Dataset for CDS BCL2A1 of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


F7CP56_BCL2A1-03      --------------------------------------------------
F7CP56_BCL2A1-02      --------------------------------------------------
F7CP56_BCL2A1-01      atgaccgactgtgagtttggatatattcacatgctggcccaggactacct
F7CP56_BCL2A1-04      atgaccgactgtgagtttggatatattcacatgctggcccaggactacct
                                                                        

F7CP56_BCL2A1-03      --------------------------------------------------
F7CP56_BCL2A1-02      --------------------------------------------------
F7CP56_BCL2A1-01      gaagtacgtcctgcagataccacaacctggatctggtccaagcaaaacat
F7CP56_BCL2A1-04      gaagtacgtcctgcagataccacaacctggatctggtccaagcaaaacat
                                                                        

F7CP56_BCL2A1-03      --------------------------------------------------
F7CP56_BCL2A1-02      --------------------------------------------------
F7CP56_BCL2A1-01      ccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaag
F7CP56_BCL2A1-04      ccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaag
                                                                        

F7CP56_BCL2A1-03      --------------------------------------------------
F7CP56_BCL2A1-02      --------------------------------------------------
F7CP56_BCL2A1-01      aatttgaaaccatgcttggacaattttcatgttgtgtccatagatgctgc
F7CP56_BCL2A1-04      aatttgaaaccatgcttggacaattttcatgttgtgtccatagatgctgc
                                                                        

F7CP56_BCL2A1-03      --------------------------------------------------
F7CP56_BCL2A1-02      ----------------------atggaaaagcaatttgaagatggcatca
F7CP56_BCL2A1-01      cagaacaatattcaatcaagtgatggaaaagcaatttgaagatggcatca
F7CP56_BCL2A1-04      cagaacaatattcaatcaagtgatggaaaagcaatttgaagatggcatca
                                                                        

F7CP56_BCL2A1-03      -----------------atgacc------------gactgtattctcatc
F7CP56_BCL2A1-02      ttaactggggaagaattatgaccatatttgcatttgaaggtattctcatc
F7CP56_BCL2A1-01      ttaactggggaagaattatgaccatatttgcatttgaaggtattctcatc
F7CP56_BCL2A1-04      ttaactggggaagaattatgaccatatttgcatttgaaggtattctcatc
                                       ******            **  ***********

F7CP56_BCL2A1-03      aagaaacttctaccagagcgaattgccccagatgtggatacttacaagga
F7CP56_BCL2A1-02      aagaaacttctaccagagcgaattgccccagatgtggatacttacaagga
F7CP56_BCL2A1-01      aagaaacttctaccagagcgaattgccccagatgtggatacttacaagga
F7CP56_BCL2A1-04      aagaaacttctaccagagcgaattgccccagatgtggatacttacaagga
                      **************************************************

F7CP56_BCL2A1-03      gatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
F7CP56_BCL2A1-02      gatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
F7CP56_BCL2A1-01      gatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
F7CP56_BCL2A1-04      gatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
                      **************************************************

F7CP56_BCL2A1-03      taaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatcc
F7CP56_BCL2A1-02      taaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatcc
F7CP56_BCL2A1-01      taaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatcc
F7CP56_BCL2A1-04      taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaaccc
                      *********************  * ** *       ** *     ** **

F7CP56_BCL2A1-03      aaaaggatttccatctttctgagcatgcaagatgaaattgagacagaaga
F7CP56_BCL2A1-02      aaaaggatttccatctttctgagcatgcaagatgaaattgagacagaaga
F7CP56_BCL2A1-01      aaaaggatttccatctttctgagcatgcaagatgaaattgagacagaaga
F7CP56_BCL2A1-04      aaa------tctggctggctgacttttctggaagttactggaa-------
                      ***      **   **  ****   * *  ** *  * **  *       

F7CP56_BCL2A1-03      gatcatcagggacattttccaacaaggcaaaacctgctttatcccacggt
F7CP56_BCL2A1-02      gatcatcagggacattttccaacaaggcaaaacctgctttatcccacggt
F7CP56_BCL2A1-01      gatcatcagggacattttccaacaaggcaaaacctgctttatcccacggt
F7CP56_BCL2A1-04      --------------------------------------------------
                                                                        

F7CP56_BCL2A1-03      accagttcaatagcaatcacatggatatggtgaaattagcatcacctgag
F7CP56_BCL2A1-02      accagttcaatagcaatcacatggatatggtgaaattagcatcacctgag
F7CP56_BCL2A1-01      accagttcaatagcaatcacatggatatggtgaaattagcatcacctgag
F7CP56_BCL2A1-04      ----------------------agatgt-gtgaaat--acttttcctgaa
                                             *** * *******   * *  ***** 

F7CP56_BCL2A1-03      gaaattttgtcacttcccaaaacatcctggaatattcatcagcctggtga
F7CP56_BCL2A1-02      gaaattttgtcacttcccaaaacatcctggaatattcatcagcctggtga
F7CP56_BCL2A1-01      gaaattttgtcacttcccaaaacatcctggaatattcatcagcctggtga
F7CP56_BCL2A1-04      gcaatactac----------------------------------------
                      * ***  *                                          

F7CP56_BCL2A1-03      ggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcc
F7CP56_BCL2A1-02      ggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcc
F7CP56_BCL2A1-01      ggaggaggttcgggaggaggccttgtcaacagcag---------------
F7CP56_BCL2A1-04      --------------------------------------------------
                                                                        

F7CP56_BCL2A1-03      tcatgccaggtcttgggtttgataagcatggcaaccggttggggaggggc
F7CP56_BCL2A1-02      tcatgccaggtcttgggtttgataagcatggcaaccggttggggaggggc
F7CP56_BCL2A1-01      --------------------------------------------------
F7CP56_BCL2A1-04      --------------------------------------------------
                                                                        

F7CP56_BCL2A1-03      aagggctactatgacacctacctgaagcgctgtctgcagcaccaggaagt
F7CP56_BCL2A1-02      aagggctactatgacacctacctgaagcgctgtctgcagcaccaggaagt
F7CP56_BCL2A1-01      -----------------------------------------cctggagat
F7CP56_BCL2A1-04      -------------------------------------------------t
                                                                       *

F7CP56_BCL2A1-03      gaagccctacaccctggccttggctttcaaagaacaaatttgtgtccagg
F7CP56_BCL2A1-02      gaagccctacaccctggccttggctttcaaagaacaaatttgtgtccagg
F7CP56_BCL2A1-01      ga------------------------------------------------
F7CP56_BCL2A1-04      ga------------------------------------------------
                      **                                                

F7CP56_BCL2A1-03      tcccagtggacgaaaatgacatgaaggtggatgaagtcctttatgaagac
F7CP56_BCL2A1-02      tcccagtggacgaaaatgacatgaaggtggatgaagtcctttatgaagac
F7CP56_BCL2A1-01      --------------------------------------------------
F7CP56_BCL2A1-04      --------------------------------------------------
                                                                        

F7CP56_BCL2A1-03      tcttcagcatcttaa
F7CP56_BCL2A1-02      tcttcagcatcttaa
F7CP56_BCL2A1-01      ---------------
F7CP56_BCL2A1-04      ---------------
                                     

© 1998-2020Legal notice