Dataset for CDS BCL2A1 of organism Equus caballus

[Download (right click)] [Alignment] [Repertoires]

5 sequence(s)

>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=696 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatccaaaaggatttccatctttctgagcatgcaa
gatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttatcccacggtaccagttcaa
tagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaacatcctggaatattcatc
agcctggtgaggaggaggttcgggaggaggccttgtcaacagcagcctggagatga
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=693 residues).
atggaaaagcaatttgaagatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaa
gaaacttctaccagagcgaattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacga
aaaacacaggagaatggataaggcaaaatggaggctgggtgattgcccacagtcagtatcaaaaatccaaaaggatttcc
atctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttat
cccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaa
catcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcctc
atgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctactatgacacctacctgaagcgctg
tctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagtggacg
aaaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-03 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=636 residues).
atgaccgactgtattctcatcaagaaacttctaccagagcgaattgccccagatgtggatacttacaaggagatttctta
ctttgttgctgagttcataacgaaaaacacaggagaatggataaggcaaaatggaggctgggtgattgcccacagtcagt
atcaaaaatccaaaaggatttccatctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttc
caacaaggcaaaacctgctttatcccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctga
ggaaattttgtcacttcccaaaacatcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaa
cagggggacttgatctcatcctcatgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctac
tatgacacctacctgaagcgctgtctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaat
ttgtgtccaggtcccagtggacgaaaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-04 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=525 residues).
atgaccgactgtgagtttggatatattcacatgctggcccaggactacctgaagtacgtcctgcagataccacaacctgg
atctggtccaagcaaaacatccagagtgttacaagacattgctttctcagttcaaaatgaagtagagaagaatttgaaac
catgcttggacaattttcatgttgtgtccatagatgctgccagaacaatattcaatcaagtgatggaaaagcaatttgaa
gatggcatcattaactggggaagaattatgaccatatttgcatttgaaggtattctcatcaagaaacttctaccagagcg
aattgccccagatgtggatacttacaaggagatttcttactttgttgctgagttcataacgaaaaacacaggagaatgga
taaggcaaaatggaggctgggaaaatggctttgtaaagaagtttgaacccaaatctggctggctgacttttctggaagtt
actggaaagatgtgtgaaatacttttcctgaagcaatactactga
>gnl|bcl2dbcds|A0A5F5PK00_BCL2A1-05 BCL2-related protein A1 gene OS=[Eukaryota] Equus caballus GN=BCL2A1 (length=612 residues).
atggcggcggcagctgtgagtggtgctaagcggcgcctgcgggccgagctgaagcagcgtctgcgggcgatgagcgccga
ggaacggctacgccagtctcgcctcttgactcagaaggtgattgcccacagtcagtatcaaaaatccaaaaggatttcca
tctttctgagcatgcaagatgaaattgagacagaagagatcatcagggacattttccaacaaggcaaaacctgctttatc
ccacggtaccagttcaatagcaatcacatggatatggtgaaattagcatcacctgaggaaattttgtcacttcccaaaac
atcctggaatattcatcagcctggtgaggaggaggttcgggaggaggccttgtcaacagggggacttgatctcatcctca
tgccaggtcttgggtttgataagcatggcaaccggttggggaggggcaagggctactatgacacctacctgaagcgctgt
ctgcagcaccaggaagtgaagccctacaccctggccttggctttcaaagaacaaatttgtgtccaggtcccagtggacga
aaatgacatgaaggtggatgaagtcctttatgaagactcttcagcatcttaa
© 1998-2022Legal notice