Dataset for CDS BCL2L1 of organism Sphaeramia orbicularis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A672Z262_BCL2L1-      atgtcgcacagtaacagggagctggtggagttcttcatatgctacaagct
A0A673BZP5_BCL2L1-      atgtctcaa---aacagagaactggtggttttctacataaactataaact
                        ***** **    ***** ** *******  **** ****  *** ** **

A0A672Z262_BCL2L1-      gtcgcagaaaaatta-cccgtcctctctgctgaggccagatgatgc----
A0A673BZP5_BCL2L1-      ctcccagagaaactatcccatcaaccacattggactcatagaacccccca
                         ** **** *** ** *** **  *     **    ** *  *  *    

A0A672Z262_BCL2L1-      -caggactgaaggagacaaggccaacaccactgtctctaatggcttattg
A0A673BZP5_BCL2L1-      gcaggactgatggtggagaggc-----------------ggggttgggtg
                         ********* ** *   ****                   ** *   **

A0A672Z262_BCL2L1-      gcgaacagtagg--------------aacggaggt-------ggacaggc
A0A673BZP5_BCL2L1-      aggaacagcgggtaagtacgcatgccaacgggacttttaatggcacaagt
                          ******  **              *****   *       * *** * 

A0A672Z262_BCL2L1-      agtggtgtcgctgc----cccccagtggtg--------------------
A0A673BZP5_BCL2L1-      cctgggacccctccagcatctcctgtgcggcagcgtttaccgtcaacgac
                          ***   * ** *     * ** ***  *                    

A0A672Z262_BCL2L1-      --acgtagacgcagtaaaggcagcgcttcaggactctgctgatgagtttg
A0A673BZP5_BCL2L1-      aaacctggactcggtgaaagaggccctccgggactcggccaatgagtttg
                          ** * *** * ** ** *  ** ** * ****** **  *********

A0A672Z262_BCL2L1-      agctgctctacacgcaggcatttagtgggctgtcctcccagctcgacatc
A0A673BZP5_BCL2L1-      agctgcggtacgcccgcgccttcagcgatctgcacaaccagctgcacatc
                        ******  *** * *  ** ** ** *  ***  *  ******  *****

A0A672Z262_BCL2L1-      actcctgacactgcctaccaaagctttaaaagtgtcatggatgaggtgtt
A0A673BZP5_BCL2L1-      acaccagccactgcataccaaagctttgaaaatgtgatggatgaggtgtt
                        ** ** * ****** ************ *** *** **************

A0A672Z262_BCL2L1-      caaggacggggtcaactgggggcgtatcgtgggcctgttcgcattcggag
A0A673BZP5_BCL2L1-      tcgggacggtgtcaactggggccgcatcgtagggctttttgcattcggcg
                           ****** *********** ** ***** ** ** ** ******** *

A0A672Z262_BCL2L1-      gagtcctttgtgtggaatgtgctgagaaggacatgagtgagctggttcct
A0A673BZP5_BCL2L1-      gggcgctctgtgtcgagtgtgtggagaaggagatgagtccactggtgggc
                        * *  ** ***** ** ****  ******** ******   *****    

A0A672Z262_BCL2L1-      cggatcgccgactggatgaccacgtacctggatgagcacatcagcccatg
A0A673BZP5_BCL2L1-      aggatcgtagagtggatgacggtgtacctggataaccacattcagggctg
                         ******  ** ********   ********** * *****       **

A0A672Z262_BCL2L1-      gattgagagcgcaggaggctgggacagcttcggtgagatttttggacaaa
A0A673BZP5_BCL2L1-      gatccagagccaaggaggatgggagcgctttgccgaaatctttggccagg
                        ***  *****  ****** *****  **** *  ** ** ***** **  

A0A672Z262_BCL2L1-      gcgcagctgccgaagcacggaggtctggggagacgctgaagcgatggctg
A0A673BZP5_BCL2L1-      atgcagcggcagagggcaggaggtctcaggagagtttcaagaagtggctg
                          ***** ** ** *   ********  *****   * ***   ******

A0A672Z262_BCL2L1-      ctggtcggagtggtgttgttaactggagtgctgatcggtgtgctcgttgc
A0A673BZP5_BCL2L1-      ctggcggggatgacccttgtgaccggggtcgtggtggggtcactcattgc
                        ****  **  **    *  * ** ** **  ** * **    *** ****

A0A672Z262_BCL2L1-      taaaaaaca---gtaa
A0A673BZP5_BCL2L1-      ccagaaacgcctgtga
                          * ****    ** *

© 1998-2021Legal notice