Dataset for CDS BCL2A1 of organism Equus caballus

[Download (right click)] [Edit] [Sequences] [Repertoires]

5 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A5F5PK00_BCL2A1-      atgaccgactgtgagtttggatatattcacatgctggcccaggactacct
A0A5F5PK00_BCL2A1-      atgaccgactgtgagtttggatatattcacatgctggcccaggactacct
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      gaagtacgtcctgcagataccacaacctggatctggtccaagcaaaacat
A0A5F5PK00_BCL2A1-      gaagtacgtcctgcagataccacaacctggatctggtccaagcaaaacat
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      ccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaag
A0A5F5PK00_BCL2A1-      ccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaag
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      aatttgaaaccatgcttggacaattttcatgttgtgtccatagatgctgc
A0A5F5PK00_BCL2A1-      aatttgaaaccatgcttggacaattttcatgttgtgtccatagatgctgc
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      cagaacaatattcaatcaagtgatggaaaagcaatttgaagatggcatca
A0A5F5PK00_BCL2A1-      cagaacaatattcaatcaagtgatggaaaagcaatttgaagatggcatca
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      ----------------------atggaaaagcaatttgaagatggcatca
A0A5F5PK00_BCL2A1-      --------------------------------------------------
                                                                          

A0A5F5PK00_BCL2A1-      ttaactggggaagaattatgaccatatttgcatttgaaggtattctcatc
A0A5F5PK00_BCL2A1-      ttaactggggaagaattatgaccatatttgcatttgaaggtattctcatc
A0A5F5PK00_BCL2A1-      -----------------atggcggcggcagctgtgagtggtgct------
A0A5F5PK00_BCL2A1-      ttaactggggaagaattatgaccatatttgcatttgaaggtattctcatc
A0A5F5PK00_BCL2A1-      -----------------atgacc------------gactgtattctcatc
                                         *** *                 **  *      

A0A5F5PK00_BCL2A1-      aagaaacttctaccagagcgaattgccccagatgtggatacttacaagga
A0A5F5PK00_BCL2A1-      aagaaacttctaccagagcgaattgccccagatgtggatacttacaagga
A0A5F5PK00_BCL2A1-      aagcggcgcctg-cgggccgagctg--------------------aagca
A0A5F5PK00_BCL2A1-      aagaaacttctaccagagcgaattgccccagatgtggatacttacaagga
A0A5F5PK00_BCL2A1-      aagaaacttctaccagagcgaattgccccagatgtggatacttacaagga
                        ***   *  **  * *  ***  **                    *** *

A0A5F5PK00_BCL2A1-      gatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
A0A5F5PK00_BCL2A1-      gatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
A0A5F5PK00_BCL2A1-      gcgt-------------ctgcg-----ggcgatgagcgccgaggaacggc
A0A5F5PK00_BCL2A1-      gatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
A0A5F5PK00_BCL2A1-      gatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
                        *  *             *** *       ***  * * * *  *** ** 

A0A5F5PK00_BCL2A1-      taaggcaaaatggaggct---------gggtgattgcccacagtcagtat
A0A5F5PK00_BCL2A1-      taaggcaaaatggaggct---------gggaaaatggctttgtaaagaag
A0A5F5PK00_BCL2A1-      tacgccagtctcgcctcttgactcagaaggtgattgcccacagtcagtat
A0A5F5PK00_BCL2A1-      taaggcaaaatggaggct---------gggtgattgcccacagtcagtat
A0A5F5PK00_BCL2A1-      taaggcaaaatggaggct---------gggtgattgcccacagtcagtat
                        ** * **   * *   **          **  * ** *       ** * 

A0A5F5PK00_BCL2A1-      caaaaatccaaaaggatttccatctttctgagcatgcaagatgaaattga
A0A5F5PK00_BCL2A1-      tttgaacccaaa------tctggctggctgacttttctggaagttactgg
A0A5F5PK00_BCL2A1-      caaaaatccaaaaggatttccatctttctgagcatgcaagatgaaattga
A0A5F5PK00_BCL2A1-      caaaaatccaaaaggatttccatctttctgagcatgcaagatgaaattga
A0A5F5PK00_BCL2A1-      caaaaatccaaaaggatttccatctttctgagcatgcaagatgaaattga
                            ** *****      **   **  ****   * *  ** *  * ** 

A0A5F5PK00_BCL2A1-      gacagaagagatcatcagggacattttccaacaaggcaaaacctgcttta
A0A5F5PK00_BCL2A1-      aa------------------------------------------------
A0A5F5PK00_BCL2A1-      gacagaagagatcatcagggacattttccaacaaggcaaaacctgcttta
A0A5F5PK00_BCL2A1-      gacagaagagatcatcagggacattttccaacaaggcaaaacctgcttta
A0A5F5PK00_BCL2A1-      gacagaagagatcatcagggacattttccaacaaggcaaaacctgcttta
                         *                                                

A0A5F5PK00_BCL2A1-      tcccacggtaccagttcaatagcaatcacatggatatggtgaaattagca
A0A5F5PK00_BCL2A1-      -------------------------------agatgt-gtgaaat--act
A0A5F5PK00_BCL2A1-      tcccacggtaccagttcaatagcaatcacatggatatggtgaaattagca
A0A5F5PK00_BCL2A1-      tcccacggtaccagttcaatagcaatcacatggatatggtgaaattagca
A0A5F5PK00_BCL2A1-      tcccacggtaccagttcaatagcaatcacatggatatggtgaaattagca
                                                        *** * *******   * 

A0A5F5PK00_BCL2A1-      tcacctgaggaaattttgtcacttcccaaaacatcctggaatattcatca
A0A5F5PK00_BCL2A1-      tttcctgaagcaatactac-------------------------------
A0A5F5PK00_BCL2A1-      tcacctgaggaaattttgtcacttcccaaaacatcctggaatattcatca
A0A5F5PK00_BCL2A1-      tcacctgaggaaattttgtcacttcccaaaacatcctggaatattcatca
A0A5F5PK00_BCL2A1-      tcacctgaggaaattttgtcacttcccaaaacatcctggaatattcatca
                        *  ***** * ***  *                                 

A0A5F5PK00_BCL2A1-      gcctggtgaggaggaggttcgggaggaggccttgtcaacagcag------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttg
A0A5F5PK00_BCL2A1-      gcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttg
A0A5F5PK00_BCL2A1-      gcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttg
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      atctcatcctcatgccaggtcttgggtttgataagcatggcaaccggttg
A0A5F5PK00_BCL2A1-      atctcatcctcatgccaggtcttgggtttgataagcatggcaaccggttg
A0A5F5PK00_BCL2A1-      atctcatcctcatgccaggtcttgggtttgataagcatggcaaccggttg
                                                                          

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gggaggggcaagggctactatgacacctacctgaagcgctgtctgcagca
A0A5F5PK00_BCL2A1-      gggaggggcaagggctactatgacacctacctgaagcgctgtctgcagca
A0A5F5PK00_BCL2A1-      gggaggggcaagggctactatgacacctacctgaagcgctgtctgcagca
                                                                          

A0A5F5PK00_BCL2A1-      cctggagatga---------------------------------------
A0A5F5PK00_BCL2A1-      --------tga---------------------------------------
A0A5F5PK00_BCL2A1-      ccaggaagtgaagccctacaccctggccttggctttcaaagaacaaattt
A0A5F5PK00_BCL2A1-      ccaggaagtgaagccctacaccctggccttggctttcaaagaacaaattt
A0A5F5PK00_BCL2A1-      ccaggaagtgaagccctacaccctggccttggctttcaaagaacaaattt
                                ***                                       

A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      --------------------------------------------------
A0A5F5PK00_BCL2A1-      gtgtccaggtcccagtggacgaaaatgacatgaaggtggatgaagtcctt
A0A5F5PK00_BCL2A1-      gtgtccaggtcccagtggacgaaaatgacatgaaggtggatgaagtcctt
A0A5F5PK00_BCL2A1-      gtgtccaggtcccagtggacgaaaatgacatgaaggtggatgaagtcctt
                                                                          

A0A5F5PK00_BCL2A1-      ------------------------
A0A5F5PK00_BCL2A1-      ------------------------
A0A5F5PK00_BCL2A1-      tatgaagactcttcagcatcttaa
A0A5F5PK00_BCL2A1-      tatgaagactcttcagcatcttaa
A0A5F5PK00_BCL2A1-      tatgaagactcttcagcatcttaa
                                                

© 1998-2021Legal notice