Dataset for CDS BCL-2-like of organism Cynoglossus semilaevis

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A3P8UWG7_BCL2L1-      actttgacctttaatattaacagaaaactggtgg--------tcgactac
A0A3P8VMA1_BCL2L1-      ------atgtcgtgcagtaacagagaattggttaagtt--------cttt
A0A3P8WUE9_BCL2-01      ------atgta---------------------------------------
A0A3P8W7K5_BCL2L10      ------atgtgcaa------------------------------------
A0A3P8V8T6_MCL1-01      ------ctggatat----------------------------ggtgc---
A0A3P8VHY5_MCL1-04      ------atgaatattataaagaacaaccaagctaagttgaacgttgccac
A0A3P8VHY5_MCL1-05      ------atgaatattataaagaacaaccaagctaagttgaacgttgccac
A0A3P8VHY5_MCL1-02      ------atgaatattataaagaacaaccaagctaagttgaacgttgccac
A0A3P8VHY5_MCL1-01      ------atgaatattataaagaacaaccaagctaagttgaacgttgccac
A0A3P8VHY5_MCL1-03      ------atgaatattataaagaacaaccaagctaagttgaacgttgccac

A0A3P8UWG7_BCL2L1-      atacagtataaactttcccagaggaactttcccg----------------
A0A3P8VMA1_BCL2L1-      ttaggttataagctttctcagaggaacta---------------------
A0A3P8WUE9_BCL2-01      --------------------------------------------------
A0A3P8W7K5_BCL2L10      --------------------------------------------------
A0A3P8V8T6_MCL1-01      -----tcataagc-------------------------------------
A0A3P8VHY5_MCL1-04      cggagtcctaggctgtttcatcgtccctcaaaatggagtcgttaatggaa
A0A3P8VHY5_MCL1-05      cggagtcctaggctgtttcatcgtccctcaaaatggagtcgttaatggaa
A0A3P8VHY5_MCL1-02      cggagtcctaggctgtttcatcgtccctcaaaatggagtcgttaatggaa
A0A3P8VHY5_MCL1-01      cggagtcctaggctgtttcatcgtccctcaaaatggagtcgttaatggaa
A0A3P8VHY5_MCL1-03      cggagtcctaggctgtttcatcgtccctcaaaatggagtcgttaatggaa

A0A3P8UWG7_BCL2L1-      -------------------------------------tccaccacct---
A0A3P8VMA1_BCL2L1-      -------------------------------------cccagaatct---
A0A3P8WUE9_BCL2-01      -------------------------------------cttggtgcca---
A0A3P8W7K5_BCL2L10      -------------------------------------ctcagcgtct---
A0A3P8V8T6_MCL1-01      ----------------------------------------agtgtct---
A0A3P8VHY5_MCL1-04      ccatgcactatggcactggaaactccacgcctatagccttagcgtcttcg
A0A3P8VHY5_MCL1-05      ccatgcactatggcactggaaactccacgcctatagccttagcgtcttcg
A0A3P8VHY5_MCL1-02      ccatgcactatggcactggaaactccacgcctatagccttagcgtcttcg
A0A3P8VHY5_MCL1-01      ccatgcactatggcactggaaactccacgcctatagccttagcgtcttcg
A0A3P8VHY5_MCL1-03      ccatgcactatggcactggaaactccacgcctatagccttagcgtcttcg

A0A3P8UWG7_BCL2L1-      ----------------------gggactcgg-------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3P8WUE9_BCL2-01      ------------------------aattctg-------------------
A0A3P8W7K5_BCL2L10      ------ccttccgccgtctctacgagctctg-------------------
A0A3P8V8T6_MCL1-01      --------------------------------------------------
A0A3P8VHY5_MCL1-04      ctgtcaacccacaacgactcaatgagttctgtcaccgaaacccaaaggcg
A0A3P8VHY5_MCL1-05      ctgtcaacccacaacgactcaatgagttctgtcaccgaaacccaaaggcg
A0A3P8VHY5_MCL1-02      ctgtcaacccacaacgactcaatgagttctgtcaccgaaacccaaaggcg
A0A3P8VHY5_MCL1-01      ctgtcaacccacaacgactcaatgagttctgtcaccgaaacccaaaggcg
A0A3P8VHY5_MCL1-03      ctgtcaacccacaacgactcaatgagttctgtcaccgaaacccaaaggcg

A0A3P8UWG7_BCL2L1-      ------------------tgattctccaaacaggactgat----------
A0A3P8VMA1_BCL2L1-      --------------cttctgatgttgaggat-------------------
A0A3P8WUE9_BCL2-01      -----------------ctggaatggcgagcgagtgt---------aacc
A0A3P8W7K5_BCL2L10      -----------agcagtctgatatcgc-----------------------
A0A3P8V8T6_MCL1-01      ---------------gtttgac----------------------------
A0A3P8VHY5_MCL1-04      acccaaggacctccaggttaacacggcaaacggacatgccagaaagagcc
A0A3P8VHY5_MCL1-05      acccaaggacctccaggttaacacggcaaacggacatgccagaaagagcc
A0A3P8VHY5_MCL1-02      acccaaggacctccaggttaacacggcaaacggacatgccagaaagagcc
A0A3P8VHY5_MCL1-01      acccaaggacctccaggttaacacggcaaacggacatgccagaaagagcc
A0A3P8VHY5_MCL1-03      acccaaggacctccaggttaacacggcaaacggacatgccagaaagagcc

A0A3P8UWG7_BCL2L1-      ----ggggaagaggcagggttgggcgcagagcagcggacaagtacgcacg
A0A3P8VMA1_BCL2L1-      ----tgggggagaacag----------cgtgaaggt--------------
A0A3P8WUE9_BCL2-01      gctatatagtggaaaagt-acatctgccataaactc----gccaagcgtg
A0A3P8W7K5_BCL2L10      ----tgggaggaaaatgtcatgtgggctgtg-------------------
A0A3P8V8T6_MCL1-01      -------------------------gctgtgcac----------------
A0A3P8VHY5_MCL1-04      actgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcg
A0A3P8VHY5_MCL1-05      actgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcg
A0A3P8VHY5_MCL1-02      actgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcg
A0A3P8VHY5_MCL1-01      actgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcg
A0A3P8VHY5_MCL1-03      actgtgaggtggacgaaggctctgagccgtgcacgccggagccacactcg

A0A3P8UWG7_BCL2L1-      ccaacgggact---------------------------------gtaaac
A0A3P8VMA1_BCL2L1-      --------------------------------------------gaggag
A0A3P8WUE9_BCL2-01      ggtacgtgtgggagcacgacgaggaccgagatggagacgctgctaataat
A0A3P8W7K5_BCL2L10      -----------------------------gaaagagaccctg--gctg-t
A0A3P8V8T6_MCL1-01      --------------------------------------actg--gaaaat
A0A3P8VHY5_MCL1-04      gaagcagaactcgatgtctcccaggccggggacgaggtgctg--gatacc
A0A3P8VHY5_MCL1-05      gaagcagaactcgatgtctcccaggccggggacgaggtgctg--gatacc
A0A3P8VHY5_MCL1-02      gaagcagaactcgatgtctcccaggccggggacgaggtgctg--gatacc
A0A3P8VHY5_MCL1-01      gaagcagaactcgatgtctcccaggccggggacgaggtgctg--gatacc
A0A3P8VHY5_MCL1-03      gaagcagaactcgatgtctcccaggccggggacgaggtgctg--gatacc

A0A3P8UWG7_BCL2L1-      ggcacaa-----------------gttct---------------------
A0A3P8VMA1_BCL2L1-      gtcaccacagcgtccagtaatggcgttcc---------------------
A0A3P8WUE9_BCL2-01      ggctcaatagtttcccgtccaccgactctggttcaccggtgccgtggtgc
A0A3P8W7K5_BCL2L10      ggcagag-gactacctgtccctctgctgt---------------------
A0A3P8V8T6_MCL1-01      gacacca-ggcaattgatttgcgatttcc---------------------
A0A3P8VHY5_MCL1-04      gatacca-aggaacttatttttcagttct---------------------
A0A3P8VHY5_MCL1-05      gatacca-aggaacttatttttcagttct---------------------
A0A3P8VHY5_MCL1-02      gatacca-aggaacttatttttcagttct---------------------
A0A3P8VHY5_MCL1-01      gatacca-aggaacttatttttcagttct---------------------
A0A3P8VHY5_MCL1-03      gatacca-aggaacttatttttcagttct---------------------
                        *                         *                       

A0A3P8UWG7_BCL2L1-      -----------------gggacgccgcctgcatctccactgcggcagcag
A0A3P8VMA1_BCL2L1-      --------------tcagactcctt-----cagctgtgctgcagca----
A0A3P8WUE9_BCL2-01      cagcaccgggcctgggaacgacggcatccctaacctctgcaaacgg----
A0A3P8W7K5_BCL2L10      --------------tcaagcccccggccagcccctccacctccca-----
A0A3P8V8T6_MCL1-01      --------------tgaaagacttcaccacaaaatctacccaacga----
A0A3P8VHY5_MCL1-04      --------------acagagactttacaactcattctccgtcgaaa----
A0A3P8VHY5_MCL1-05      --------------acagagactttacaactcattctccgtcgaaa----
A0A3P8VHY5_MCL1-02      --------------acagagactttacaactcattctccgtcgaaa----
A0A3P8VHY5_MCL1-01      --------------acagagactttacaactcattctccgtcgaaa----
A0A3P8VHY5_MCL1-03      --------------acagagactttacaactcattctccgtcgaaa----

A0A3P8UWG7_BCL2L1-      cattcggcgtcggatacaagtctggactccattaaagaggctctgcggga
A0A3P8VMA1_BCL2L1-      ---ctgcagtggtgcagag--------gctgtaaaggctgctctcaagga
A0A3P8WUE9_BCL2-01      ---ccacctgcgcccgaggcgcacgccgccattcacagagtcctgcgcga
A0A3P8W7K5_BCL2L10      -------------gcgagtcagccgctgccatgagacacctg--------
A0A3P8V8T6_MCL1-01      ---ttggtggagagcaaagcattgtcaactatgaaaagagtg--------
A0A3P8VHY5_MCL1-04      ---tggggcgaacgcaaagcgcttacgacgatgaaaagagtc--------
A0A3P8VHY5_MCL1-05      ---tggggcgaacgcaaagcgcttacgacgatgaaaagagtc--------
A0A3P8VHY5_MCL1-02      ---tggggcgaacgcaaagcgcttacgacgatgaaaagagtc--------
A0A3P8VHY5_MCL1-01      ---tggggcgaacgcaaagcgcttacgacgatgaaaagagtc--------
A0A3P8VHY5_MCL1-03      ---tggggcgaacgcaaagcgcttacgacgatgaaaagagtc--------
                                                    *  *                  

A0A3P8UWG7_BCL2L1-      ctcggccaacgagtttgaactgcgata-cgcgcgggcctt-cagcgatct
A0A3P8VMA1_BCL2L1-      ctcagctgacgagtttgaacttcg-cttcacacaagcctttcgtaacctt
A0A3P8WUE9_BCL2-01      agccggagacgaactggagcgactgtaccagccggacttctcagagatgt
A0A3P8W7K5_BCL2L10      -gcccaggaca---tggagaagcagcaccaagctcgcttc-ca--gacgt
A0A3P8V8T6_MCL1-01      -gtaaaaggcattttagacaaaca----cagacatgcatt-cagtggcat
A0A3P8VHY5_MCL1-04      -gtggacgacgttttggagaaaca----cagatatgcata-caatggtat
A0A3P8VHY5_MCL1-05      -gtggacgacgttttggagaaaca----cagatatgcata-caatggtat
A0A3P8VHY5_MCL1-02      -gtggacgacgttttggagaaaca----cagatatgcata-caatggtat
A0A3P8VHY5_MCL1-01      -gtggacgacgttttggagaaaca----cagatatgcata-caatggtat
A0A3P8VHY5_MCL1-03      -gtggacgacgttttggagaaaca----cagatatgcata-caatggtat
                                 *    * **    *     *       * *  *       *

A0A3P8UWG7_BCL2L1-      gcaccagcagctgcacatcacaccagccactgcctaccaaagtt------
A0A3P8VMA1_BCL2L1-      t-tcttaaagctggacctcactccggacacagtctaccacagtt------
A0A3P8WUE9_BCL2-01      c-a-cggcagctctatctcacctccagcacggcg---cagag------ga
A0A3P8W7K5_BCL2L10      t-gtc-tca-----gtctttcctgaggcaatgtggctctgagccctgtgt
A0A3P8V8T6_MCL1-01      g-atcaaca-----acctctcttttgaaaacgga---gtatataatattg
A0A3P8VHY5_MCL1-04      g-atcaaca-----aactttcattagaaaacaga---cagggtgatttga
A0A3P8VHY5_MCL1-05      g-atcaaca-----aactttcattagaaaacaga---cagggtgatttga
A0A3P8VHY5_MCL1-02      g-atcaaca-----aactttcattagaaaacaga---cagggtgatttga
A0A3P8VHY5_MCL1-01      g-atcaaca-----aactttcattagaaaacaga---cagggtgatttga
A0A3P8VHY5_MCL1-03      g-atcaaca-----aactttcattagaaaacaga---cagggtgatttga
                                *        *  *       *                     

A0A3P8UWG7_BCL2L1-      ------tcgagaatgtgatggacgaagtgttccgggacggtgtc---aat
A0A3P8VMA1_BCL2L1-      ------ttaagagcgtgatggatgaggtcttcagagacggagtc---aac
A0A3P8WUE9_BCL2-01      gattcaccgaggtgattgacgaa---ctgttccgggacgg---cgtgaac
A0A3P8W7K5_BCL2L10      gtgtc-ttaggaaggttatggaagagctggtaggagacggacacttgaac
A0A3P8V8T6_MCL1-01      gagttgttggggcagtggccaggagcctcttcagagatggcacctccaac
A0A3P8VHY5_MCL1-04      ctttcatcagctctgttgccaaaagcctgtttggagatggtaccacaaac
A0A3P8VHY5_MCL1-05      ctttcatcagctctgttgccaaaagcctgtttggagatggtaccacaaac
A0A3P8VHY5_MCL1-02      ctttcatcagctctgttgccaaaagcctgtttggagatggtaccacaaac
A0A3P8VHY5_MCL1-01      ctttcatcagctctgttgccaaaagcctgtttggagatggtaccacaaac
A0A3P8VHY5_MCL1-03      ctttcatcagctctgttgccaaaagcctgtttggagatggtaccacaaac
                                       *           *  *  * ** **   *   ** 

A0A3P8UWG7_BCL2L1-      tggggtcgcatcatagggctcttcgccttcggcggggcgctg--------
A0A3P8VMA1_BCL2L1-      tggggacgcatagtcggcctgtttactttcggaggagtactg--------
A0A3P8WUE9_BCL2-01      tggggccggattatcgccttcttcgagtttggaggcgtcgtg--------
A0A3P8W7K5_BCL2L10      tgggggagagttgtttccattttcacctttactggggttctggccaaaca
A0A3P8V8T6_MCL1-01      tggggtcgaatagttagcctggttgcatttggggcagtgctt--------
A0A3P8VHY5_MCL1-04      tggggtcggatcaccagcctggtggcctttggggcagttgtg--------
A0A3P8VHY5_MCL1-05      tggggtcggatcaccagcctggtggcctttggggcagttgtg--------
A0A3P8VHY5_MCL1-02      tggggtcggatcaccagcctggtggcctttggggcagttgtg--------
A0A3P8VHY5_MCL1-01      tggggtcggatcaccagcctggtggcctttggggcagttgtg--------
A0A3P8VHY5_MCL1-03      tggggtcggatcaccagcctggtggcctttggggcagttgtg--------
                        *****  *  *        *  *    **    *  *   *         

A0A3P8UWG7_BCL2L1-      agtgtc-------gagtgcgtggaga-------aagagatgagtcagctg
A0A3P8VMA1_BCL2L1-      --tgtgtg-----gaatgtgtgcaga-------ggaatatgagtgagtta
A0A3P8WUE9_BCL2-01      --tgtgtg-------gagtgtgcggctaagg--aggacttgacgccgcaa
A0A3P8W7K5_BCL2L10      gctgttggtccagaagggtttaaagccggggcaggaacccgaggcag--g
A0A3P8V8T6_MCL1-01      --tgtcagcacctaaaggagaaaggctggg---agaacacggtggaccag
A0A3P8VHY5_MCL1-04      --tgtcagcacctaaaggagtgtggtcaag---agaactcaacagagcta
A0A3P8VHY5_MCL1-05      --tgtcagcacctaaaggagtgtggtcaag---agaactcaacagagcta
A0A3P8VHY5_MCL1-02      --tgtcagcacctaaaggagtgtggtcaag---agaactcaacagagcta
A0A3P8VHY5_MCL1-01      --tgtcagcacctaaaggagtgtggtcaag---agaactcaacagagcta
A0A3P8VHY5_MCL1-03      --tgtcagcacctaaaggagtgtggtcaag---agaactcaacagagcta
                          ***            *      *           *             

A0A3P8UWG7_BCL2L1-      gtgg---------ccaggattgcggattgg-------atgacagt-----
A0A3P8VMA1_BCL2L1-      gtt---------ccccgcattgcagactgg-------atgaccat-----
A0A3P8WUE9_BCL2-01      gtggagcag---------gtcgtggactgg-------atgacaga-----
A0A3P8W7K5_BCL2L10      gcaggaactgggaccggagcctggaacctgcagggaactggcagagacca
A0A3P8V8T6_MCL1-01      gttggacaggagatc---gcctcatacctg-------ttgtc--------
A0A3P8VHY5_MCL1-04      gtaggaagagagatc---tcctcgtacctg-------ctgtc--------
A0A3P8VHY5_MCL1-05      gtaggaagagagatc---tcctcgtacctg-------ctgtc--------
A0A3P8VHY5_MCL1-02      gtaggaagagagatc---tcctcgtacctg-------ctgtc--------
A0A3P8VHY5_MCL1-01      gtaggaagagagatc---tcctcgtacctg-------ctgtc--------
A0A3P8VHY5_MCL1-03      gtaggaagagagatc---tcctcgtacctg-------ctgtc--------
                        *                        *   *        ** *        

A0A3P8UWG7_BCL2L1-      -------ctatcttgacaaccacatccagccatggatcgaaacccaaggt
A0A3P8VMA1_BCL2L1-      -------gtacttggatgaatacattgatccatggatccagagccaagga
A0A3P8WUE9_BCL2-01      -------gtatttaaatggacctcttaacatctggattaaagagaacggg
A0A3P8W7K5_BCL2L10      ttgctgattatctgggagaagagaagaaagcgtggcttttggagaatggt
A0A3P8V8T6_MCL1-01      -------ttatc------------agaaagactggctcctgaaaaacaac
A0A3P8VHY5_MCL1-04      -------ttacc------------agagagattggctattgaaaaacaac
A0A3P8VHY5_MCL1-05      -------ttacc------------agagagattggctattgaaaaacaac
A0A3P8VHY5_MCL1-02      -------ttacc------------agagagattggctattgaaaaacaac
A0A3P8VHY5_MCL1-01      -------ttacc------------agagagattggctattgaaaaacaac
A0A3P8VHY5_MCL1-03      -------ttacc------------agagagattggctattgaaaaacaac
                                **                      *** *        *    

A0A3P8UWG7_BCL2L1-      ggatgggagcattttgcggaactctttgg------------tcaggatgc
A0A3P8VMA1_BCL2L1-      ggctgggaccgttttgctgagatttttggcacagactgtattccaagaac
A0A3P8WUE9_BCL2-01      ggatgggatgcctttgtggagctgt----------------acgacagac
A0A3P8W7K5_BCL2L10      ggatgggaggggttctgtgagttct---------------ctcacagtgc
A0A3P8V8T6_MCL1-01      tcctgggatggcttcgtggaattct----------------tccaaggac
A0A3P8VHY5_MCL1-04      tcttgggatggctttgtagagttct----------------tcagagtag
A0A3P8VHY5_MCL1-05      tcttgggatggctttgtagagttct----------------tcagagtag
A0A3P8VHY5_MCL1-02      tcttgggatggctttgtagagttct----------------tcagagtag
A0A3P8VHY5_MCL1-01      tcttgggatggctttgtagagttct----------------tcagagtag
A0A3P8VHY5_MCL1-03      tcttgggatggctttgtagagttct----------------tcagagtag
                           *****    **    **  * *                 *       

A0A3P8UWG7_BCL2L1-      agcagcggagagccggaggtca--caggagagttttaagaaatggtt---
A0A3P8VMA1_BCL2L1-      gagg---agttgtcgggacacagtgagaagatg-----------------
A0A3P8WUE9_BCL2-01      aggg-----------ggagtctgccttcag-----ctgctcctggccctc
A0A3P8W7K5_BCL2L10      cagagagctgagccaggactcgtccatgaagaccgctctgtttgctgct-
A0A3P8V8T6_MCL1-01      aaga--------gccagagaaggcaattagatgtacacttcttggctt--
A0A3P8VHY5_MCL1-04      aaga--------cccagaggcaaccatgaggaacaccctccttggtct--
A0A3P8VHY5_MCL1-05      aaga--------cccagaggcaaccatgaggaacaccctccttggtct--
A0A3P8VHY5_MCL1-02      aaga--------cccagaggcaaccatgaggaacaccctccttggtct--
A0A3P8VHY5_MCL1-01      aaga--------cccagaggcaaccatgaggaacaccctccttggtct--
A0A3P8VHY5_MCL1-03      aaga--------cccagaggcaaccatgaggaacaccctccttggtct--

A0A3P8UWG7_BCL2L1-      ------------------gctggctgggatgacgctggtgacaggcgtgg
A0A3P8VMA1_BCL2L1-      -------gctgctagtggga--gcaggcctgcttgcagcagtg------t
A0A3P8WUE9_BCL2-01      catcaagaccgtctttggtctggctgcactgggggc--cgccagcctcac
A0A3P8W7K5_BCL2L10      -------gctagtgttggccttgctggact--------caccttcctc-c
A0A3P8V8T6_MCL1-01      ------------tgttgggtttgcaggactttgggcaacacttgccttac
A0A3P8VHY5_MCL1-04      ------------ttttggagttgctggactcggggcaacactggccctgt
A0A3P8VHY5_MCL1-05      ------------ttttggagttgctggactcggggcaacactggccctgt
A0A3P8VHY5_MCL1-02      ------------ttttggagttgctggactcggggcaacactggccctgt
A0A3P8VHY5_MCL1-01      ------------ttttggagttgctggactcggggcaacactggccctgt
A0A3P8VHY5_MCL1-03      ------------ttttggagttgctggactcggggcaacactggccctgt
                                              ** *   *                    

A0A3P8UWG7_BCL2L1-      tggtgggctccctgattgcccagaaacgtctc------------------
A0A3P8VMA1_BCL2L1-      tgattggtgttctgatcactaaaaagcat---------------------
A0A3P8WUE9_BCL2-01      c-atcggagcgtatctgacccagaag------------------------
A0A3P8W7K5_BCL2L10      tggtgcgc------------------------------------------
A0A3P8V8T6_MCL1-01      tgatgagatattttctcaggtttgtgtgg---------------------
A0A3P8VHY5_MCL1-04      tgatcaga------------------------------------------
A0A3P8VHY5_MCL1-05      tgatcaga------------------------------------------
A0A3P8VHY5_MCL1-02      tgatcagggatttcaactccattggaaaagccttcacagtggccttcgat
A0A3P8VHY5_MCL1-01      tgatcagg-------------tcaagaaaa--------------------
A0A3P8VHY5_MCL1-03      tgatcagg------------------------------------------
                           *  *                                           

A0A3P8UWG7_BCL2L1-      ------------------------tga------
A0A3P8VMA1_BCL2L1-      ------------------------tga------
A0A3P8WUE9_BCL2-01      ------------------------tga------
A0A3P8W7K5_BCL2L10      ------------------------tga------
A0A3P8V8T6_MCL1-01      ------------------------tag------
A0A3P8VHY5_MCL1-04      ------------------------taa------
A0A3P8VHY5_MCL1-05      ------------------------tggaaatga
A0A3P8VHY5_MCL1-02      gccatgttcctcttcattcgtcgctga------
A0A3P8VHY5_MCL1-01      ------------------------tga------
A0A3P8VHY5_MCL1-03      ------------------------tga------

© 1998-2022Legal notice