      agatag
G3TVG9_MCL1-01      ------
                          

© 1998-2020Legal notice