Dataset for CDS BCL-2-like of organism Cynoglossus semilaevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A3P8UWG7_BCL2L1-      ac---------tttgacctttaatattaacagaaaactggtggtcgacta
A0A3P8WUE9_BCL2-01      atg------tacttggtgccaaattctgctggaa---tggcgagcgagtg
A0A3P8VMA1_BCL2L1-      atgtcgtgcagtaa--------------cagagaattggttaagttctt-
A0A3P8W7K5_BCL2L10      atg------tgcaa------------------------------------
A0A3P8V8T6_MCL1-01      ctg------gatat----------------------------ggtgc---
A0A3P8VKM5_MCL1-03      atg------aatattataaagaacaaccaagctaagttgaacgttgcca-
A0A3P8VKM5_MCL1-05      atg------aatattataaagaacaaccaagctaagttgaacgttgcca-
A0A3P8VKM5_MCL1-04      atg------aatattataaagaacaaccaagctaagttgaacgttgcca-
                                                                          

A0A3P8UWG7_BCL2L1-      -------catacagtataaactttcccag---------------------
A0A3P8WUE9_BCL2-01      taaccgctatatagtggaaa------------------------------
A0A3P8VMA1_BCL2L1-      -------tttaggttataagctttctcagaggaacta-------------
A0A3P8W7K5_BCL2L10      --------------------------------------------------
A0A3P8V8T6_MCL1-01      -------------tcataagc-----------------------------
A0A3P8VKM5_MCL1-03      -------ccggagtcctaggctgtttcatcgtccctcaaaatggagtcgt
A0A3P8VKM5_MCL1-05      -------ccggagtcctaggctgtttcatcgtccctcaaaatggagtcgt
A0A3P8VKM5_MCL1-04      -------ccggagtcctaggctgtttcatcgtccctcaaaatggagtcgt
                                                                          

A0A3P8UWG7_BCL2L1-      ------------------------------------------------ag
A0A3P8WUE9_BCL2-01      ------------------------------------------------ag
A0A3P8VMA1_BCL2L1-      ---------------------------------------------cccag
A0A3P8W7K5_BCL2L10      ---------------------------------------------ctcag
A0A3P8V8T6_MCL1-01      ------------------------------------------------ag
A0A3P8VKM5_MCL1-03      taatggaaccatgcactatggcactggaaactccacgcctatagccttag
A0A3P8VKM5_MCL1-05      taatggaaccatgcactatggcactggaaactccacgcctatagccttag
A0A3P8VKM5_MCL1-04      taatggaaccatgcactatggcactggaaactccacgcctatagccttag
                                                                        **

A0A3P8UWG7_BCL2L1-      gaactttcccgtccaccacctgggactcggtgattctccaaaca------
A0A3P8WUE9_BCL2-01      tacatctgccataaactcgccaagcgtgggtacgtgtgggagca------
A0A3P8VMA1_BCL2L1-      aatct---------------------------------------------
A0A3P8W7K5_BCL2L10      cgtct---------ccttccgccgtctctacgagctctg-----------
A0A3P8V8T6_MCL1-01      tgtct---------------------------------------------
A0A3P8VKM5_MCL1-03      cgtcttcgctgtcaacccacaacgactcaatgagttctgtcaccgaaacc
A0A3P8VKM5_MCL1-05      cgtcttcgctgtcaacccacaacgactcaatgagttctgtcaccgaaacc
A0A3P8VKM5_MCL1-04      cgtcttcgctgtcaacccacaacgactcaatgagttctgtcaccgaaacc
                            *                                             

A0A3P8UWG7_BCL2L1-      ----------------------ggactgat--------------------
A0A3P8WUE9_BCL2-01      ----------------------cgac------------------------
A0A3P8VMA1_BCL2L1-      ----------------------cttctgatgttgagga------------
A0A3P8W7K5_BCL2L10      -------------------agcagtctgatatcgc---------------
A0A3P8V8T6_MCL1-01      -----------------------gtttgac--------------------
A0A3P8VKM5_MCL1-03      caaaggcgacccaaggacctccaggttaacacggcaaacggacatgccag
A0A3P8VKM5_MCL1-05      caaaggcgacccaaggacctccaggttaacacggcaaacggacatgccag
A0A3P8VKM5_MCL1-04      caaaggcgacccaaggacctccaggttaacacggcaaacggacatgccag
                                                                          

A0A3P8UWG7_BCL2L1-      ------------ggggaagaggcagggttgggcgcag--agcagcggaca
A0A3P8WUE9_BCL2-01      ---------------gaggaccgagatggagacgctgctaataatggctc
A0A3P8VMA1_BCL2L1-      ------------ttgggggagaacagcgtgaaggt---------------
A0A3P8W7K5_BCL2L10      ------------tgggaggaaaatgtcatgtgggctgtg-----------
A0A3P8V8T6_MCL1-01      ---------------------------------gctgtgcac--------
A0A3P8VKM5_MCL1-03      aaagagccactgtgaggtggacgaaggctctgagccgtgcacgccggagc
A0A3P8VKM5_MCL1-05      aaagagccactgtgaggtggacgaaggctctgagccgtgcacgccggagc
A0A3P8VKM5_MCL1-04      aaagagccactgtgaggtggacgaaggctctgagccgtgcacgccggagc
                                                         *                

A0A3P8UWG7_BCL2L1-      agta------cgcacgccaa-----------cgggactgta--aacggca
A0A3P8WUE9_BCL2-01      aatagtttcccgtccaccgactctggttcaccggtgccgtggtgccagca
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3P8W7K5_BCL2L10      -----------------------------------------------gaa
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A3P8VKM5_MCL1-03      ----------cacactcggaagcagaactcgatgtctcccaggccgggga
A0A3P8VKM5_MCL1-05      ----------cacactcggaagcagaactcgatgtctcccaggccgggga
A0A3P8VKM5_MCL1-04      ----------cacactcggaagcagaactcgatgtctcccaggccgggga
                                                                          

A0A3P8UWG7_BCL2L1-      caagttctgggacgccgcctgca-------------------tctcca--
A0A3P8WUE9_BCL2-01      ccgggcctggga--acgacggca-------------------tccctaac
A0A3P8VMA1_BCL2L1-      ----------gaggaggtcaccacagcgtccagtaatggcgttcctcaga
A0A3P8W7K5_BCL2L10      agagaccctggctg-tggcagag-gactacctgtccctctgctgttcaag
A0A3P8V8T6_MCL1-01      ------actggaaaatgacacca-ggcaattgatttgcgatttcctgaaa
A0A3P8VKM5_MCL1-03      cgaggtgctggataccgatacca-aggaacttatttttcagttctacaga
A0A3P8VKM5_MCL1-05      cgaggtgctggataccgatacca-aggaacttatttttcagttctacaga
A0A3P8VKM5_MCL1-04      cgaggtgctggataccgatacca-aggaacttatttttcagttctacaga
                                  *     *                         *    *  

A0A3P8UWG7_BCL2L1-      ctgcggcagcagcattcggcgtcggat----------acaagtctg--ga
A0A3P8WUE9_BCL2-01      ctctgcaaacggccacctgcgcccgag----------gcg---cac--gc
A0A3P8VMA1_BCL2L1-      ctcctt--cagctgtgctgcagcact-----------gcagtggtgcaga
A0A3P8W7K5_BCL2L10      cccccggccagcccctccacctccca-----------gcgagtcagccgc
A0A3P8V8T6_MCL1-01      gacttcaccacaaaatctacccaacgattggtggagagcaaagcattgtc
A0A3P8VKM5_MCL1-03      gactttacaactcattctccgtcgaaatggggcgaacgcaaagcgcttac
A0A3P8VKM5_MCL1-05      gactttacaactcattctccgtcgaaatggggcgaacgcaaagcgcttac
A0A3P8VKM5_MCL1-04      gactttacaactcattctccgtcgaaatggggcgaacgcaaagcgcttac
                                        *  *                  *           

A0A3P8UWG7_BCL2L1-      ctccattaaagaggctctgcgggactcggccaacgagtt----tgaactg
A0A3P8WUE9_BCL2-01      cgccattcacagagtcctgcgcgaagccggagacgaact----ggagcga
A0A3P8VMA1_BCL2L1-      ggctgtaaaggctgctctcaaggactcagctgacgagtt----tgaactt
A0A3P8W7K5_BCL2L10      tgccatgagacacctggcccaggaca---tggagaagcagcaccaagctc
A0A3P8V8T6_MCL1-01      aactatgaaaagagtggtaaaaggcattttagacaaaca----cagacat
A0A3P8VKM5_MCL1-03      gacgatgaaaagagtcgtggacgacgttttggagaaaca----cagatat
A0A3P8VKM5_MCL1-05      gacgatgaaaagagtcgtggacgacgttttggagaaaca----cagatat
A0A3P8VKM5_MCL1-04      gacgatgaaaagagtcgtggacgacgttttggagaaaca----cagatat
                          *  *                *         *  *              

A0A3P8UWG7_BCL2L1-      cgatacgcgcgggccttcagcgatctgcaccagcagctgcacatcacacc
A0A3P8WUE9_BCL2-01      ctgtaccagccggacttctcagagatgtcacggcagctctatctcacctc
A0A3P8VMA1_BCL2L1-      cgcttcacacaagcctttcgtaaccttttcttaaagctggacctcactcc
A0A3P8W7K5_BCL2L10      gcttcca--gacgttgtc-tcagtctttcctgagg---caatgtggctct
A0A3P8V8T6_MCL1-01      gcattcagtggcatgatcaacaacctctcttttga---aaacgga---gt
A0A3P8VKM5_MCL1-03      gcatacaatggtatgatcaacaaactttcattaga---aaacaga---ca
A0A3P8VKM5_MCL1-05      gcatacaatggtatgatcaacaaactttcattaga---aaacaga---ca
A0A3P8VKM5_MCL1-04      gcatacaatggtatgatcaacaaactttcattaga---aaacaga---ca
                           * *          *        *              *         

A0A3P8UWG7_BCL2L1-      agccactgcctaccaaagtt-tcgagaatgtgatggacgaagtgttccgg
A0A3P8WUE9_BCL2-01      cagcacggcgcagaggagat-tcaccgaggtgattgacgaactgttccgg
A0A3P8VMA1_BCL2L1-      ggacacagtctaccacagtt-ttaagagcgtgatggatgaggtcttcaga
A0A3P8W7K5_BCL2L10      gagcc----ctgtgtgtgtc-ttaggaaggttatggaagagctggtagga
A0A3P8V8T6_MCL1-01      atata----atattggagttgttggggcagtggccaggagcctcttcaga
A0A3P8VKM5_MCL1-03      gggtg----atttgactttcatcagctctgttgccaaaagcctgtttgga
A0A3P8VKM5_MCL1-05      gggtg----atttgactttcatcagctctgttgccaaaagcctgtttgga
A0A3P8VKM5_MCL1-04      gggtg----atttgactttcatcagctctgttgccaaaagcctgtttgga
                                             *       **           *  *  * 

A0A3P8UWG7_BCL2L1-      gacggtgtc---aattggggtcgcatcatagggctcttcgccttcggcgg
A0A3P8WUE9_BCL2-01      gacggcgtg---aactggggccggattatcgccttcttcgagtttggagg
A0A3P8VMA1_BCL2L1-      gacggagtc---aactggggacgcatagtcggcctgtttactttcggagg
A0A3P8W7K5_BCL2L10      gacggacacttgaactgggggagagttgtttccattttcacctttactgg
A0A3P8V8T6_MCL1-01      gatggcacctccaactggggtcgaatagttagcctggttgcatttggggc
A0A3P8VKM5_MCL1-03      gatggtaccacaaactggggtcggatcaccagcctggtggcctttggggc
A0A3P8VKM5_MCL1-05      gatggtaccacaaactggggtcggatcaccagcctggtggcctttggggc
A0A3P8VKM5_MCL1-04      gatggtaccacaaactggggtcggatcaccagcctggtggcctttggggc
                        ** **       ** *****  *  *        *  *    **    * 

A0A3P8UWG7_BCL2L1-      ggcgctg----------agtgtcgagtgcgtggagaaagaga---tgagt
A0A3P8WUE9_BCL2-01      cgtcgtg----------tgtgtggagtgtgcggctaaggaggacttgacg
A0A3P8VMA1_BCL2L1-      agtactg----------tgtgtggaatgtgtgcagaggaata---tgagt
A0A3P8W7K5_BCL2L10      ggttctggccaaacagctgt-----tggtccagaagggttta---aagcc
A0A3P8V8T6_MCL1-01      agtgctt----------tgt-----cagcacctaaaggagaa---aggct
A0A3P8VKM5_MCL1-03      agttgtg----------tgt-----cagcacctaaaggagtg---tggtc
A0A3P8VKM5_MCL1-05      agttgtg----------tgt-----cagcacctaaaggagtg---tggtc
A0A3P8VKM5_MCL1-04      agttgtg----------tgt-----cagcacctaaaggagtg---tggtc
                         *   *            **       *                      

A0A3P8UWG7_BCL2L1-      cagctggtggccagg---attgcgga---ttggatgacag-------tct
A0A3P8WUE9_BCL2-01      ccgcaagtggagcag---gtcgtgga---ctggatgacag-------agt
A0A3P8VMA1_BCL2L1-      gagttagttccccg---cattgcaga---ctggatga-------ccatgt
A0A3P8W7K5_BCL2L10      ggggcaggaacccgaggcagggcaggaactgggaccggag----cctgga
A0A3P8V8T6_MCL1-01      ggg---agaacacgg--tggaccagg---ttggacaggagatcgcctcat
A0A3P8VKM5_MCL1-03      aag---agaactcaa--cagagctag---taggaagagagatctcctcgt
A0A3P8VKM5_MCL1-05      aag---agaactcaa--cagagctag---taggaagagagatctcctcgt
A0A3P8VKM5_MCL1-04      aag---agaactcaa--cagagctag---taggaagagagatctcctcgt
                          *                            ***                

A0A3P8UWG7_BCL2L1-      atcttgacaaccacat----------------ccagc-------------
A0A3P8WUE9_BCL2-01      atttaaatggacctct----------------taaca-------------
A0A3P8VMA1_BCL2L1-      acttggatgaatacat----------------tgatc-------------
A0A3P8W7K5_BCL2L10      acctgcagggaactggcagagaccattgctgattatctgggagaagagaa
A0A3P8V8T6_MCL1-01      acctg-------ttgtc---------------ttatc------------a
A0A3P8VKM5_MCL1-03      acctg-------ctgtc---------------ttacc------------a
A0A3P8VKM5_MCL1-05      acctg-------ctgtc---------------ttacc------------a
A0A3P8VKM5_MCL1-04      acctg-------ctgtc---------------ttacc------------a
                        *  *                              *               

A0A3P8UWG7_BCL2L1-      -----catggatcgaaacccaaggtggatgggagcattttgcggaactct
A0A3P8WUE9_BCL2-01      -----tctggattaaagagaacgggggatgggatgcctttgtggagctgt
A0A3P8VMA1_BCL2L1-      -----catggatccagagccaaggaggctgggaccgttttgctgagattt
A0A3P8W7K5_BCL2L10      gaaagcgtggcttttggagaatggtggatgggaggggttctgtgagttct
A0A3P8V8T6_MCL1-01      gaaagactggctcctgaaaaacaactcctgggatggcttcgtggaattct
A0A3P8VKM5_MCL1-03      gagagattggctattgaaaaacaactcttgggatggctttgtagagttct
A0A3P8VKM5_MCL1-05      gagagattggctattgaaaaacaactcttgggatggctttgtagagttct
A0A3P8VKM5_MCL1-04      gagagattggctattgaaaaacaactcttgggatggctttgtagagttct
                               *** *        *       *****    **    **  * *

A0A3P8UWG7_BCL2L1-      ttggtcaggatg------cagcagcggagagccggaggtca---------
A0A3P8WUE9_BCL2-01      acg--------a------cagacagggggagtctgccttcagctgctcct
A0A3P8VMA1_BCL2L1-      ttggcacagactgtattccaagaacgaggagttgtcgggac---------
A0A3P8W7K5_BCL2L10      ctcacagtg---------ccagagagctgagccaggactcg---------
A0A3P8V8T6_MCL1-01      t-----------------ccaaggacaagagcca-gagaag---------
A0A3P8VKM5_MCL1-03      t-----------------cagagtagaagaccca-gaggca---------
A0A3P8VKM5_MCL1-05      t-----------------cagagtagaagaccca-gaggca---------
A0A3P8VKM5_MCL1-04      t-----------------cagagtagaagaccca-gaggca---------
                                          *         **                    

A0A3P8UWG7_BCL2L1-      ----------caggagagttttaagaaatggttgctggctgggatgacgc
A0A3P8WUE9_BCL2-01      ggccctccatcaagaccgtctt------tggt--ctggctg------cac
A0A3P8VMA1_BCL2L1-      -----acagtgagaagatggct----------gct------------agt
A0A3P8W7K5_BCL2L10      -----tccatgaagaccgctct----------gtttgctgctgctagtgt
A0A3P8V8T6_MCL1-01      -----gcaattagatgtacact----------tcttggctt------tgt
A0A3P8VKM5_MCL1-03      -----accatgaggaacaccct----------ccttggtct------ttt
A0A3P8VKM5_MCL1-05      -----accatgaggaacaccct----------ccttggtct------ttt
A0A3P8VKM5_MCL1-04      -----accatgaggaacaccct----------ccttggtct------ttt
                                   *         *                            

A0A3P8UWG7_BCL2L1-      tggtgacaggcgtggtggtgggctccctgattgccca--gaaacgtctct
A0A3P8WUE9_BCL2-01      tgg----------------gggccgccagcctcaccatcggagcgtatct
A0A3P8VMA1_BCL2L1-      ggg--a---gcaggcctgcttgcagcagtgttgattggtgttctgatcac
A0A3P8W7K5_BCL2L10      tgg--ccttgctggactc------accttcct-cctggtgcgctga----
A0A3P8V8T6_MCL1-01      tgg--gtttgcaggactttgggcaacacttgc-cttactgatgagatatt
A0A3P8VKM5_MCL1-03      tgg--agttgctggactcggggcaacactggc-cctgttgatcaggtg--
A0A3P8VKM5_MCL1-05      tgg--agttgctggactcggggcaacactggc-cctgttgatcagatg--
A0A3P8VKM5_MCL1-04      tgg--agttgctggactcggggcaacactggc-cctgttgatcagata--
                         **                      *             *    *     

A0A3P8UWG7_BCL2L1-      ga------------------
A0A3P8WUE9_BCL2-01      gacccagaagtga-------
A0A3P8VMA1_BCL2L1-      taaaaagcattga-------
A0A3P8W7K5_BCL2L10      --------------------
A0A3P8V8T6_MCL1-01      ttctcaggtttgtgtggtag
A0A3P8VKM5_MCL1-03      -------------a------
A0A3P8VKM5_MCL1-05      -------------gaaatga
A0A3P8VKM5_MCL1-04      -------------a------
                                            

© 1998-2020Legal notice