Dataset for CDS BAX-like of Organism Biomphalaria glabrata

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A0A182YU00_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=672 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgccagaagctgacataggt
agacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaatct
agattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaactggg
gaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctctca
tttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatggtgg
atggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctgctg
tcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-04 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-05 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A182YU00_BAK1-06 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Biomphalaria glabrata GN=BAK1 (length=675 residues).
atggcctggtcgcagggtcaagataaccattcctttctacctgggggtctgatgaccttgagagagccacaaatacgccc
tgattctgaagggaatgtcagtgcgcagactgaagcagtctttcggaactatatgtaccaaagctatgaaaatgatctca
acagagaagatgctcaggatattcctgttgttaacgaactcttgcatctatctgatcctccgagtccagaagctgacata
ggtagacagttggccaggtttggagatagcataaatgccaaatatgctgatgtctttgactcaatgatatcaaacctaaa
tctagattcagataattcagaaaatgcttatgaagattttgctcaaatagcaaggagagttttaactactaagatcaact
ggggaaccatcttaattcttctcaactttggatatcgtatagccctcacagtcttgaggtcaaagacatcacagtttctc
tcatttttatcaagaattgtttcttatatatgccgctttattctaagtgagagaatagccaagtggattgcggatcatgg
tggatggagagcagccttgagttacattccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgctg
ctgtcattggcatcatcttcagtcacagactatga
>gnl|bcl2dbcds|A0A2C9L934_BAX-01 BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata GN=BAX (length=507 residues).
atggttttggtcattgttgtgatagatgcaccacgaaggcagcagagattaactctcgaggatgtcacaaatcagggacg
ctatctgctcaacaactttatatatgagcgtatgcaaagtgatggaatcgagacagttcctggcattgaacaattacaag
aacctggtacacccacagggccaccaatggaacatgttcgagaaataggcagagcattgaggtttattggtgatgactta
gacaaagatcaaaaactacaagagcttgtaaacagagttcctcctgaggcagaacgacaaactttattaactgtagcctc
caatatatttaaagatggtatcttcaactggggtagagttgttgccttgttttactttgcttacaaagtttgtttgaagg
ctcttgatagaatccctctaatccgagccatcataaatttgattgtggagttcatgagagatcatgtagttcgatggatt
attgagagagggggatggacattttag
>gnl|bcl2dbcds|A0A2C9L934_BAX-02 BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata GN=BAX (length=609 residues).
atggttttggtcattgttgtgatagatgcaccacgaaggcagcagagattaactctcgaggatgtcacaaatcagggacg
ctatctgctcaacaactttatatatgagcgtatgcaaagtgatggaatcgagacagttcctggcattgaacaattacaag
aacctggtacacccacagggccaccaatggaacatgttcgagaaataggcagagcattgaggtttattggtgatgactta
gacaaagatcaaaaactacaagagcttgtaaacagagttcctcctgaggcagaacgacaaactttattaactgtagcctc
caatatatttaaagatggtatcttcaactggggtagagttgttgccttgttttactttgcttacaaagtttgtttgaagg
ctcttgatagaatccctctaatccgagccatcataaatttgattgtggagttcatgagagatcatgtagttcgatggatt
attgagagagggggatgggaggctatacgcgagtattttggtagctcacaaacacagtttgctgtggtcattggagctgg
agccatcgcttgtgctgccgttctcctctatcgcaaatatttctcttaa
>gnl|bcl2dbcds|A0A2C9L934_BAX-03 BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata GN=BAX (length=546 residues).
atggttttggtcattgttgtgatagatgcaccacgaaggcagcagagattaactctcgaggatgtcacaaatcagggacg
ctatctgctcaacaactttatatatgagcgtatgcaaagtgatggaatcgagacagttcctggcattgaacaattacaag
aacctggtacacccacagggccaccaatggaacatgttcgagaaataggcagagcattgaggtttattggtgatgactta
gacaaagatcaaaaactacaagagcttgtaaacagagttcctcctgaggcagaacgacaaactttattaactgtagcctc
caatatatttaaagatggtatcttcaactggggtagagttgttgccttgttttactttgcttacaaagtttgtttgaagg
ctcttgatagaatccctctaatccgagccatcataaatttgattgtggagttcatgagagatcatgtagttcgatggatt
attgagagagggggatggtgtgaaactgtgctcagccacaatgagataaaacaacctgagctgtag
>gnl|bcl2dbcds|A0A2C9L934_BAX-04 BCL2-associated X gene OS=[Eukaryota] Biomphalaria glabrata GN=BAX (length=534 residues).
atggttttggtcattgttgtgatagatgcaccacgaaggcagcagagattaactctcgaggatgtcacaaatcagggacg
ctatctgctcaacaactttatatatgagcgtatgcaaagtgatggaatcgagacagttcctggcattgaacaattacaag
aacctggtacacccacagggccaccaatggaacatgttcgagaaataggcagagcattgaggtttattggtgatgactta
gacaaagatcaaaaactacaagagcttgtaaacagagttcctcctgaggcagaacgacaaactttattaactgtagcctc
caatatatttaaagatggtatcttcaactggggtagagttgttgccttgttttactttgcttacaaagtttgtttgaagg
ctcttgatagaatccctctaatccgagccatcataaatttgattgtggagttcatgagagatcatgtagttcgatggatt
attgagagagggggatgggtcaactactacaccatgattactagtgggggttag
© 1998-2023Legal notice