Dataset for CDS BAX-like of Organism Biomphalaria glabrata

[Download (right click)] [Edit] [Sequences] [Repertoires]

10 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A182YU00_BAK1-01      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-02      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-03      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-04      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-05      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A182YU00_BAK1-06      atggcctggtcgcagggtcaagataaccattcctttctacctgggggtct
A0A2C9L934_BAX-04       atggttttggt-cattgttgtgata-------------------------
A0A2C9L934_BAX-03       atggttttggt-cattgttgtgata-------------------------
A0A2C9L934_BAX-01       atggttttggt-cattgttgtgata-------------------------
A0A2C9L934_BAX-02       atggttttggt-cattgttgtgata-------------------------
                        ****  * *   **  **   ****                         

A0A182YU00_BAK1-01      gatg-accttgagagagccacaaatacgccctgattctgaagggaatgtc
A0A182YU00_BAK1-02      gatg-accttgagagagccacaaatacgccctgattctgaagggaatgtc
A0A182YU00_BAK1-03      gatg-accttgagagagccacaaatacgccctgattctgaagggaatgtc
A0A182YU00_BAK1-04      gatg-accttgagagagccacaaatacgccctgattctgaagggaatgtc
A0A182YU00_BAK1-05      gatg-accttgagagagccacaaatacgccctgattctgaagggaatgtc
A0A182YU00_BAK1-06      gatg-accttgagagagccacaaatacgccctgattctgaagggaatgtc
A0A2C9L934_BAX-04       gatgcaccacgaaggcagcagagat------taactctcgagg--atgtc
A0A2C9L934_BAX-03       gatgcaccacgaaggcagcagagat------taactctcgagg--atgtc
A0A2C9L934_BAX-01       gatgcaccacgaaggcagcagagat------taactctcgagg--atgtc
A0A2C9L934_BAX-02       gatgcaccacgaaggcagcagagat------taactctcgagg--atgtc
                        **** ***  **  *   ** * **      * * ***  ***  *****

A0A182YU00_BAK1-01      agtgcgcagactgaagcagtct--ttcggaactatatgtaccaaagctat
A0A182YU00_BAK1-02      agtgcgcagactgaagcagtct--ttcggaactatatgtaccaaagctat
A0A182YU00_BAK1-03      agtgcgcagactgaagcagtct--ttcggaactatatgtaccaaagctat
A0A182YU00_BAK1-04      agtgcgcagactgaagcagtct--ttcggaactatatgtaccaaagctat
A0A182YU00_BAK1-05      agtgcgcagactgaagcagtct--ttcggaactatatgtaccaaagctat
A0A182YU00_BAK1-06      agtgcgcagactgaagcagtct--ttcggaactatatgtaccaaagctat
A0A2C9L934_BAX-04       acaaatcagg--gacgctatctgctcaacaactttatatatgagcg-tat
A0A2C9L934_BAX-03       acaaatcagg--gacgctatctgctcaacaactttatatatgagcg-tat
A0A2C9L934_BAX-01       acaaatcagg--gacgctatctgctcaacaactttatatatgagcg-tat
A0A2C9L934_BAX-02       acaaatcagg--gacgctatctgctcaacaactttatatatgagcg-tat
                        *     ***   ** **  ***  *    **** *** **  *  * ***

A0A182YU00_BAK1-01      g-aaaatgatctcaacagagaagatgctcaggata-ttcctgttgttaac
A0A182YU00_BAK1-02      g-aaaatgatctcaacagagaagatgctcaggata-ttcctgttgttaac
A0A182YU00_BAK1-03      g-aaaatgatctcaacagagaagatgctcaggata-ttcctgttgttaac
A0A182YU00_BAK1-04      g-aaaatgatctcaacagagaagatgctcaggata-ttcctgttgttaac
A0A182YU00_BAK1-05      g-aaaatgatctcaacagagaagatgctcaggata-ttcctgttgttaac
A0A182YU00_BAK1-06      g-aaaatgatctcaacagagaagatgctcaggata-ttcctgttgttaac
A0A2C9L934_BAX-04       gcaaagtgat--------ggaa-----tcgagacagttcctggcatt---
A0A2C9L934_BAX-03       gcaaagtgat--------ggaa-----tcgagacagttcctggcatt---
A0A2C9L934_BAX-01       gcaaagtgat--------ggaa-----tcgagacagttcctggcatt---
A0A2C9L934_BAX-02       gcaaagtgat--------ggaa-----tcgagacagttcctggcatt---
                        * *** ****         ***     **  ** * ******   **   

A0A182YU00_BAK1-01      gaactcttgcatctatctgatcctccg---ccagaagctgacataggtag
A0A182YU00_BAK1-02      gaactcttgcatctatctgatcctccgagtccagaagctgacataggtag
A0A182YU00_BAK1-03      gaactcttgcatctatctgatcctccgagtccagaagctgacataggtag
A0A182YU00_BAK1-04      gaactcttgcatctatctgatcctccgagtccagaagctgacataggtag
A0A182YU00_BAK1-05      gaactcttgcatctatctgatcctccgagtccagaagctgacataggtag
A0A182YU00_BAK1-06      gaactcttgcatctatctgatcctccgagtccagaagctgacataggtag
A0A2C9L934_BAX-04       gaacaattacaagaacctggtacac-----ccacagggccac--------
A0A2C9L934_BAX-03       gaacaattacaagaacctggtacac-----ccacagggccac--------
A0A2C9L934_BAX-01       gaacaattacaagaacctggtacac-----ccacagggccac--------
A0A2C9L934_BAX-02       gaacaattacaagaacctggtacac-----ccacagggccac--------
                        ****  ** **   * *** * * *     *** * *   **        

A0A182YU00_BAK1-01      acagttggccaggtttg-gagatagcataaatgccaaatatgctgatgtc
A0A182YU00_BAK1-02      acagttggccaggtttg-gagatagcataaatgccaaatatgctgatgtc
A0A182YU00_BAK1-03      acagttggccaggtttg-gagatagcataaatgccaaatatgctgatgtc
A0A182YU00_BAK1-04      acagttggccaggtttg-gagatagcataaatgccaaatatgctgatgtc
A0A182YU00_BAK1-05      acagttggccaggtttg-gagatagcataaatgccaaatatgctgatgtc
A0A182YU00_BAK1-06      acagttggccaggtttg-gagatagcataaatgccaaatatgctgatgtc
A0A2C9L934_BAX-04       -caatggaacatgttcgagaaatag-------gcagagcat--tgaggtt
A0A2C9L934_BAX-03       -caatggaacatgttcgagaaatag-------gcagagcat--tgaggtt
A0A2C9L934_BAX-01       -caatggaacatgttcgagaaatag-------gcagagcat--tgaggtt
A0A2C9L934_BAX-02       -caatggaacatgttcgagaaatag-------gcagagcat--tgaggtt
                         ** * *  ** *** * ** ****       **  *  **  *** ** 

A0A182YU00_BAK1-01      tttgactcaatgatatcaaacctaaatctagattcagataa--ttcagaa
A0A182YU00_BAK1-02      tttgactcaatgatatcaaacctaaatctagattcagataa--ttcagaa
A0A182YU00_BAK1-03      tttgactcaatgatatcaaacctaaatctagattcagataa--ttcagaa
A0A182YU00_BAK1-04      tttgactcaatgatatcaaacctaaatctagattcagataa--ttcagaa
A0A182YU00_BAK1-05      tttgactcaatgatatcaaacctaaatctagattcagataa--ttcagaa
A0A182YU00_BAK1-06      tttgactcaatgatatcaaacctaaatctagattcagataa--ttcagaa
A0A2C9L934_BAX-04       t----attggtgat----------------gacttagacaaagatcaaaa
A0A2C9L934_BAX-03       t----attggtgat----------------gacttagacaaagatcaaaa
A0A2C9L934_BAX-01       t----attggtgat----------------gacttagacaaagatcaaaa
A0A2C9L934_BAX-02       t----attggtgat----------------gacttagacaaagatcaaaa
                        *     *   ****                ** * *** **   *** **

A0A182YU00_BAK1-01      aatgcttatgaagattttgctcaaatagcaaggagagttttaactactaa
A0A182YU00_BAK1-02      aatgcttatgaagattttgctcaaatagcaaggagagttttaactactaa
A0A182YU00_BAK1-03      aatgcttatgaagattttgctcaaatagcaaggagagttttaactactaa
A0A182YU00_BAK1-04      aatgcttatgaagattttgctcaaatagcaaggagagttttaactactaa
A0A182YU00_BAK1-05      aatgcttatgaagattttgctcaaatagcaaggagagttttaactactaa
A0A182YU00_BAK1-06      aatgcttatgaagattttgctcaaatagcaaggagagttttaactactaa
A0A2C9L934_BAX-04       actac-----aagagctt---------gtaaacagagttc---ctcctga
A0A2C9L934_BAX-03       actac-----aagagctt---------gtaaacagagttc---ctcctga
A0A2C9L934_BAX-01       actac-----aagagctt---------gtaaacagagttc---ctcctga
A0A2C9L934_BAX-02       actac-----aagagctt---------gtaaacagagttc---ctcctga
                        * * *     ****  **         * **  ******    ** ** *

A0A182YU00_BAK1-01      gatcaactggggaaccatcttaattct---tctcaac---tttggatatc
A0A182YU00_BAK1-02      gatcaactggggaaccatcttaattct---tctcaac---tttggatatc
A0A182YU00_BAK1-03      gatcaactggggaaccatcttaattct---tctcaac---tttggatatc
A0A182YU00_BAK1-04      gatcaactggggaaccatcttaattct---tctcaac---tttggatatc
A0A182YU00_BAK1-05      gatcaactggggaaccatcttaattct---tctcaac---tttggatatc
A0A182YU00_BAK1-06      gatcaactggggaaccatcttaattct---tctcaac---tttggatatc
A0A2C9L934_BAX-04       ggcagaacgacaaactttattaactgtagcctccaatatatttaaagatg
A0A2C9L934_BAX-03       ggcagaacgacaaactttattaactgtagcctccaatatatttaaagatg
A0A2C9L934_BAX-01       ggcagaacgacaaactttattaactgtagcctccaatatatttaaagatg
A0A2C9L934_BAX-02       ggcagaacgacaaactttattaactgtagcctccaatatatttaaagatg
                        *    *  *   ***  * **** * *      ***    ***  * ** 

A0A182YU00_BAK1-01      gtatagccctcacagtcttgaggtcaaagacatcacagtttctctcattt
A0A182YU00_BAK1-02      gtatagccctcacagtcttgaggtcaaagacatcacagtttctctcattt
A0A182YU00_BAK1-03      gtatagccctcacagtcttgaggtcaaagacatcacagtttctctcattt
A0A182YU00_BAK1-04      gtatagccctcacagtcttgaggtcaaagacatcacagtttctctcattt
A0A182YU00_BAK1-05      gtatagccctcacagtcttgaggtcaaagacatcacagtttctctcattt
A0A182YU00_BAK1-06      gtatagccctcacagtcttgaggtcaaagacatcacagtttctctcattt
A0A2C9L934_BAX-04       gtat---cttca----actggggt-agagttgttgccttgttttactttg
A0A2C9L934_BAX-03       gtat---cttca----actggggt-agagttgttgccttgttttactttg
A0A2C9L934_BAX-01       gtat---cttca----actggggt-agagttgttgccttgttttactttg
A0A2C9L934_BAX-02       gtat---cttca----actggggt-agagttgttgccttgttttactttg
                        ****   * ***      ** *** * **   *  *  * * *  * ** 

A0A182YU00_BAK1-01      ttatcaagaattgttt--------cttatatatgccgctttattctaag-
A0A182YU00_BAK1-02      ttatcaagaattgttt--------cttatatatgccgctttattctaag-
A0A182YU00_BAK1-03      ttatcaagaattgttt--------cttatatatgccgctttattctaag-
A0A182YU00_BAK1-04      ttatcaagaattgttt--------cttatatatgccgctttattctaag-
A0A182YU00_BAK1-05      ttatcaagaattgttt--------cttatatatgccgctttattctaag-
A0A182YU00_BAK1-06      ttatcaagaattgttt--------cttatatatgccgctttattctaag-
A0A2C9L934_BAX-04       cttacaaagtttgtttgaaggctcttgatagaatcc-ctctaatccgagc
A0A2C9L934_BAX-03       cttacaaagtttgtttgaaggctcttgatagaatcc-ctctaatccgagc
A0A2C9L934_BAX-01       cttacaaagtttgtttgaaggctcttgatagaatcc-ctctaatccgagc
A0A2C9L934_BAX-02       cttacaaagtttgtttgaaggctcttgatagaatcc-ctctaatccgagc
                         *  ***   ******         * *** *  ** ** ** **  ** 

A0A182YU00_BAK1-01      --------------------------tgagaga----atagccaagtgga
A0A182YU00_BAK1-02      --------------------------tgagaga----atagccaagtgga
A0A182YU00_BAK1-03      --------------------------tgagaga----atagccaagtgga
A0A182YU00_BAK1-04      --------------------------tgagaga----atagccaagtgga
A0A182YU00_BAK1-05      --------------------------tgagaga----atagccaagtgga
A0A182YU00_BAK1-06      --------------------------tgagaga----atagccaagtgga
A0A2C9L934_BAX-04       catcataaatttgattgtggagttcatgagagatcatgtagttcgatgga
A0A2C9L934_BAX-03       catcataaatttgattgtggagttcatgagagatcatgtagttcgatgga
A0A2C9L934_BAX-01       catcataaatttgattgtggagttcatgagagatcatgtagttcgatgga
A0A2C9L934_BAX-02       catcataaatttgattgtggagttcatgagagatcatgtagttcgatgga
                                                  *******     ***     ****

A0A182YU00_BAK1-01      ttgcggatcatggtggatggagagc---------agccttgagttacatt
A0A182YU00_BAK1-02      ttgcggatcatggtggatggagagc---------agccttgagttacatt
A0A182YU00_BAK1-03      ttgcggatcatggtggatggagagc---------agccttgagttacatt
A0A182YU00_BAK1-04      ttgcggatcatggtggatggagagc---------agccttgagttacatt
A0A182YU00_BAK1-05      ttgcggatcatggtggatggagagc---------agccttgagttacatt
A0A182YU00_BAK1-06      ttgcggatcatggtggatggagagc---------agccttgagttacatt
A0A2C9L934_BAX-04       ttattgagagagggggatgg----------------------------gt
A0A2C9L934_BAX-03       ttattgagagagggggatggtgtg----------aaactgtg------ct
A0A2C9L934_BAX-01       ttattgagagagggggatgg--------------acattttag-------
A0A2C9L934_BAX-02       ttattgagagagggggatgggaggctatacgcgagtattttggtagctca
                        **   **    ** ******                              

A0A182YU00_BAK1-01      ccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgc
A0A182YU00_BAK1-02      ccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgc
A0A182YU00_BAK1-03      ccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgc
A0A182YU00_BAK1-04      ccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgc
A0A182YU00_BAK1-05      ccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgc
A0A182YU00_BAK1-06      ccactgatgtcttcaaaaccattctggctagtgactgccctgcaggctgc
A0A2C9L934_BAX-04       caactactacaccatgattactagtgggggttag----------------
A0A2C9L934_BAX-03       cagccacaatgagataaaacaacctgagctgtag----------------
A0A2C9L934_BAX-01       --------------------------------------------------
A0A2C9L934_BAX-02       caaacacagtttgctgtggtcattggagctggagccatcgcttgtgctgc
                                                                          

A0A182YU00_BAK1-01      tgctgtcattggcatcatcttcagtcacagactatga
A0A182YU00_BAK1-02      tgctgtcattggcatcatcttcagtcacagactatga
A0A182YU00_BAK1-03      tgctgtcattggcatcatcttcagtcacagactatga
A0A182YU00_BAK1-04      tgctgtcattggcatcatcttcagtcacagactatga
A0A182YU00_BAK1-05      tgctgtcattggcatcatcttcagtcacagactatga
A0A182YU00_BAK1-06      tgctgtcattggcatcatcttcagtcacagactatga
A0A2C9L934_BAX-04       -------------------------------------
A0A2C9L934_BAX-03       -------------------------------------
A0A2C9L934_BAX-01       -------------------------------------
A0A2C9L934_BAX-02       cgttctcctctatcgcaaatatttctcttaa------
                                                             

© 1998-2023Legal notice