Dataset for CDS BAX-like of Organism Junco hyemalis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5IA19_BAX-01      ccctgggggaaaggtg---------ggacacagggacagaga-gctgggg
A0A8C5JSE8_BOK-01      --atggaggtgctgcgtcgttcctcggtctttgctgcagaggtgatggag
                          *** **    * *         ** *   *   *****  * *** *

A0A8C5IA19_BAX-01      tcacccagagcaccggggaggtcacccagagcaccagggg---gggtcac
A0A8C5JSE8_BOK-01      ---------gtttttgacaggtctcccactg-acaaggagcttgtgtccc
                                *     *  ***** ****  * ** *** *   * *** *

A0A8C5IA19_BAX-01      ---ccaggacc-----cagggggtcccacaacaccgggggggctccccag
A0A8C5JSE8_BOK-01      aagccaaggctctgtgcagagactacatcaactccaggctgatcc-----
                          *** * *      *** *  * *  **** ** **  *   *     

A0A8C5IA19_BAX-01      agccgggggtcacccagagcaa---cgggcgggtcacccagagcaccggg
A0A8C5JSE8_BOK-01      aggcaggtgtgagctggagcaaacccgagcacaacgcgccggtgcccggg
                       ** * ** ** * *  ******   ** **    * * * *    *****

A0A8C5IA19_BAX-01      ggctcccaggagctgggggggctccccagacctgggggtcacccagagca
A0A8C5JSE8_BOK-01      gg------gaagctggccgaggtctcca--------------ccatactg
                       **      * ******  * * ** ***              *** *   

A0A8C5IA19_BAX-01      ccggggctcgcaggttcgtgcgggaccgcgtgcagcgctgtggggacccc
A0A8C5JSE8_BOK-01      ctgcggcttggggat--gagctggagtacatccgtcccaacgtgta---c
                       * * **** *  * *  * ** ***   * * *  * *   * * *   *

A0A8C5IA19_BAX-01      caggccgtggcgctgagcgaggccgagctgggc---------cagcccca
A0A8C5JSE8_BOK-01      cggaacgtggcgc-------ggc--agctgaacatctcgctgcactccga
                       * *  ********       ***  *****  *         **  ** *

A0A8C5IA19_BAX-01      gcccagcagccccgacaccaaacgcctcagcgagtgcctgcgccgcatcg
A0A8C5JSE8_BOK-01      gtccgtggtgtccgacgcc---------------ttcctg-gccgtggcc
                       * **       ***** **               * **** ****   * 

A0A8C5IA19_BAX-01      gcgacgagctggacagca-acatggagctgcagaggatgatcgagcaggt
A0A8C5JSE8_BOK-01      acgcagatcttcactgcaggtatggtgcc-cacacacacacagagcagca
                        **  ** **  ** ***   **** **  ** *     *  ******  

A0A8C5IA19_BAX-01      gggctgtgacgcccccaagaagcttttcttccgcgtggcccgggagat--
A0A8C5JSE8_BOK-01      ggg--atggagcc-------agctcctgt------------gggaaatgg
                       ***   **  ***       ****  * *            **** **  

A0A8C5IA19_BAX-01      gttcgctgacggcaccttcaactggggccgcgtggtcgccctcttctact
A0A8C5JSE8_BOK-01      gtttgtggagagttc------------tcacatagtatacctgccctgag
                       *** *  **  *  *             * * * **   ***   **   

A0A8C5IA19_BAX-01      ttgcctgcaagctggtgctcaaggctctgtgcaccaaggtcccggagctg
A0A8C5JSE8_BOK-01      cagcctggcagacatcacaaagtgtgtggtgaacactgaccccag-----
                         *****  **      *  *  *    *** **   *  *** *     

A0A8C5IA19_BAX-01      gtgcagaccatcctgcgctggaccatggagtacctgcaggagcacgtgct
A0A8C5JSE8_BOK-01      -----------ccttcgct-------------cccactggctcgtg-gct
                                  *** ****             **  * **  *  * ***

A0A8C5IA19_BAX-01      ggcctggatccaggcccagggcggatgggtgagaccccagacccccattc
A0A8C5JSE8_BOK-01      gctctt--tgcagttt---------tgggcacttcctcaaggccatcttc
                       *  **   * ***            ****     ** **   **   ***

A0A8C5IA19_BAX-01      ctcg----gggggctgacccctaa
A0A8C5JSE8_BOK-01      ttcgtcctgctgcctgagagatga
                        ***    *  * ****    * *

© 1998-2023Legal notice