Dataset for CDS MCL-1 of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C6GJU8_MCL1-01      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
A0A8C6GJU8_MCL1-02      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg
A0A8C6GJU8_MCL1-03      atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcgg

A0A8C6GJU8_MCL1-01      cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg
A0A8C6GJU8_MCL1-02      cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg
A0A8C6GJU8_MCL1-03      cggcgccagcctcggcgcgggcggcggttctccggcaggggcgcgcctgg

A0A8C6GJU8_MCL1-01      tggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctg
A0A8C6GJU8_MCL1-02      tggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctg
A0A8C6GJU8_MCL1-03      tggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctg

A0A8C6GJU8_MCL1-01      ctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagga
A0A8C6GJU8_MCL1-02      ctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagga
A0A8C6GJU8_MCL1-03      ctgcccggcgcgcgggtggtcgcccggccgccgcccgtgggcgccgagga

A0A8C6GJU8_MCL1-01      ccccgacgtcaccgcgtcggccgaaaggcggctgcataagtcgcccggcc
A0A8C6GJU8_MCL1-02      ccccgacgtcaccgcgtcggccgaaaggcggctgcataagtcgcccggcc
A0A8C6GJU8_MCL1-03      ccccgacgtcaccgcgtcggccgaaaggcggctgcataagtcgcccggcc

A0A8C6GJU8_MCL1-01      tcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatc
A0A8C6GJU8_MCL1-02      tcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatc
A0A8C6GJU8_MCL1-03      tcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatc

A0A8C6GJU8_MCL1-01      gtgtctcccgaggaggaactggacggctgcgagccggaggcgatcggcaa
A0A8C6GJU8_MCL1-02      gtgtctcccgaggaggaactggacggctgcgagccggaggcgatcggcaa
A0A8C6GJU8_MCL1-03      gtgtctcccgaggaggaactggacggctgcgagccggaggcgatcggcaa

A0A8C6GJU8_MCL1-01      gcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
A0A8C6GJU8_MCL1-02      gcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
A0A8C6GJU8_MCL1-03      gcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga

A0A8C6GJU8_MCL1-01      gctccggggccgacggctctctgccctccacgccgccgccgcccgaggag
A0A8C6GJU8_MCL1-02      gctccggggccgacggctctctgccctccacgccgccgccgcccgaggag
A0A8C6GJU8_MCL1-03      gctccggggccgacggctctctgccctccacgccgccgccgcccgaggag

A0A8C6GJU8_MCL1-01      gaagaggacgacctataccgccagtcgctggagatcatctcgcgctactt
A0A8C6GJU8_MCL1-02      gaagaggacgacctataccgccagtcgctggagatcatctcgcgctactt
A0A8C6GJU8_MCL1-03      gaagaggacgacctataccgccagtcgctggagatcatctcgcgctactt

A0A8C6GJU8_MCL1-01      gcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgg
A0A8C6GJU8_MCL1-02      gcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgg
A0A8C6GJU8_MCL1-03      gcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgg

A0A8C6GJU8_MCL1-01      gcgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggc
A0A8C6GJU8_MCL1-02      gcgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggc
A0A8C6GJU8_MCL1-03      gcgcggcgggccggagagcgctggagaccctgcggcgcgtgggcgacggc

A0A8C6GJU8_MCL1-01      gtgcagcgcaaccacgagacggccttccagggcatgctccggaaactgga
A0A8C6GJU8_MCL1-02      gtgcagcgcaaccacgagacggccttccagggcatgctccggaaactgga
A0A8C6GJU8_MCL1-03      gtgcagcgcaaccacgagacggccttccagggcatgctccggaaactgga

A0A8C6GJU8_MCL1-01      cattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatg
A0A8C6GJU8_MCL1-02      cattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatg
A0A8C6GJU8_MCL1-03      cattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatg

A0A8C6GJU8_MCL1-01      ttttcaaagatggcgtaacaaactggggcaggattgtgactcttatttct
A0A8C6GJU8_MCL1-02      ttttcaaagatggcgtaacaaactggggcaggattgtgactcttatttct
A0A8C6GJU8_MCL1-03      ttttcaaagatggcgtaacaaactggggcaggattgtgactcttatttct

A0A8C6GJU8_MCL1-01      ttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
A0A8C6GJU8_MCL1-02      ttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
A0A8C6GJU8_MCL1-03      ttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg

A0A8C6GJU8_MCL1-01      catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaac
A0A8C6GJU8_MCL1-02      catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaac
A0A8C6GJU8_MCL1-03      catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaac

A0A8C6GJU8_MCL1-01      gggactggcttgtcaaacaaagaggctggcctccatggttaaagg---tt
A0A8C6GJU8_MCL1-02      gggactggcttgtcaaacaaagaggctgggatgggtttgtggagttcttc
A0A8C6GJU8_MCL1-03      gggactggcttgtcaaacaaagaggctgggttgtacttctaa------tt
                        *****************************  *       *        * 

A0A8C6GJU8_MCL1-01      cagcccca----cttcacagtgacatgttcatataaaggaagccaatcac
A0A8C6GJU8_MCL1-02      cacgtacaggacctagaaggcggc--atcagaaatgtgctgctggctttt
A0A8C6GJU8_MCL1-03      cagttggataatcttcagagcagtggattcaaaccgtga-----------
                        **     *    **  *  *       *    *    *            

A0A8C6GJU8_MCL1-01      ccaactgctga-------------------------------------
A0A8C6GJU8_MCL1-02      gcgggtgttgctggagtaggggctggtctggcatatctaataagatag
A0A8C6GJU8_MCL1-03      ------------------------------------------------

© 1998-2023Legal notice