Dataset for CDS BCL-2-like of organism Chrysemys picta bellii

[Download (right click)] [Edit] [Sequences] [Repertoires]

8 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C3FIW3_BCL2A1-      -atgg-------------------------------------aacgctc-
A0A8C3EZ48_MCL1-01      tgtgc-----------------------------tggggggtgctcccc-
A0A8C3H9M3_MCL1-01      -atgt-----------------------------tgg-------------
A0A8C3ITE1_BCL2-01      -atgtatttaattgcatgtgtctgtacgttgcactggagggaaaagcaca
A0A8C3IUT0_BCL2L1-      -atgt-------------------------------------caaacac-
A0A8C3IUT0_BCL2L1-      -atgt-------------------------------------caaacac-
A0A8C3IUT0_BCL2L1-      -atgt-------------------------------------caaacac-
A0A8C3IUT0_BCL2L1-      -atgt-------------------------------------caaacac-
                          **                                              

A0A8C3FIW3_BCL2A1-      ----------------------tgagtactgttatgtttacc---attta
A0A8C3EZ48_MCL1-01      ---------------------------------cagttcacccagaccct
A0A8C3H9M3_MCL1-01      ----------------------------------cgttaaagcggaac--
A0A8C3ITE1_BCL2-01      gcacttctgcaagagcttggagtcaaagaggctatgataaccgggagata
A0A8C3IUT0_BCL2L1-      -------------------------------------taacagggagtta
A0A8C3IUT0_BCL2L1-      -------------------------------------taacagggagtta
A0A8C3IUT0_BCL2L1-      -------------------------------------taacagggagtta
A0A8C3IUT0_BCL2L1-      -------------------------------------taacagggagtta
                                                             * *     *    

A0A8C3FIW3_BCL2A1-      gtccaagat---------------tatctgaaatacattcttc-----ag
A0A8C3EZ48_MCL1-01      gccccactccactgcttccccccaggccccacctctgtcccactccatcc
A0A8C3H9M3_MCL1-01      gcggtgatc---------------ggcctcaac-ctgt---actgcgggg
A0A8C3ITE1_BCL2-01      gtgctgaag---------------tacatccattacaaactgtcacagag
A0A8C3IUT0_BCL2L1-      gtgactgac---------------tttctctcctacaagctatcgcagcg
A0A8C3IUT0_BCL2L1-      gtgactgac---------------tttctctcctacaagctatcgcagcg
A0A8C3IUT0_BCL2L1-      gtgactgac---------------tttctctcctacaagctatcgcagcg
A0A8C3IUT0_BCL2L1-      gtgactgac---------------tttctctcctacaagctatcgcagcg
                        *                                                 

A0A8C3FIW3_BCL2A1-      gaaccacagcttggaccagccccaagcagagt------------------
A0A8C3EZ48_MCL1-01      ccactccact-------gctgc----------------------------
A0A8C3H9M3_MCL1-01      gcggcccgac-------gctgc----------------------------
A0A8C3ITE1_BCL2-01      gggatacgattgg----gctgccaatgaaaacagaggaccagtttctcca
A0A8C3IUT0_BCL2L1-      gggatacagctggagtcggttcgagggggaggatgagatcag--------
A0A8C3IUT0_BCL2L1-      gggatacagctggagtcggttcgagggggaggatgagatcag--------
A0A8C3IUT0_BCL2L1-      gggatacagctggagtcggttcgagggggaggatgagatcag--------
A0A8C3IUT0_BCL2L1-      gggatacagctggagtcggttcgagggggaggatgagatcag--------
                              *              *                            

A0A8C3FIW3_BCL2A1-      --------------------tgctcatgtctta---agaaatactg----
A0A8C3EZ48_MCL1-01      ---cctgcctcttcccgtcccgttctaccccatcccgagtgcaccctgcc
A0A8C3H9M3_MCL1-01      ---c---cccgtccccgccgggctc--------cccgagcg----gcgcc
A0A8C3ITE1_BCL2-01      aatctctctccccctactgttgctgggacctcatctgaccatgctgggct
A0A8C3IUT0_BCL2L1-      --------------------gactgagtctgca---gaagaggctgagat
A0A8C3IUT0_BCL2L1-      --------------------gactgagtctgca---gaagaggctgagat
A0A8C3IUT0_BCL2L1-      --------------------gactgagtctgca---gaagaggctgagat
A0A8C3IUT0_BCL2L1-      --------------------gactgagtctgca---gaagaggctgagat
                                               *                          

A0A8C3FIW3_BCL2A1-      -----------------------catccttt-------------------
A0A8C3EZ48_MCL1-01      ctcactcctcc------------cacccagtgcctcctacacactggatc
A0A8C3H9M3_MCL1-01      gggacccctcc------------caccccgggccggctgctgagcgggcc
A0A8C3ITE1_BCL2-01      ggtgtctctgcctcctgag----ccccctggctcggctgctgctagtaac
A0A8C3IUT0_BCL2L1-      ggcaagcgtccctaatgggagtccatcctggcac-ccgggtgccagccac
A0A8C3IUT0_BCL2L1-      ggcaagcgtccctaatgggagtccatcctggcac-ccgggtgccagccac
A0A8C3IUT0_BCL2L1-      ggcaagcgtccctaatgggagtccatcctggcac-ccgggtgccagccac
A0A8C3IUT0_BCL2L1-      ggcaagcgtccctaatgggagtccatcctggcac-ccgggtgccagccac
                                               *  **                      

A0A8C3FIW3_BCL2A1-      --------------------------------------------------
A0A8C3EZ48_MCL1-01      a-------tggcaggcag--------------------g-----------
A0A8C3H9M3_MCL1-01      g-------cggggagcgg--------------------gccccgccgccc
A0A8C3ITE1_BCL2-01      gtacctcttggtgatgggctgcgcccagcaccg---caggct--------
A0A8C3IUT0_BCL2L1-      g-------tggtgaatggggctgccgggcacagtaacagccttgaagccc
A0A8C3IUT0_BCL2L1-      g-------tggtgaatggggctgccgggcacagtaacagccttgaagccc
A0A8C3IUT0_BCL2L1-      g-------tggtgaatggggctgccgggcacagtaacagccttgaagccc
A0A8C3IUT0_BCL2L1-      g-------tggtgaatggggctgccgggcacagtaacagccttgaagccc
                                                                          

A0A8C3FIW3_BCL2A1-      -----------------------------------ctgcaaaaggaaaat
A0A8C3EZ48_MCL1-01      ------------------------------------------aggtcggc
A0A8C3H9M3_MCL1-01      tggagaaggcgctggagacg---------------ctgcggagggtcggc
A0A8C3ITE1_BCL2-01      --------gttctcttgact---------------ctgtgccaagctgga
A0A8C3IUT0_BCL2L1-      atgaaagggttccggcaactggagtgaggcaggcactgagagaggcagga
A0A8C3IUT0_BCL2L1-      atgaaagggttccggcaactggagtgaggcaggcactgagagaggcagga
A0A8C3IUT0_BCL2L1-      atgaaagggttccggcaactggagtgaggcaggcactgagagaggcagga
A0A8C3IUT0_BCL2L1-      atgaaagggttccggcaactggagtgaggcaggcactgagagaggcagga
                                                                    *     

A0A8C3FIW3_BCL2A1-      ga----------------------agagagtctgaaaccatgtttggaca
A0A8C3EZ48_MCL1-01      gatggcgtcattgagaagcagcagatcaccttccaagggatgcttcggaa
A0A8C3H9M3_MCL1-01      gacggcgtcatggagaagcaccagctcgccttccaagggatgcttcggaa
A0A8C3ITE1_BCL2-01      gatgaattttcccgccgctaccacagagattttgcccagatgtctggcca
A0A8C3IUT0_BCL2L1-      gatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
A0A8C3IUT0_BCL2L1-      gatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
A0A8C3IUT0_BCL2L1-      gatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
A0A8C3IUT0_BCL2L1-      gatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
                        **                            *         *   *    *

A0A8C3FIW3_BCL2A1-      cacttgatattaccactgtagatgctgccagaagaatt-------ttcac
A0A8C3EZ48_MCL1-01      -gctagacatca----------agcatgaggaggatctgaagtcagtaac
A0A8C3H9M3_MCL1-01      -gctagacatca----------agaatgaggaggatctgaagtcagtgac
A0A8C3ITE1_BCL2-01      -gttgcacttgaccccattcacggccagggggcgctttgtg---------
A0A8C3IUT0_BCL2L1-      -gctccacatcacccctggcacggcataccagagctttgag---------
A0A8C3IUT0_BCL2L1-      -gctccacatcacccctggcacggcataccagagctttgag---------
A0A8C3IUT0_BCL2L1-      -gctccacatcacccctggcacggcataccagagctttgag---------
A0A8C3IUT0_BCL2L1-      -gctccacatcacccctggcacggcataccagagctttgag---------
                           *  *  * *           *         *   *            

A0A8C3FIW3_BCL2A1-      tgaagtcgtggataaagaatttgctgatggaaacactaactggggacgga
A0A8C3EZ48_MCL1-01      tgctgttgcaacccatattttcaatgatggggtaacaaactggggtagaa
A0A8C3H9M3_MCL1-01      tgccgttgcaacccatgttttcagtgatggagtaacaaactggggtagaa
A0A8C3ITE1_BCL2-01      -gcggtggtggaggagctgttccgagatggggt---taactggggaagga
A0A8C3IUT0_BCL2L1-      -caggtggtgaatgaactcttccgggacggagt---gaactgggggcgca
A0A8C3IUT0_BCL2L1-      -caggtggtgaatgaactcttccgggacggagt---gaactgggggcgca
A0A8C3IUT0_BCL2L1-      -caggtggtgaatgaactcttccgggacggagt---gaactgggggcgca
A0A8C3IUT0_BCL2L1-      -caggtggtgaatgaactcttccgggacggagt---gaactgggggcgca
                            ** *      *    **    ** **       ********  * *

A0A8C3FIW3_BCL2A1-      ttttgacaatatttatgtttggaggaattctttctaagaggcttcaagaa
A0A8C3EZ48_MCL1-01      ttgtgacactcatctcttt