Dataset for CDS BCL-2-like of organism Chrysemys picta bellii

[Download (right click)] [Alignment] [Repertoires]

8 sequence(s)

>gnl|bcl2dbcds|A0A8C3EZ48_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=MCL-1 (length=666 residues).
tgtgctggggggtgctcccccagttcacccagaccctgccccactccactgcttccccccaggccccacctctgtcccac
tccatccccactccactgctgccctgcctcttcccgtcccgttctaccccatcccgagtgcaccctgccctcactcctcc
cacccagtgcctcctacacactggatcatggcaggcaggaggtcggcgatggcgtcattgagaagcagcagatcaccttc
caagggatgcttcggaagctagacatcaagcatgaggaggatctgaagtcagtaactgctgttgcaacccatattttcaa
tgatggggtaacaaactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataa
accaggagaattgcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgacattggttagttaac
caaagaggctgggagggatttgttgaattcttccgtgtagaggatctagaaggtagcagcatcaggaatgttctggtggc
ttttgctggactgggagcatccttgttgagaggatttttttttttttttaaaagcagtggttataaatgttcaggcctga
gtctccattgcataatgcagcagtga
>gnl|bcl2dbcds|A0A8C3FIW3_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2A1 (length=528 residues).
atggaacgctctgagtactgttatgtttaccatttagtccaagattatctgaaatacattcttcaggaaccacagcttgg
accagccccaagcagagttgctcatgtcttaagaaatactgcatcctttctgcaaaaggaaaatgaagagagtctgaaac
catgtttggacacacttgatattaccactgtagatgctgccagaagaattttcactgaagtcgtggataaagaatttgct
gatggaaacactaactggggacggattttgacaatatttatgtttggaggaattctttctaagaggcttcaagaacacaa
agttcagcttacaggagataataaagagcagatttcttatttcatcaccgagtacattataaacaacaaggctgagtgga
tagaggcaaatggaggttgggaaaacggcttcctacctatgtttgaggaaaaacgatcatggctgtccttattcaacatt
aaagcaaaaatcatggatgctttttccttcttcagtcagtacttttga
>gnl|bcl2dbcds|A0A8C3H9M3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=MCL-1 (length=597 residues).
atgttggcgttaaagcggaacgcggtgatcggcctcaacctgtactgcgggggcggcccgacgctgcccccgtccccgcc
gggctccccgagcggcgccgggacccctcccaccccgggccggctgctgagcgggccgcggggagcgggccccgccgccc
tggagaaggcgctggagacgctgcggagggtcggcgacggcgtcatggagaagcaccagctcgccttccaagggatgctt
cggaagctagacatcaagaatgaggaggatctgaagtcagtgactgccgttgcaacccatgttttcagtgatggagtaac
aaactggggtagaattgtgacactcatctcttttggtgcctttgttgcaaaacacctgaagagcataaaccaggagaatt
gcatcaacacactagcagggatcatcacagatgtgcttgtcacaggcaaacgagattggctagttaaccaaagaggctgg
gagggatttgttgaattcttccgtgtagaggatctagaaggtagcatcaggaatgttctggtggcttttgcaggctttgc
tggactgggagcaagcttggcctacatgatgcgatga
>gnl|bcl2dbcds|A0A8C3ITE1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL-2 (length=759 residues).
atgtatttaattgcatgtgtctgtacgttgcactggagggaaaagcacagcacttctgcaagagcttggagtcaaagagg
ctatgataaccgggagatagtgctgaagtacatccattacaaactgtcacagaggggatacgattgggctgccaatgaaa
acagaggaccagtttctccaaatctctctccccctactgttgctgggacctcatctgaccatgctgggctggtgtctctg
cctcctgagccccctggctcggctgctgctagtaacgtacctcttggtgatgggctgcgcccagcaccgcaggctgttct
cttgactctgtgccaagctggagatgaattttcccgccgctaccacagagattttgcccagatgtctggccagttgcact
tgaccccattcacggccagggggcgctttgtggcggtggtggaggagctgttccgagatggggttaactggggaaggatc
gtggccttctttgaattcggtggcgtgatgtgcgtggagagcgttaatcgggagatgtcgcctcttgtggacagcattgc
tgtgtggatgaccgagtacctgaacagacacctacataactggatccaagacaacggaggctgggatgcctttgtggaat
tgtacggcaacaacatgaggcctttgtttgatttctcctggatctctttgaagactatcctaagtctggctctggtggga
gcttgcatcacccttggcgcttatctgggacataagtga
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=711 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggagccatctgctgtccc
attgcgtctcgctgcagcggccaaggccccgtctcgacgctggctgtgcccagcccagggcactcggctag
© 1998-2022Legal notice