Dataset for CDS BAX of Organism Castor canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A250YBQ3_BAX-01      atggatgggtccggggagcagcccagaggaggcgggcccaccagctctga
A0A250YBQ3_BAX-02      --------------------------------------------------
                                                                         

A0A250YBQ3_BAX-01      gcagatcatgaagacgggggcccttttgcttcagggtttcatccaggatc
A0A250YBQ3_BAX-02      -------atgaagacgggggcccttttgcttcagggtttcatccaggatc
                              *******************************************

A0A250YBQ3_BAX-01      gagcagggcggatggggggggagacaccggagctgaccttggagcagatg
A0A250YBQ3_BAX-02      gagcagggcggatggggggggagacaccggagctgaccttggagcagatg
                       **************************************************

A0A250YBQ3_BAX-01      caccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
A0A250YBQ3_BAX-02      caccaggatgcgtccaccaagaagctgagcgagtgtctcaagcgcatcgg
                       **************************************************

A0A250YBQ3_BAX-01      ggacgaactggacagtaatatggagctgcagaggatgattgcagatgtgg
A0A250YBQ3_BAX-02      ggacgaactggacagtaatatggagctgcagaggatgattgcagatgtgg
                       **************************************************

A0A250YBQ3_BAX-01      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
A0A250YBQ3_BAX-02      acacagactccccccgagaggtctttttccgagtggcagctgacatgttt
                       **************************************************

A0A250YBQ3_BAX-01      gccgacggcaacttcaattggggccgggttgtcgcccttttctactttgc
A0A250YBQ3_BAX-02      gccgacggcaacttcaattggggccgggttgtcgcccttttctactttgc
                       **************************************************

A0A250YBQ3_BAX-01      cagcaaactggtgctcaaggccctgtgcaccaaggtaccggagctgatca
A0A250YBQ3_BAX-02      cagcaaactggtgctcaaggccctgtgcaccaaggtaccggagctgatca
                       **************************************************

A0A250YBQ3_BAX-01      gaaccatcatgggctggacgctggaattcctccgagaacggctgctaggc
A0A250YBQ3_BAX-02      gaaccatcatgggctggacgctggaattcctccgagaacggctgctaggc
                       **************************************************

A0A250YBQ3_BAX-01      tggatccaagaccagggtggttgggacggcctcctttcctactttgggac
A0A250YBQ3_BAX-02      tggatccaagaccagggtggttgggacggcctcctttcctactttgggac
                       **************************************************

A0A250YBQ3_BAX-01      ccccacgtggcagacagtgaccatctttgtggctggagtgctcactgcct
A0A250YBQ3_BAX-02      ccccacgtggcagacagtgaccatctttgtggctggagtgctcactgcct
                       **************************************************

A0A250YBQ3_BAX-01      cgctcaccatttggaagaagatgggctga
A0A250YBQ3_BAX-02      cgctcaccatttggaagaagatgggctga
                       *****************************

© 1998-2020Legal notice