Dataset for CDS BAK1 of Organism Castor canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A250YC64_BAK1-01      atggcatctggacaaggcccaggtcctcccaaggagggattggaagagcc
A0A250YC64_BAK1-02      atggcatctggacaaggcccaggtcctcccaaggagggattggaagagcc
A0A250YC64_BAK1-03      atggcatctggacaaggcccaggtcctcccaaggagggattggaagagcc

A0A250YC64_BAK1-01      ttcctcagactccacttctgagcagcaggtagtccaggacacggaggagg
A0A250YC64_BAK1-02      ttcctcagactccacttctgagcagcaggtagtccaggacacggaggagg
A0A250YC64_BAK1-03      ttcctcagactccacttctgagcagcaggtagtccaggacacggaggagg

A0A250YC64_BAK1-01      ttttccgcagctacgttttttaccgccaccagcaggaacaggaggctcag
A0A250YC64_BAK1-02      ttttccgcagctacgttttttaccgccaccagcaggaacaggaggctcag
A0A250YC64_BAK1-03      ttttccgcagctacgttttttaccgccaccagcaggaacaggaggctcag

A0A250YC64_BAK1-01      ggggcagctgctcctgctgacccagagttggtgtccttgccacaagaacc
A0A250YC64_BAK1-02      ggggcagctgctcctgctgacccagagttggtgtccttgccacaagaacc
A0A250YC64_BAK1-03      ggggcagctgctcctgctgacccagagttggtgtccttgccacaagaacc

A0A250YC64_BAK1-01      taacagcaccatggggcaggtgggccggcggcttgccatcattggggatg
A0A250YC64_BAK1-02      taacagcaccatggggcaggtgggccggcggcttgccatcattggggatg
A0A250YC64_BAK1-03      taacagcaccatggggcaggtgggccggcggcttgccatcattggggatg

A0A250YC64_BAK1-01      atattaaccggcgctatgacaccgagttccagaccatgctgcagcagcta
A0A250YC64_BAK1-02      atattaaccggcgctatgacaccgagttccagaccatgctgcagcagcta
A0A250YC64_BAK1-03      atattaaccggcgctatgacaccgagttccagaccatgctgcagcagcta

A0A250YC64_BAK1-01      cggcccacagctgagaatgcctctgagctcttcaccaagattgcctccag
A0A250YC64_BAK1-02      cggcccacagctgagaatgcctctgagctcttcaccaagattgcctc---
A0A250YC64_BAK1-03      cggcccacagctgagaatgcctctgagctcttcaccaagattgcctccag

A0A250YC64_BAK1-01      gtgcacagcc-------tggcctctctgtccactgtcccgtcaccaccca
A0A250YC64_BAK1-02      -----------------cagtctgtttg---acagt---ggcatcagctg
A0A250YC64_BAK1-03      gccagcagcaacgcccacagtctgtttg---acagt---ggcatcagctg
                                           * ** * **   ** **   * ** ** *  

A0A250YC64_BAK1-01      tg--catgcaatgggctccctggagtgggcacacttctctggcagtgtc-
A0A250YC64_BAK1-02      gggccgtgtggt-ggctctcttgagctttggctatcgcctggctgtgcat
A0A250YC64_BAK1-03      gggccgtgtggt-ggctctcttga--------------------------
                         *  * **   * ***** ** **                          

A0A250YC64_BAK1-01      --------------------------------------------------
A0A250YC64_BAK1-02      gtctaccagcgtggcctgactggcttcttgggtcaggtgacctattttgt
A0A250YC64_BAK1-03      --------------------------------------------------

A0A250YC64_BAK1-01      ------------------------------------------------ag
A0A250YC64_BAK1-02      gattgacgtcatgctgcggcactacattacccggtggatcgcacagagag
A0A250YC64_BAK1-03      --------------------------------------------------

A0A250YC64_BAK1-01      ggggcagtgtgttaactcacatgtggtctctgagtcctctactg------
A0A250YC64_BAK1-02      gaggttgggtggcagccctggaattgggcaacggccccatccggaatgtg
A0A250YC64_BAK1-03      --------------------------------------------------

A0A250YC64_BAK1-01      ------------------------------------------------tg
A0A250YC64_BAK1-02      gtgatagttctggctgtggttctgttgggccagtttgtggtacgaagatt
A0A250YC64_BAK1-03      --------------------------------------------------

A0A250YC64_BAK1-01      cataaactcatga
A0A250YC64_BAK1-02      cttcaagtcatga
A0A250YC64_BAK1-03      -------------

© 1998-2020Legal notice