Dataset for CDS BAX-like of Organism Junco hyemalis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C5IA19_BAX-01 BCL2-associated X gene OS=[Eukaryota] Junco hyemalis GN=BAX (length=684 residues).
ccctgggggaaaggtgggacacagggacagagagctggggtcacccagagcaccggggaggtcacccagagcaccagggg
gggtcacccaggacccagggggtcccacaacaccgggggggctccccagagccgggggtcacccagagcaacgggcgggt
cacccagagcaccgggggctcccaggagctgggggggctccccagacctgggggtcacccagagcaccggggctcgcagg
ttcgtgcgggaccgcgtgcagcgctgtggggacccccaggccgtggcgctgagcgaggccgagctgggccagccccagcc
cagcagccccgacaccaaacgcctcagcgagtgcctgcgccgcatcggcgacgagctggacagcaacatggagctgcaga
ggatgatcgagcaggtgggctgtgacgcccccaagaagcttttcttccgcgtggcccgggagatgttcgctgacggcacc
ttcaactggggccgcgtggtcgccctcttctactttgcctgcaagctggtgctcaaggctctgtgcaccaaggtcccgga
gctggtgcagaccatcctgcgctggaccatggagtacctgcaggagcacgtgctggcctggatccaggcccagggcggat
gggtgagaccccagacccccattcctcggggggctgacccctaa
>gnl|bcl2dbcds|A0A8C5JSE8_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Junco hyemalis GN=BOK (length=582 residues).
atggaggtgctgcgtcgttcctcggtctttgctgcagaggtgatggaggtttttgacaggtctcccactgacaaggagct
tgtgtcccaagccaaggctctgtgcagagactacatcaactccaggctgatccaggcaggtgtgagctggagcaaacccg
agcacaacgcgccggtgcccggggggaagctggccgaggtctccaccatactgctgcggcttggggatgagctggagtac
atccgtcccaacgtgtaccggaacgtggcgcggcagctgaacatctcgctgcactccgagtccgtggtgtccgacgcctt
cctggccgtggccacgcagatcttcactgcaggtatggtgcccacacacacacagagcagcagggatggagccagctcct
gtgggaaatgggtttgtggagagttctcacatagtatacctgccctgagcagcctggcagacatcacaaagtgtgtggtg
aacactgaccccagccttcgctcccactggctcgtggctgctctttgcagttttgggcacttcctcaaggccatcttctt
cgtcctgctgcctgagagatga
© 1998-2023Legal notice