Dataset for CDS MCL-1 of organism Mus spicilegus

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=954 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggc
ctccatggttaaaggttcagccccacttcacagtgacatgttcatataaaggaagccaatcacccaactgctga
>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=996 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
atgggtttgtggagttcttccacgtacaggacctagaaggcggcatcagaaatgtgctgctggcttttgcgggtgttgct
ggagtaggggctggtctggcatatctaataagatag
>gnl|bcl2dbcds|A0A8C6GJU8_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Mus spicilegus GN=MCL-1 (length=933 residues).
atgtttggcctgcggagaaacgcggtcatcggcttgaacctgtactgcggcggcgccagcctcggcgcgggcggcggttc
tccggcaggggcgcgcctggtggccgaggaggccaaggcgcggcgcgaggggggaggggaggccgccctgctgcccggcg
cgcgggtggtcgcccggccgccgcccgtgggcgccgaggaccccgacgtcaccgcgtcggccgaaaggcggctgcataag
tcgcccggcctcctcgccgtgccgcccgaggagatggccgcgtcggccgccgccgccatcgtgtctcccgaggaggaact
ggacggctgcgagccggaggcgatcggcaagcgcccggccgtgctgcccctcctggagcgcgtgagcgaggcggccaaga
gctccggggccgacggctctctgccctccacgccgccgccgcccgaggaggaagaggacgacctataccgccagtcgctg
gagatcatctcgcgctacttgcgggagcaggcgaccggctccaaggactcgaagcctctgggcgaggcgggcgcggcggg
ccggagagcgctggagaccctgcggcgcgtgggcgacggcgtgcagcgcaaccacgagacggccttccagggcatgctcc
ggaaactggacattaaaaacgaaggcgatgttaaatctttttctcgagtaatggtccatgttttcaaagatggcgtaaca
aactggggcaggattgtgactcttatttctttcggtgcctttgtggccaaacacttaaagagcgtaaaccaagaaagctg
catcgaaccattagcagaaactatcacagatgttcttgtaaggacgaaacgggactggcttgtcaaacaaagaggctggg
ttgtacttctaattcagttggataatcttcagagcagtggattcaaaccgtga
© 1998-2022Legal notice