Dataset for CDS BCL2L1 of organism all

[Download (right click)] [Alignment] [Repertoires]

383 sequence(s)

>gnl|bcl2dbcds|A0A3Q1EVP6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=627 residues).
atgtcgtgcagtaacagagagctggtggagttctttataagctacaagctgtctcaaaggaactatccgatgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccagctcagcctccagtaacggcttgctggtgaacaaca
gagacggcatagaggctgtaaaatccacccttaaggatgcggcagatgaatttgaacttctcttcacgcaaactttcagt
gacctgtcttcgcagattgacatcacccctgaaacggcctaccacagctttaagagtgtgatggatgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccctggatccagagccaagga
gactgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacggaggtctcgggatactctgaagcgatg
gctgctagccggaggggtgctgctaatgggagtgctggctggtgtactcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1FR00_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactgtcccagagaaactatcccctcaaccacatggt
gctgaacgaggctcccaacaggactgatgggggggaggcccggctgggagaggaccagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcagtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtcatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgcgtcgagtgcgtggaaaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagggccagggaggatgggagcgttttgctga
gatcttcggtcaggacgcggcggccgagagcaggaggtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtggggtcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1FR00_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Acanthochromis polyacanthus GN=BCL2L1 (length=1107 residues).
atgttccgacggcacgtgaaggcgtcatattacgtaatagggaggcagggccgagcggacgtaggaggatacgtgcgagc
acacacactcgtgaacacaaagtggatgtgtgacattcttgtggagcttgacagctttttgtgcgcaccgagcgacagac
ggactggagacagcgtcacggagcggaggacagcttcccgggaatcccgtgcttttgtttcggttcttgctgggcctgag
ctggtttgtcagccttgtgtaggtttggttttcacccccgagcgtcctgtggatatcagcggaccatggtggtctgagca
gagggcagcaggaaggcagcctggcacagtgtgtgttcactctaacgcagcgagacggaccagagccacgaggacggaaa
acacattggcacgcaacatgtctcagaacagagaactggtggttttctacataaagtataaactgtcccagagaaactat
cccctcaaccacatggtgctgaacgaggctcccaacaggactgatgggggggaggcccggctgggagaggaccagcggac
agagacacacgccaacgggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacgg
cgaccatggacgcagtgaaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgac
ctgcacagccagctgcacatcacgcccgccaccgcctaccagagcttcgagaacgtcatggacgaggtgttccgggacgg
cgtcaactggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgcgtcgagtgcgtggaaaaggagatgagcc
ccctggtgggcaggatcgtagagtggatgaccgtctacctggacaaccacattcaggactggatccagggccagggagga
tgggagcgttttgctgagatcttcggtcaggacgcggcggccgagagcaggaggtctcaggagagcttcaagaagtggct
gctggtggggatgacggtggtgacgggggtggtggtggggtcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8B9N2I0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Accipiter nisus GN=BCL2L1 (length=693 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaatgggagcccctcct
ggcacccgcctgccagccacgtagtgaacggagccgccatgcaccggagcagccttgaagtccatgaaatcgttcaaaca
gctgatgtaaggcaggcgttgagagaggcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagttttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctatgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9FKI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amazona collaria GN=BCL2L1 (length=1302 residues).
atgtgccccgtgcgcccggccctggcggcgcggactcgccggtttgcggccgagcgaggggcttcgggggtggggggggc
tgtgcccggtgcagggggtgcgagggtgaccccgcggttaccgtcacaccgggcccctctcggggctgccgtaacccttg
gcaacgccgcttgcccgcttccgccggccgccgttgggcaacgccggcggaggggggcggggggagccgagctctttaac
gggcggggcgggggcggggctgcctccgcctccgctgcgcttcgggactggcggagcgcggccgggccggtccgcagcca
ccgcagcgccagagccgcctcccgcagcccggcccggcccggcccggcccgcagccgcctgcccgcacccggtgaggccc
gggggctccctggggtccaggtcagatgctcccatcggcggtgcagaagaagagcagggtcgggagctgctgagtgccga
tctgtgcgtgctccggaccatggactcattgagggcgtcccaggtgtgaaaatgtccagcagcaaccgggcgttagtgat
tgactttgtgtcctacaagctctcgcagaagggccacagctggagccagctggaggaggaggatgagagcaggactgact
ttgcagctgaggaggtagagatggacggcgtcctcaatgggagcccctcctggcacccgcccgccagccacgtagtgaac
ggagctgccatgcaccggagcagcctccaggtccacaacacagtccaagcggccgacgtgaggcaggcactgagagaggc
gggggatgagttcgagctgaggtaccggcgggcgttcagcgacctcacgtcccagctccacatcacccccggcaccgcgt
accagagctttgagcaggtggtgaacgaactcttccgcgatggagtgaactgggggcgcatcgtggctttcttctccttc
ggaggagccttgtgtgtggagagcgtcgacaaggagatgcgggtattggtgggacgcattgtgtcttggatgaccaccta
cttgaccgaccacctagatccctggatccaggagaatggcggatgggagcgctttgtggacctctatgggaacgatgctg
ctgccgaggcgctgaggccaaggcagcacttcagccaccagctcccacactggggggccccgggcagcgggggcagaagg
tgccccccccccaggctcctccaggtcacttggaagagaataaacagacttatttttgcatgtgtgagtgcgtgcgtgtg
tgtagatgtgtcactaatataa
>gnl|bcl2dbcds|A0A3Q0RTF8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphilophus citrinellus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtgcttttctacataacgtataaactatcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcagggttggatgaggaacagcgaatagatacacacgccaatg
ggacttttaatggcacaagtcccggtaccccgccagcgtccccgcagcggcagcaacagccgccatcaacaacgaacctc
gacgcagtgaaggaggcgctccgggacacagccaacgagttcgagctgcgatacgctcgtgccttcaacgatctgcacag
ccagctgcacatcacgccggccacggcctaccaaagcttcgagaatgtgatggacgaggtgttccgggatggcgtcaact
ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgtgtcgagaaggagatgagccccctggtg
ggcaggatcgtagagtggatgacagtctacctagacaaccacattcagccctggatccagagccaaggaggatgggagcg
ctttgctgaaatctttgggcaggacgcggcggctgaaagccggaggtctcaggagagcttcaagaagtggctgcttgtgg
gcatgacggtggtgaccggcgtcgtggcaggtgcactcatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A6G7K5D7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion clarkii GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccaactcagcttccagtaacggcttgctggtgaacagca
gaggcggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gacctgtcttcacagcttgacatcacccctgaaacggcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gcgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtctgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1BQA0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagcgacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctggaggaaggactgatggggacaaggccaactcagcttccagtaatggcttgctggtgaacagca
gaggtggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gatctgtcttcacagcttgacatcacccctgaaacggcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagagaagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1DHJ3_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Amphiprion ocellaris GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggctgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8TL99_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgtgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggatgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggccgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8TL99_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=690 residues).
atgtctcagaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcccctcaaccacatggt
gctgaatgaggctcccagcaggactgacgggggggaggcccggctgggagaggaacagcggacagagacacacgccaacg
ggacttttaacggcacgagtcccgggacccccccgccgtccccgcggcggctggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgtgccttcagcgacctgcacagccagctgca
catcacgcccgccaccgcctaccagagcttcgagaacgtgatggatgaggtgttccgggacggcgtcaactggggccgca
tcgtggggctgttcgcgttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagccccctggtgggcaggatc
gtagagtggatgaccgtctacctggacaaccacattcaggactggatccagagccaaggaggatgggagcgttttgctga
aatcttcggtcaggacgcggcggccgagagcaggaagtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgacgggggtggtggtgggatcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P8U812_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Amphiprion percula GN=BCL2L1 (length=627 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcaaaggaactatccgacgtctctgct
gaggccagaggatgctgaaggaaggactgatggggacaaggccaactcagcttccagtaacggcttgctggtgaacagca
gaggtggcatagaggctgtaaaatccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggcttttagt
gatctgtcttcacagcttgacatcacccctgaaacagcctaccacagctttaagagtgtgatggacgaggtgttcaagga
tggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagataagaatatga
gtgagctggttccccgcatcgctgactggatgaccatgtacctggatgagcacatcagtccgtggatccaaagccaagga
ggatgggagtgctttgctgagatttttgggcagaacgccgctgcagaagcacgaaggtctcgggatactctgaagagatg
gctgctagtcggaggggtgctgctaatgggagttctggctggtgtgctcattgctaagaaacagtga
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1JZ46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=660 residues).
atggaagaaatgtcgaacagtaacagagagctggtggagttcttcataatgtacaaactgtctcaaagaaaccacccagc
ctctcttctgaggccagatgataccggtggagtgggagacagacccaactcagcagctgctaacggcctgccggtcagca
ggagtggcgagctggggaactcgtcacctccgtgtaagagcatggaggccgtaaaaacagctcttagggactctgctgac
gagtttgaactgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatcaaag
ctttaagagtgtgatggacgagttgttcaaggatggagtcaactggggacgtatagtggggctgtttgccttcggtggcg
tgctgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggatgaccatgtacctggat
gagcacatcagtccttggatccagagccagggaggatgggactgctttgctgagatatttgggcaagatgccgctgctga
ggcgaggagatctcgggaggctctgagaagatggctgctagttggagtggtgctgctcacgggagtgctgttaggtgtgc
tcattgctaagaaacggtga
>gnl|bcl2dbcds|A0A493TIA6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=BCL2L1 (length=717 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagccggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagctcgttcaatcagccgccgtc
cggcaggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggtaagggggtgctc
cttctgcactcctctgggggatctgggctggatctggccccttagtgctctgcagataaccccccccccccgcccccccc
ccccccgcacccccccccgccccctccccctccctccctctctccctccctccctccctccaggcctgggcttttaa
>gnl|bcl2dbcds|A0A8B9SM69_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL2L1 (length=684 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagccggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagctcgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggccggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9V5I0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas zonorhyncha GN=BCL2L1 (length=684 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagccggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagctcgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggctggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|H9GHK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anolis carolinensis GN=BCL2L1 (length=690 residues).
atgtcgagcagtaaccgagcgctcgtggtggacttcctttcctacaagctgtcgcagcggggccacagctggcatgagat
tgagatggagagcggggaggaagcgatggagccagcaaacgagacggggaacaccctcaatgggagcccttcttggcatc
ccagccccagccatgtcatcaatggggcctcagaacaccccgaactccttgaagaggaggaggaagaaaacccgagggtg
gatgtcagccagacacttagggaggctggcgatgagtttgaactaaggtaccggcgggcttttagtgacctgacctccca
gctccacatcaccttgggcacggcataccagagcttcgagcaggtggtgaatgaactcttccacgatggggtaaactggg
ggcggatagtggcattcttctcctttgggggagccctgtgcgtggagagcgttgacaaagagatgcaagggttggtggtg
aggattgccagctggatgaccacgtacctgactgaacacctggacccctggatccaagaaaacggtggctgggagcgatt
tgtggacgtctacgggaacgatgcggccgccaaaagcaggaagggccaggaacgcttcaacaagtggctctggacagggg
ccaccgtggccggtgtggtgctcctgggctccctcctgagccgcaagtag
>gnl|bcl2dbcds|A0A8B9CUX0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anser brachyrhynchus GN=BCL2L1 (length=693 residues).
atgtccggcagcaaccgggacctggtgattgactttgtttcctacaagctgtcgcagaagggctacagctggagccagct
ggaggaggaggaggatgagaacaggactgacttcgcggcggaggccgacacggacggggtgctcaacgggagcccgtcct
ggcacccgcccgccagccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgaaatcgttcggtcg
gccgccgtgaggcaggcgctgcgagaagccggggacgagttcgagctgcggtaccgccgggccttcagcgacctcacctc
ccagctccacatcacccccggcacggcgtaccagagcttcgagcaggtggtgaacgaactcttccgcgacggagtgaact
gggggcgcgtcgtggctttcttctccttcggaggggcgctgtgcgtggagagcgtcgacaaggagatgcgggtactggtg
gggcgcatcgtggcgtggatgaccacgtacttgaccgaccatctagacccctggatccaggagaacggcggatgggagcg
gtttgtggacctctacgggaacgacgctgctgcggaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9DB39_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anser cygnoid GN=BCL2L1 (length=693 residues).
atgtccggcagcaaccgggacctggtgattgactttgtttcctacaagctgtcgcagaagggctacagctggagccagct
ggaggaggaggaggatgagaacaggactgacttcgcggcggaggccgacacggacggggtgctcaacgggagcccgtcct
ggcacccgcccgccagccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgaaatcgttcggtcg
gccgccgtgaggcaggcgctgcgagaagccggggacgagttcgagctgcggtaccgccgggccttcagcgacctcacctc
ccagctccacatcacccccggcacggcgtaccagagcttcgagcaggtggtgaacgaactcttccgcgacggagtgaact
gggggcgcgtcgtggctttcttctccttcggaggggcgctgtgcgtggagagcgtcgacaaggagatgcgggtactggtg
gggcgcatcgtggcgtggatgaccacgtacttgaccgaccatctagacccctggatccaggagaacggcggatgggagcg
gtttgtggacctctacgggaacgacgctgctgcggaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|E2IV75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus vociferans GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A8B9NWH6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Apteryx owenii GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggctgggatggccggtgtccttaatgggagcccatcctggc
acccccctgctagccacatagtgaacggagccgctgtgcacaggagcagcctcgaagtccatgaaattgttcaagcagct
gacgtgaggcaggcactgagagaggcgggagatgaatttgagttgaggtaccggagagctttcagtgacctcacttccca
gctccacatcacccctggcactgcgtatcagagctttgagcaggtggtgaacgaactcttccgggacggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgcgtggagagcgttgacaaggagatgcgggtattggttgga
cgcgttgtatcttggatgaccacgtacttgaccgaccatctagacccctggatccaagagaatggcggatgggagcggtt
tgtggacctctacgggaatgatgctgctgccgagatgaggaagggccaggagaccttcaacaaatggctcctgactgggg
cgaccgtggcaggagtgcttctcctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B9NWH6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Apteryx owenii GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggctgggatggccggtgtccttaatgggagcccatcctggc
acccccctgctagccacatagtgaacggagccgctgtgcacaggagcagcctcgaagtccatgaaattgttcaagcagct
gacgtgaggcaggcactgagagaggcgggagatgaatttgagttgaggtaccggagagctttcagtgacctcacttccca
gctccacatcacccctggcactgcgtatcagagctttgagcaggtggtgaacgaactcttccgggacggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgcgtggagagcgttgacaaggagatgcgggtattggttgga
cgcgttgtatcttggatgaccacgtacttgaccgaccatctagacccctggatccaagagaatggcggatgggagcggtt
tgtggacctctacgggaatgatgctgctgccgagatgaggaagggccaggagaccttcaacaaatggctcctgactgggg
cgaccgtggcaggagtgcttctcctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A663ECL2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aquila chrysaetos chrysaetos GN=BCL2L1 (length=693 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccacgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaggcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccatatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
gggcgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A3P8P0F1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3B1JJ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L1 (length=720 residues).
gttatgtcgtactataaccgagaattagtggtgtactttattaagtacaaactctcacagaggaactatcctactaatca
catcggactcatggaagaaacaaatcgaactgaagggggccaggaagcggaggggaatgcagaggcggccggggtgactc
ccaccgcagtcgttaacgggtccgtaaatgggacgagtcacggtgcggcagggtcgcccacctcgtccccccagagaagg
gccaacggggctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgagtttgagctgcgatactctcg
cgccttcagcgacctgtcctcccagctgcacatcacgcctgctactgcgtaccagagctttgagagcgtgatggacgagg
tgtttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttcggcggggctctgtgtgtggagtgcgtggag
aaggagatgagccccctggtgggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagccctggatcca
ggagcaaggaggatgggaacgctttgcagagatctttgggaacgacacagcagcagagagcagaaggatgcaggaacgct
ataagatgtggctgctggtggggatgaccctgttcacaggaattgtggtgggctctctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|A0A8B9LKW7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L1 (length=717 residues).
atgtcgtactataaccgagaattagtggtgtactttattaagtacaaactctcacagaggaactatcctactaatcacat
cggactcgtggaagaaacaaatcgaactgaagggggccaggaagcggaggggaacgcagaggcggccgcggtgactccca
ccgcagtcgttaacgggtccgtaaatgggacgagtcacggtgcggcagggtcgcccacctcgtccccccagagaagggcc
aacggggctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgagtttgagctgcgatactctcgcgc
cttcagcgacctgtcctcccagctgcacatcacgcctgctactgcgtaccagagctttgagagcgtgatggacgaggtgt
ttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttcggcggggctctgtgtgtggagtgcgtggagaag
gagatgagccccctggtgggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagccctggatccagga
gcaaggaggatgggaacgctttgcagagatctttgggaacgacacagcagcagagagcagaaggatgcaggaacgctata
agatgtggctgctggtggggatgaccctgttcacaggaattgtggtgggctctctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|A0A8B8VBB9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Balaenoptera musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggacgagaacagaactgaggccccagaagggactgaatcagacatggaaacccccagtgccatcaatggca
acccgtcctggcacctggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaagcgctgagggaggcaggtgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacggcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A4W2D608_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=717 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtggtatgaaagaacacagaactgagaccccagaagggagagagtcagatatggaaacccccaatagccccacagtga
atggagccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggag
gcaagcaatgagtttaaactttggtaccaacagacattcagcgacctgacgtcccagctccgcatcaccccagggacagc
atgtcagagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctcct
tcagtgggacaatatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaatggccact
tacctaaataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatac
aacaaacgagagccagaagggccaggagcgcttcaactccatttacactactgctgctgtcgcaggcctcgcaaacctca
tttcaaacacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A4W2F845_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=711 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctccttcagtg
ggacactatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
aataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaagagtgtttcaactccatttacactactgctgctgtcgcaggcctcacaaacctcatttcaa
acacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A8B9WB42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=711 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccagaaaacgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctccttcagtg
ggacactgtgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaatggccacttaccta
aataaccacgtcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaggagcgcttcaactccatttacactactgctgctgttgcaggcctcgcaaacctcatttcaa
acacaaaactttattcaaaattggaccaaagatgcccatactatgtgggccactcaggctcagacagatga
>gnl|bcl2dbcds|A0A8B9X9C2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=654 residues).
aaatttatcttacagggaaaggggtatagcaaccgacggctggtggttgactttctctcttacaagctttcccagaaagg
atacagctggagtcgatttaatgatgtggaagagaacagaactgaggcctcggaagggacaaaatcagatatggaaaccc
caatgccatcaatgacaacccatcttgccactggccacagcagaagcttggacgcctggaaagtgatccccgtgacaaca
gaaaagcaagccctgagggaggcaggcaatgacgaccagacgtcccagctccacatcaccccagggacagcatatcagag
ctttgaacagatgatgtatgaactcctccaggacggggtgaactggggtcgcattgtggcctttttttccttcagtgggg
cactatgcatggaaagcatagacaaggagacacaagtattggtgagtcaaagcacaacttggatggccacctacctaaat
gaccacctagagtcttggatccaggagaacggcggctgggacacttctgtgaaactctgtgaaaacaatacaaccaccga
gagccaaaagggccaggagcgcttcaacagctggtccctgacgggcatgacttcggctggtacagctctgctgggcttgc
tactcaactcatag
>gnl|bcl2dbcds|A0A8B9XQH5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos mutus grunniens GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A3Q1LRT3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=714 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaaatggggtcacgttgtggcctttttctccttcagtg
ggacactatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
aataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaagagcgtttcaactgctggtccctgacgacacgactgtggctgtttggcattttcttaatta
aacatatatttaccaaacaacccagcaattgtactcttgagcatttatctgggagatacgcaacattactgtag
>gnl|bcl2dbcds|A0A4W2D608_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=717 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtggtatgaaagaacacagaactgagaccccagaagggagagagtcagatatggaaacccccaatagccccacagtga
atggagccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggag
gcaagcaatgagtttaaactttggtaccaacagacattcagcgacctgacgtcccagctccgcatcaccccagggacagc
atgtcagagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctcct
tcagtgggacaatatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaatggccact
tacctaaataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatac
aacaaacgagagccagaagggccaggagcgcttcaactccatttacactactgctgctgtcgcaggcctcgcaaacctca
tttcaaacacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|A0A4W2F845_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos indicus GN=BCL2L1 (length=711 residues).
atgtctcagagcaatcgggaactagtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgtcagatatggaaacccccagtggatcagtggcaacccatcctggcacctggcagatagccccacagtgaatggag
ccactggccacagcagaagcttggatgcccggaaaatgatccccatgacaacagtaaagcaagccctgagggaggcaagc
aatgagtttaaactgaggtaccaacagacattcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
gagctttgaacaggtaataaatgaactcttccgggacagggtgaagtggggtcacgttgtggcctttttctccttcagtg
ggacactatgcatgaaaagcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaacggccacttaccta
aataaccacctcaagccttggatccaagagaacggcgggtgggacacttttgtggaactctacgaaagcaatacaacaaa
cgagagccagaagggccaagagtgtttcaactccatttacactactgctgctgtcgcaggcctcacaaacctcatttcaa
acacaaaactttattcaaaattagaccaaagatgcccatactatgtgggccactcaggctcagatagatga
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C0FL84_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bubo bubo GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagtggaggacgccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccgtgcaccggagcagcctcgaagtccatgaaatcgttcaagcg
gccgatgtgaggcaggcgctgagagaggcgggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccccggcacggcgtatcagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccatgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggtaag
aactcatctccctggtggggatggctgccagtgtcctccctcgctccaggctggcagcggtgccggtcaaaccggtgcgc
agctccctgcagtgtttattctagtgcctgtcctagaccttgcagggagataa
>gnl|bcl2dbcds|A0A8C0AYR5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L1 (length=693 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccatgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C0AYR5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Buteo japonicus GN=BCL2L1 (length=816 residues).
atgtccagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccatgcaccggagcagcctcgaagtccatgaaatcgttcaaaca
gctgatgtgaggcaggcgttgagagaagcaggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaatgaactcttccgtgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcgttgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatggtccag
gccatggcctctgtccccagccctgtcacacacctccctcagagggagaggggctgtggctgtttgccgtgcagtggctc
tattgaaatttgctcggctcttgctgttgctggagatgaaggactggaggcagccggcttggacgagccgggccggagtg
actgcattcctggccaggcctcgtgcttggcccgctctcccgaagcccagggaaaggccggagtttcacgatccagagtg
cctgccttcgccatag
>gnl|bcl2dbcds|A0A8C3CGW6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cairina moschata domestica GN=BCL2L1 (length=684 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtcgcctacaagctgtcgcagaagggctacagctggagccagct
ggaggaggaggatgagaacaggactgaggtggcggccgaggccgacgcggtgctcaacgggagcccctcctggcacccgc
ccgccggccaggtagtgaacggcgccgccgtgcaccggagcggcctggaggtccgcgagctcgtccagtcggccggcgtc
cggcaggcgctgcgcgaagccggggacgagttcgagctgaggtaccgccgggccttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaactcttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtcgacaaggagatgcgggtgctggtggggcgcatc
gtggcctggatgaccacctacctgagcgaccacctcgacccctggatccaggagaacggcggatgggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggcgacgg
tggccggagtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C3KQJ2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Calidris pygmaea GN=BCL2L1 (length=693 residues).
atgtccaacagtaaccgggagttagtgattgactttgtttcctacaagctttcacagaagggatacagctggagcgatct
gcaggaggaggatgagaacaggactgactttgtggcagaggaggacgagatggacggcgtcctcaacgggagcccctcct
ggcaccaacccgccagccacgtagtgaacggagccaccgtgcaccggagaagcctggaagtccatgaaatcgttcaaaca
gccgatgtgaggcaggcgctgagagaggcgggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccccggcacggcgtatcagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccacgtacttgaccgaccacctagatccctggatccgggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8I3ZZI7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A8I3ZZI7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=639 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctggatgaaggtgatctttcaaatctcctctgcagagatccaatgggataatggtgactaccatttattgagcatctag
>gnl|bcl2dbcds|A0A8C0TGM4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q76LT7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A452E1B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagtttttccagaaaggatacagctggagtcagtt
tagtgatatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagcgccatcagtggca
acccatcctggcacctggcagatagctctgtggtgaatggagccactggtcacagcagaagcttggacgctgggaaaatg
atccccacggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggacaacatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggtgtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaataaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacttcaaccgctggt
ccctgacggacgtgactgtggctggtatggctctgctgggcttgctcttcaacacataa
>gnl|bcl2dbcds|A0A452FHY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggggatcaggactcagcaggaaggcag
ctgtctctaaagataccccttggctcaccttcccctctccccatgctcaagcctactga
>gnl|bcl2dbcds|A0A452FHY1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=723 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggctcgctcttcaactcatagtgactg
ttcctttcattacagtcattcatgttttgcacaagcttgtgttcccttccttttgttacagctatagagaccttacaatt
taa
>gnl|bcl2dbcds|A0A452FWV3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacattaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctatgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A250YD48_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Castor canadensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataggactgaggccccagaagggattgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacataaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggctacttacctgaatgaccacctagaaccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1L5BWY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Castor fiber GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataggactgaggccccagaagggattgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatgacagcagtgaagcaagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacataaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggctacttacctgaatgaccacctagaaccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C3WJH5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Catagonus wagneri GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcggtgaagcaagcgctgagggaggcgggtgatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacgtggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagtcggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgacactagctggcgtggttctgctgggttcgcttttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C3U3Q2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Catharus ustulatus GN=BCL2L1 (length=696 residues).
atgtacagcagtaatcgggcgttagtgattgactttgtttcctacaagctctcccagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtcctcaacgggagcccctcct
ggcacgcacccaccagccacatagtgaacggagcctccgtgcaccagagcagcctcgaagcccatgagatccgtcgagca
cccgacgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcac
ttcccagctccacatcactcccagcacagcatatcagagctttgagcaggtagtgaacgaactgttccgagatggagtga
actggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattg
gtgaaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatggga
gcgctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctga
ctggggcgacggtggccggagtgcttctgctgggatcgctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A286Y5D6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L1 (length=702 residues).
atgtctcaaagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaaggcccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctaactgatagtcccacggtgaatggggccactggccacagcagtagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctcttagggaggcgggcgatgagtttgaacttcggtaccggcgagcattcagcga
cttaacatctcagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggctacttacctgaatgaccacctagaaccttggatccaggacaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tgctgacgggcgtgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5M8B1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Cercocebus atys GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtgaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A0D6DR75_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Channa striata GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggtttactacataacatataaactgtcggagaaaaactatcctctcaaccacttggg
actcagtgagcctccaaacaggactgatggaggggaggttgagtccgctgaggaacagcggatagcgacgcacgccaacg
gtacttttaacggaagaagtcctggaacccccccagcatccccgctcaggcaacaacggttgccatcaccgacgagcctg
gatgcggtgaaagaggccctccgggactcagccaatgagtttgagctgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgcccgccacggcctaccaaagctttgcgaacgtcatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctctttgcatttggtggggcactgtgtgttgagtgtgtggagaaggagatgagtcagctggtg
gtcaggatcgtagagtggatgacagtgtacctggacgaccacattcagccctggatccaaagtcaaggaggatgggagca
ctttgctgaaatcttcgggcatgatgcagctgcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A8C0IVL6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chelonoidis abingdonii GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctatcgcagaggggatacagctggagtcggtt
tgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaagcccatgaaagggttccagcaacg
ggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgagatatcggagggctttcagtgacctcacttccca
actccatatcacccctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcgtggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3RIU8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chelydra serpentina GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttctctcctacaagctttcgcagaggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaggaggctgagatggcaagcgtccctaatgggagtccatcctggc
atccgggtgccagccacatagtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggccact
ggagtgaggcaggcgctgagagaggcaggcgatgagtttgaattgaggtatcgaagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtagtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcattgcctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcgctt
tgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcaggcgtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C2YUU6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L1 (length=702 residues).
atgtctcagagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
cagtgatgtggaagagaacaggactgaaggcccagaaggggctgaatcagagacggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccgcacggtgaatggggccactggccacagcagcagtttggatgcccgcgaggtg
atccccatggcagcagtgaaacaagctctgagggaggcgggcgacgagtttgaactgcggtaccggcgagcattcagtga
cctaacatctcagctacacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacgtttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgaccgtggccggcgtggttctgctggggtcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C2YUU6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L1 (length=702 residues).
atgtctcagagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
cagtgatgtggaagagaacaggactgaaggcccagaaggggctgaatcagagacggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccgcacggtgaatggggccactggccacagcagcagtttggatgcccgcgaggtg
atccccatggcagcagtgaaacaagctctgagggaggcgggcgacgagtttgaactgcggtaccggcgagcattcagtga
cctaacatctcagctacacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacgtttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgaccgtggccggcgtggttctgctggggtcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C2YUU6_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Chinchilla lanigera GN=BCL2L1 (length=702 residues).
atgtctcagagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
cagtgatgtggaagagaacaggactgaaggcccagaaggggctgaatcagagacggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccgcacggtgaatggggccactggccacagcagcagtttggatgcccgcgaggtg
atccccatggcagcagtgaaacaagctctgagggaggcgggcgacgagtttgaactgcggtaccggcgagcattcagtga
cctaacatctcagctacacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacgtttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgaccgtggccggcgtggttctgctggggtcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A0D9RJZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chlorocebus sabaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaaacgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=690 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactctggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C3IUT0_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Chrysemys picta bellii GN=BCL2L1 (length=711 residues).
atgtcaaacactaacagggagttagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
cgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
acccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggagctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggagccatctgctgtccc
attgcgtctcgctgcagcggccaaggccccgtctcgacgctggctgtgcccagcccagggcactcggctag
>gnl|bcl2dbcds|A0A8C3LRK6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Chrysolophus pictus GN=BCL2L1 (length=690 residues).
atgtccagcagaaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccgtcctggc
acccgcctgccggccacgtagtgaatggagccaccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcaggcgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggctggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A059PJI5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Clarias batrachus GN=BCL2L1 (length=717 residues).
atgtcttactacaacagagaacttgtcgtgtacttcatcaagtacaagctctcccagaaaaactacccctgcgaccacat
cggcctcacggaagaggtgaacggccaggtggcggaagagaacgcggtgggagcgggagagtcggagacgccgacagcag
tcgttaatggcaccctaaacgggaccggatcggcaggcactccaccgcgatcgccgactttgtcccctcagaggcaggtg
aatggcagcgcaagcctggaggcagtaaaggaggcgctacgtgactctggcaatgagttcgagctgcgctattcacgcgc
ctttagcgacctgtcatcacagttgcatataactccagtcacggtgtaccagagctttgagagcgtgatggacgaggtgt
tccgcgacggcgtcaactggggccgtatcgtgggcttgttcgcttttggaggtgccctctgtgtcgagtgtgtggaaaag
gagatgagtccgctggtggcacgtatcgccgagtggatgaccgtctacctggacaaccacatccagccctggattgaaga
gcaaggaggatgggaacggtttgcagagatctttgggaaagatgcagcagcagaaggcagaaggtcacaggaaagcttta
agaagtggctgctggcaggtgtgacactcttcacgggggtggtggtgggctccttcatcgctcagaagcgcctgtaa
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5H963_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Colobus angolensis palliatus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagctgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A6F8ZUL6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcaatt
ggtgctggagggtgcaagtggacggactgagggggaagaagccattgcaaatgggtctttggggaacaacaggaatggca
gaagcaatttgggtaagccttcatctccacaggggggcattgaggcagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgcgccttcagtgacctttcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgctttcggcggggccc
tgtgcattgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggactgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaagaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaacgccagtga
>gnl|bcl2dbcds|A0A6F9B188_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=789 residues).
atgatgacttacaacaacagagaactggtggtttactatattacctataaactatcacagagagactaccccttcaacca
cactgggctcacagaagctcccagtcagactgaggggggtgagggtggacaggtggaagggggggcggcagtcacgacac
accccaacggcacagtaaacgggacgagtcctgggactccaccgcgacagtctcccccctctacccctcagcggacaatg
ggcctggatgcagtgaaagaggcactgcgggactctgccaatgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggacgaggttttccgggacggtg
tgaactggggacgggtggtgggcctgtttgccttcggaggggccctctgtgtagagtgcgtggagaaggagatgagccca
ctagtgggacggattgcagaatggatgaccgtctacctggacaaccacatccagccttggatccagagccaaggaggatg
gatgaaagcagcgttttctctggggtcagctgagagaggggttgtcctgttcctggtgggtgggtgtgttatgggatgga
aggaggacactgttaaagagatctttgggaaggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtgg
ctgctggcggggatgacgctggtcacaggagtcgtcgtagggtcactcatcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A6F9BJ02_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=570 residues).
atgatgacttacaacaacagagaactggtggaatactatattacctataaactatcacagagggactaccccttcaatca
cattgggctcacggaatcccagagtcggactgaggggggaccggtggacgggagtgcggcagtcatgacatacgtcaact
gcacaatgaacgggacgagtcctggtactccaccaccacggcagtcacccccctcctcccctcggcggacagagggcctg
gacgcagtgaaagaggcactgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctggcctc
ccagctgcacatcacgccgtccacagcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggtgtgaact
ggggacgggtggttggcctgtttgccttcggaggggccctctgtgtagagtgtgtggacaaggagatgagccctctggtg
ggaaggatcacagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatgggtgag
tcacgactga
>gnl|bcl2dbcds|A0A6F9CY91_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coregonus sp. 'balchen' GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtagtgttttttataagctatagactgtcccagaggaattattcattttgtcaatt
ggggctggagggtgtaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaacaacaggaacagca
gaagcaatttagggaagccctcatctccactggggggaattgaggcagtgaaagcagcactacgggactcagcggatgag
tttgagctgcgctacaccagagccttcagtgacctcgcctcccaactccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggccgcgtggtgggcctatttgcttttggcggggccc
tgtgtgttgaatgtgttgagaaggatatgagccccctggtggcacgcatcgcagactggatgaccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagatgt
ccgacggtcccaggagagcgtaataaaatggctgctagttggggtgattctgttttcaggagtgctggtcggcactctca
tcatgaagaaacgccagtga
>gnl|bcl2dbcds|A0A8C2T2M7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Coturnix japonica GN=BCL2L1 (length=690 residues).
atgtccggcagtaaccgggacttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcggcagaggcagagatggacagcgtcctcaacgggagcccatcgtggc
acccgcctgccggccacgtagtgaatggagccaccgtgcaccggagcagcatggaagttcatgaaatcgtcggagcatct
gacgtgaggcaggcgctgagagaagcaggggatgagtttgagctgaggtacaggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagcttcgagcaggtagtcaatgaactcttccacgatggtgtgaactggg
ggcgcattgtggctttcttctccttcggaggggctctgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagttcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|B2Z3Z4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cricetulus griseus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagttctcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtaaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagccgtaaagcaagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcgttcagtga
tctaacatcccagcttcatataaccccagggactgcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggcgg
ctgggacactttcgtggaactctacggaaacaatgcagcagctgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctctctcttcagtcggaagtga
>gnl|bcl2dbcds|A0A7M4EJG9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Crocodylus porosus GN=BCL2L1 (length=690 residues).
atgtcgagcagcaaccgggaattagtgattgactttatatcctacaagctgtcacagcggggacacagctggagtcagct
tgaggggcaggatgagaccaggactgagtttgcagaagaggaggacatggcaagtgtcccgaatgggagtccgtcctggc
atcccactgccagccacgtagtgaatggggctgctggacacaggaacaacctggaagcccaggagagtgttccagcggct
gaagtgcggcaggcgctaagggaggcaggagacgagtttgagctgaggtaccgcagggccttcagcgacctcacatccca
gctccacatcacccctggcacagcataccagagcttcgaacaggtggtgaatgaactgttccgggatggagtgaactggg
ggcgcatcgtggcctttttctccttcggaggggccttgtgtgtggagagtgtcgacaaggaaatgcaggtgctggttgga
cgtatcatctcatggatgaccacctacctgaccgaccacctcgacccctggattcaggagaacggcggttgggagcggtt
cgtggatctctatggcgatgacgctgcagccaagagccggagaggccaggagcgtttcaacaagtggctcctgaccgggg
ccacggtggctggcgtgcttctgctgggctctctgctcagccgcaagtag
>gnl|bcl2dbcds|A0A345BSW9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ctenopharyngodon idella GN=BCL2L1 (length=627 residues).
atgtcttactataacagagaactagtggtattttttattaaatataaactctcgcagaggaactacccctgcaaccacat
tgggcttacagaagacacaaatcggactgatggggccgaagagaatggtgagggggcggcaggaacgacgaccctcgtta
acggctccatgaacagaaccccaccacaatcccccgctacatccccccagcatcagacaaacgggagtgggggtctggac
gcggtgaaggaagcactacgcgattctgccaatgagtttgagctgcgttattcccgagcgttcaacgacctttcctcaca
gctccacatcacacctgccacggcataccagagctttgagagcgtgatggatgaggtgttccgcgacggcgtcaactggg
gccgcatcgtgggactgtttgccttcggaggggctctgtgcgtcgagtgtgtggagaaggagatgagcccattagtggga
cgcattgcagaatggatgaccgtctacctggacaaccacattcagccctggatccagagccaaggaggatgggtgagtgg
aaaattacttgcatttctttcctaccttgttccctttcttcagtttaatcacaaagagcctttgtaa
>gnl|bcl2dbcds|A0A8C0U194_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyanistes caeruleus GN=BCL2L1 (length=693 residues).
atgtacagcagtaatcgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtcctcaacgggagcccctcct
ggcatgcacccaccagccacatagtgaacggagccaccgtccaccagagcagcctcgaagtccatgagatccgtcgagca
gctgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaatgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcattgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C3XCF2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyanoderma ruficeps GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagccagct
ggaggaggaagatgagaacaggactgactttgcaggggaggaggacgaggtggatggcgtcctcaatgggagcccctcct
ggcacgcgcctaccagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtccacgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacaatgctgctgccgaggtgagaaaaggtcaagaaaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C2ZH46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L1 (length=678 residues).
atgtccaacatcaacagagagctggtggagttcttcataagctacaagctgtcgcagaagaactacccaacctctctgct
gtggccagaggaggatgccgccggtgggaggacggagggagacgaagccgacccagcatccagtaacggctcgctggtca
acggcggggacggggacggggccggcccgtcggggacgtcatcgcctccgtccggtgacgtggaggccgtgaaggcggct
ctccgggactcggcgaacgagtttgagctgctcttcacgcaagcgttcagtgacctttcctcgcagctcgacgtcacccc
cgtcacggcctaccacagctttaagagcgtgatggacgaggtgttcaaggacggagtcaactggggccgcgtggtgggcc
tgttcgccttcggcagcgtgctgtgtgtggactgcgtcgagaaggacatgagcgagctggtttcccgcatcgcggactgg
atgaccacgtacctggacgagcacatcagcgcatggatccagagccagggaggatgggactgctttgccgagatctttgg
gcgggacagcgctgcggaggcgaggatatctcaggagacgctgaggaggtggctgctcgttggagcggcgctgctaaaag
gagtgctcggcggcatggccatcagcaagaagcggtga
>gnl|bcl2dbcds|A0A8C2ZZ68_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyclopterus lumpus GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagagctggtggtcttctacataaactataaactctcccagaggaactatcccctcacccacatggg
actcacagagcctctgaacaggactgacgggggggaggcgggggcgggcgatgccgaggaacagcgggtagcgacgcacg
ctaacgggactttcaatggcacaagtcccgggaccccaccggcatccccgctgcgaccgcaacggttgccgtcgacgacg
aacctggacgcggtaaaggaggccctccgggactcggccaacgagttcgagctgcgatacgcccgggccttcagcgatct
gcacaaccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgtttcgggacgggg
tcaactggggccgcatcgtggggcttttcgccttcggcggggccctgtgcgtggagtgtgtggagaaggagatgagtcca
ctggtgggacggatcatcgagtggatgacggtctacctggacaaccacattcagccctggatccagacccagggaggatg
ggagcgcttcgccgagatctttgggcaggacgcggcggcggagagcaggaagtctcaggagagcttcaagaagtggctgc
tggcgggggtgacgctggtgaccggcgtcgtggtggttttgctcatcggccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3P8UWG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L1 (length=708 residues).
actttgacctttaatattaacagaaaactggtggtcgactacatacagtataaactttcccagaggaactttcccgtcca
ccacctgggactcggtgattctccaaacaggactgatggggaagaggcagggttgggcgcagagcagcggacaagtacgc
acgccaacgggactgtaaacggcacaagttctgggacgccgcctgcatctccactgcggcagcagcattcggcgtcggat
acaagtctggactccattaaagaggctctgcgggactcggccaacgagtttgaactgcgatacgcgcgggccttcagcga
tctgcaccagcagctgcacatcacaccagccactgcctaccaaagtttcgagaatgtgatggacgaagtgttccgggacg
gtgtcaattggggtcgcatcatagggctcttcgccttcggcggggcgctgagtgtcgagtgcgtggagaaagagatgagt
cagctggtggccaggattgcggattggatgacagtctatcttgacaaccacatccagccatggatcgaaacccaaggtgg
atgggagcattttgcggaactctttggtcaggatgcagcagcggagagccggaggtcacaggagagttttaagaaatggt
tgctggctgggatgacgctggtgacaggcgtggtggtgggctccctgattgcccagaaacgtctctga
>gnl|bcl2dbcds|A0A3P8VMA1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L1 (length=645 residues).
atgtcgtgcagtaacagagaattggttaagttctttttaggttataagctttctcagaggaactacccagaatctcttct
gatgttgaggattgggggagaacagcgtgaaggtgaggaggtcaccacagcgtccagtaatggcgttcctcagactcctt
cagctgtgctgcagcactgcagtggtgcagaggctgtaaaggctgctctcaaggactcagctgacgagtttgaacttcgc
ttcacacaagcctttcgtaaccttttcttaaagctggacctcactccggacacagtctaccacagttttaagagcgtgat
ggatgaggtcttcagagacggagtcaactggggacgcatagtcggcctgtttactttcggaggagtactgtgtgtggaat
gtgtgcagaggaatatgagtgagttagttccccgcattgcagactggatgaccatgtacttggatgaatacattgatcca
tggatccagagccaaggaggctgggaccgttttgctgagatttttggcacagactgtattccaagaacgaggagttgtcg
ggacacagtgagaagatggctgctagtgggagcaggcctgcttgcagcagtgttgattggtgttctgatcactaaaaagc
attga
>gnl|bcl2dbcds|A0A3Q2C6K4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=BCL2L1 (length=660 residues).
atgtcatacagtaacagagaactggtagagttctatataagctacaaactgtctcagacaaactgcccaaactctctgct
gaggtcggaggtcactggtggccggaccgagggagacaaggacgcctcggcttccagcaatggcccacttttcaacagca
ggcccagcccccccgggaagcctcgggccccccatggaagcatagaggctgtaaaatccgctctgaaggactcagcaaat
gagtttgaacttctcttctctcaaagtttcagtgacctctccatgcagctagacatcacccctgacacggcctaccacag
ctttaaggccgtgttggacgagttgttcaaggatgggatcaactggggccgtgtggtggggctgtttgcctttggtgggg
ttctgtgtgtgcactgcgtgcagaagaatatgagtgagttggtgtcccgcattgcagactggatgaccatttacctagat
gagcagcttaacccttggatccacagccagggaggatgggactgctttgctaagctgtacggccaagacgccgctgcaga
ggggcggagatctcacgagacattgaacaaatggctgctagttggtgcggctctgctcggcggagttctgctcactgtgc
ttgttgctaagaaacgatga
>gnl|bcl2dbcds|A0A3Q2FR43_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinodon variegatus GN=BCL2L1 (length=681 residues).
atgtctcagaacagagaactggtccttttctacattaagttcaaactgtctcagaggaactatcccgtcaaccacataat
gctcaacgagccgcccaacggcaccggcgcccagggggcggagcaggacgacgagcgtacgccggagacgcacgctaacg
ggacttttaacgggaccagtccaggctccccgcggcgacagcaggcgtccacagccgccatggaggcggtgaaggcggcg
ctgagagacacggcctgcgagttcgagctgcgctacgcccgcgccttcaacgaccttcacagcacgctgcacatcacgcc
ggccaccgcctaccagagcttcgagaacgtgatgaacgaggtgttccgggacggcgtcaactggggccgcatcgtgggcc
tgttcgccttcggcggagcgctgtgcgtggaatgcgtggagaaggagatgagtcccctggtggggcggatcgtggagtgg
atgaccgtctacttggatgagcagatcgatccctggatccagagccaaggaggatgggaacgctttgctgaaatcttcgg
aggcgacgcagcggctgagagcagaaggtctcaggagagcctgaagaactggctgctgctggggatgagcgtggccaccg
ccctcatagccggctccatcttcgcccacaaacgcctgtga
>gnl|bcl2dbcds|A0A8C1JXA4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cyprinus carpio GN=BCL2L1 (length=720 residues).
atgtcttactataacagagaactggtggtattttttattaaatataaactctcacagaggaactacccgtacaatcacat
tgaatttacagaagacacacatcggactgatgcggtggaagggaatgatgatgaggaggcagcaggaacaacgaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccaccaaggtcccccacttcagccccccagcgtcag
acgaacgggactgggggtcttgatgcagtaaaggaggcgcttcgcgattctgccaacgaatttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcgcattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcggagatctttggaaaagatgcagcggcagagagcagaaaatcgcaagaaaact
tcaagaagtggttgctggctggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|B2GRK1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|B2GRK1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgcttcgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C4CMF6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Denticeps clupeoides GN=BCL2L1 (length=726 residues).
atgtcctacagcaacagagagctggttgtgtattacatcaactataaactgtcccagaggaactaccctctgagccacgt
cggcctgacccaccagatggagtctccagtggacagcagtcaggagggcgcaggtgtgacggcgctgtccaacggctcag
tgaacggaacaagcgcgttgccggcatccgccgagctgtccccgctgctgtccccggtgctgtccgggaacggtagcggt
ggtggcgccagcagcagcagcagcatcgatgccgtgaaggaggcccttcgagactctgccaacgagttcgagcttcgtta
ctcgcgggccttcagcgacctctcgtcccagctgcacatcacgcccgccaccgcgtaccagagcttcgagagcgtgatgg
acgaggttttccgcgacggcgtgaactggggccgcgtggtgggcctgttcgccttcggaggggcgctctgcgtggagtgc
gtggagaaggagatgagtccgctggtagcgcgcatcgccgactggatgaccgtctacctggacaaccacatccagccctg
gatccagagccaaggaggatgggaccgcttcgctgagatcttcggcaaggacaccgccgcagagagtcgtcgctctcagg
aaagctttaagaattggcttgtggcagggatgaccttggttacaggagtcgtggtgggttcactcattgtccggaagcac
ctgtaa
>gnl|bcl2dbcds|A0A8C4IRU9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L1 (length=621 residues).
atgtcgtacagtaacagagagctggtggagttctttataagctataaactgtctcagaggaaccacccaacctctctact
gaggccggagaatgccggtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttgctggccagcgctg
acatagaggctgtaaaggcagctcttcgggactcggcagatgagtttgaactgctcttcacgcaagcgtttagtgacctt
tcctcgcagattgacatcactcctgacacggcctaccacagctttaaaagcgtgatggacgaggtgttcaaggatggagt
gaactggggacgtatagtgggcctgtttgcctttggcggtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagc
tggtttcccgcatcgcagactggatgaccatgtacctggatgagcacatcagtccgtggatccagagccaaggaggatgg
gactgctttgctgaggtttttgggcgagacgccgccgcagaagcgaggagatctcgggagactctgagtagatggctgct
aattggggtggcgctgctaatgggagctgtggtcggggttctcattgctaagaaacattga
>gnl|bcl2dbcds|E6ZFR0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L1 (length=663 residues).
atgtcgtacagtaacagagagctggtggagttctttataagctataaactgtctcagaggaaccacccaacctctctact
gaggccggagaatgccggtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttgctggccagcaaga
acacaagtggccagccggggacgtcttcgtcctcaggcgctgacatagaggctgtaaaggcagctcttcgggactcggca
gatgagtttgaactgctcttcacgcaagcgtttagtgacctttcctcgcagattgacatcactcctgacacggcctacca
cagctttaaaagcgtgatggacgaggtgttcaaggatggagtgaactggggacgtatagtgggcctgtttgcctttggcg
gtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcccgcatcgcagactggatgaccatgtacctg
gatgagcacatcagtccgtggatccagagccaaggaggatgggactgctttgctgaggtttttgggcgagacgccgccgc
agaagcgaggagatctcgggagactctgagtagatggctgctaattggggtggcgctgctaatgggagctgtggtcgggg
ttctcattgctaagaaacattga
>gnl|bcl2dbcds|A0A8C4JDK2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaaggactacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagcccgtcctggc
acccccctgccagccacgtagtgaacggagccgccgtgcacaggagcagcctcgaggtccatgaaactgttcaagcagcc
gatgtgaggcaggcgctgagagaggcaggcgatgaatttgagctgaggtaccagagagctttcagtgacctcacttccca
gctccacatcacccctgccacggcgtatcagagcttcgagcaggtggtgaacgaactcttccgggatggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgtgtggagagcgttgagaaggagatgcgggtattggttgga
cgcattgtatcttggatgaccacgtacttgaccgaccatctagatccctggatccaagaaaatggcggatgggagcggtt
cgtggacctctacgggaataatgctgctgctgagataaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggcaggcgtgcttctgctgggatctctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8C4JDK2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Dromaius novaehollandiae GN=BCL2L1 (length=633 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcacagaaggactacagctggagtcagct
cgaggaagaggatgagaacaggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagcccgtcctggc
acccccctgccagccacgtagtgaacggagccgccgtgcacaggagcagcctcgaggtccatgaaactgttcaagcagcc
gatgtgaggcaggcgctgagagaggcaggcgatgaatttgagctgaggtaccagagagctttcagtgacctcacttccca
gctccacatcacccctgccacggcgtatcagagcttcgagcaggtggtgaacgaactcttccgggatggagtgaactggg
gtcgcatcgtggctttcttctccttcggaggggcgttgtgtgtggagagcgttgagaaggagatgcgggtattggttgga
cgcattgtatcttggatgaccacgtacttgaccgaccatctagatccctggatccaagaaaatggcggatggcgctgcat
gggactctgcccgtgggaggtatatggcctacagatgtctgagttttcttcttgcttctgctttgggatctga
>gnl|bcl2dbcds|A0A665VM40_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Echeneis naucrates GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggttgttttctacataaaatataaactttcccagagaaactatcctctcaaccacatgga
gttcaatgaatctcttcacaggactgatggtgggggggcagggttggttgaagaacaaagggtagcaacgcattccaacg
gaacttttaatggcacaagttctggaacccggtcagagtccccacaggggcagcaacacttggcatcaatgacaagcctg
gatgcagtgaaggaggccctcctggattctgccaacgagtttgaattgcgatactcccgcgccttcagcgacttgcacaa
ccagctgcatatcacaccggccacagcttacataagctttgaaaacgtgatggatgaagtgttccgtgacggcgtcaact
ggggccgcatcatagggctttttgtgtttggtggggcactatgtgtcgagtgcgtggagaaggagatgagtccactggtg
gtcaggatcattgaatggatgacagtctacctggacaacaacattcagccctggatccagggtcaaggaggatgggagca
ttttgctgaactctttgggcacgatgctgcagcggagagcagaaggtcacaggaaagtttcaccaagtggctgctggcag
gaatgaccctgctgactggagttgtggtggggtcactgatcgccagaaagcgcctgtga
>gnl|bcl2dbcds|A0A665VSD7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Echeneis naucrates GN=BCL2L1 (length=654 residues).
atgtcgtacagcaacagagagctggtggagttcttcatacactccaaactgcctctggcctcgctgctgaggccagagga
tgctggtggacagactgaaggagacaaggccaactcagctgctaggaatggcctacctgtcatcagtgggagcatgctga
gttacactaggacccccccacccccaccatgtgacattgaagctgtaaaggaagctcttagggactctactgatgagttt
gaattcctcttcaggcaagcatttagtgacctttcctcacagcttgacatcacttctgacacagtctaccagagcttcga
gaccgtgatggatgaggtgttcaaggatggcatcaactgggggcggatagtggccctgtttgcctttgggggtgaacttt
gtgtggaatgtgttgagaagaatatgagtgagatggttcccagcattgcagagtggatgaccatatacttggatttgcac
atccgtccatggatcgagacgcaaggaggctgggactgctttgctgagatttttgggcagaactccgctgcaacagcgag
gagatctcaggaggctgcgaggaggtggctgctagttggagtggcgctgctgacaggagtgctgatgggtgtgctcattg
ctaagaaacagtga
>gnl|bcl2dbcds|A0A4W4GHX3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Electrophorus electricus GN=BCL2L1 (length=702 residues).
atgtcgtactacaacagagaactggtcatgtactatatcaggtacaaactctcccagaggaactatccctgtagccacat
cgggctcacagaagatatgggccagactgaggggggtccggagggagaggatggtgcggaggccgcggcaacgccgacgg
cagtggccaatggctctacggcaagccccacccggttgccggcctcgcctgggccaagggcggcgaacggaggcggggga
ctggaagccgtgaaggaggccctgcgggactcggccaacgagtttgagctgcgctactcgcgcgcattcagcgacctgtc
ctcacagctgcacatcacgccagccacggcgtaccagagtttcgagagcgtcatggacgaggtgttccgcagtggcgtca
attggggccgaatcgtgggcctgtttgccttcggtggggccctttgcgtggagtgtgtggagaaggagatgagtccactg
gtggggcgcattgccgagtggatgaccgtctacttagacaaccacatccagccgtggatccaggagcaaggaggatggga
gcactttgcggagatcttcgggaaggacgcagcagcagagaacagaaggtcgcaggaaagcttcaagaaatggctgttgg
ctggaatgaccctgttcacaggggtcgtggtaggctccctctttgctcagaagcgcctgtaa
>gnl|bcl2dbcds|A0A219P0Y3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=699 residues).
atgtgtcaaaacagagaactggtggtttgctacataaaatataaactaacccagagaaactatcctctcaaccacatggg
actcatagagcctccaaacaggactgatgggggggaggcagggttaggtgaggagcagcgggtagcgacacacgccaacg
ggacttttaatggcatgagtcccgggaccccgccagcatccccgctgcggcagcaacagttgccatcaacaacgagcctg
gacgcggtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgctcgcgccttcagcgatctgcacca
ccagctgcacatcacgccggccacagcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggagtcaact
ggggccgcatcgtagggcttttcgctttcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagtccgttggtg
ggcaggatcatagagtggaagacccgctatctggacaaccacattcagccctggatccagagccaaagaggatgggagcg
cttcgccgaaatcttcgggcaggacgcggcggcagagagcaggaggtctcaggagagtttcaaaaagtggctgctggcgg
ggatgaccctggtgaccggagttgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A510BW31_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Epinephelus coioides GN=BCL2L1 (length=666 residues).
atgtcgtacagtaacagagagctggtggagttctttgtaagctacaagctgtctcagaggaaccacccgacctctctact
gaggccagagggtgctgaaggaaggaccgagcgagacaaggccagctcagctgccagtaacggcttgctggtcaacagca
ggaatgggggcagccagccggggacttcatcacccccgcatggtgacatagaagctgtaaaggcagctctgcgggactca
gcagatgagtttgaactgcttttcacgcaatcatttagtgacctttcctcgcagctagacatcactcctgacacagccta
ccacagctttaagagtgtgatggacgaggtgttcaaggatggagtcaactggggacgtgtagtgggcctgtttgcctttg
gcggtgtgctgtgtgtggaatgtgtagagaaggatatgagtgagctggtttcccgcatcacagactggatgaccacgtac
ctggatgagcacatcaatccatggatccagacccaaggaggatgggactgctttgctgagatttttgggcagaacagcgc
tgcagaagcgaggcgatctcaggagagtctgagaagatggctgctagttggagtcgcgctgctcatgggagtgctggtcg
gtgtggtcatcgccaagaatcactga
>gnl|bcl2dbcds|A0A8C4L2X1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus asinus asinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaagtga
>gnl|bcl2dbcds|A0A3Q2H0F6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctgggacacctttgtggaactctacgggaacaacgcggcagccgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A3Q2H0F6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Equus caballus GN=BCL2L1 (length=738 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacaactggagtcagtt
tagtgacgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccacggggaatggagccactggccacagcagcagcttggatgcccgggaagtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacctggatggccacttacctgaatgaccacctagagccttggatccaagagaacggcgg
ctggaaagaaactgctttggggaccttctgctacttcgtttcatccctgatgagactctcaggccaaggcggagccttac
agctagctccaagctacagtgctttttgggcagactccagagctcccctcggaactagaggtttttctctcgctcttcag
gaaatgccattgcaatga
>gnl|bcl2dbcds|A0A8C4STP1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BCL2L1 (length=675 residues).
atgccctacagcaacaaagagctagttgaagattttataagctataaattatctcagaaaaatttttcatgtaaccagta
tttcggagacagtaggactgccacaccagggacctccactcctgagaatgaacaagatgtgctacatgtcaatggctctg
tcagtggaacagaaaatggaggcagctcttctgcagaccactcgcctgatggtatcagagcagtaaaagaggcactccat
gactcgggggatgagtttgagttgaggtaccgggctgctttcagtgatctctcatcccagctgcacatcaccccagttac
cgcttaccaaagctttgagcaagttatcaacgaactcttccgagatggggtgaactggggacgtatagtggcactcttcg
catttggtggtgctctgtgtgtggaatgtgtggagaaggaaatgggttctttggtgaaacgcatagctgaatggatgacc
acctacttggacaataacctagatccctggatccagagacaaggaggatgggacacgttcgccaaaatctacgggagcaa
cgcggctgccgagtgccggaggtcccaggaacgtttcagtaggtggctgttggcaggaatgactctggctactggcctga
tgctgggctcctacttcttccacaaacgcttgtag
>gnl|bcl2dbcds|A0A8C4XBF6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Erpetoichthys calabaricus GN=BCL2L1 (length=597 residues).
atgtcttacagcaacagagagcttgttgaagattttatcagctacaaattatcgcagaaaaatgttttgaatagccagag
tgaactggatgtattacaggtcaatgggactggaataatcaatagcttcccagccactccagcatctaatggagttaaag
cagtaaaagaggcacttcgtggctcaggggacgagtttgagctgaggtaccgggctgctttcaatgaccttgcttcgcag
ctacatatcacccctgttacagcttaccagagcttcgaggaggttgttggcgaactcttcagagatggagtgaactgggg
acgcatagtggcactcttttcatttggtggtgcgctctgtgttgaatgtgtggagaaggaaatggttcctcttgtgagac
atatagcagactggatgaccacctacttggataataacattgatgcctggatcctgagtaatggaggatgggataccttt
gtcaggatctatggacgacacgcatcagccgagtatttcaagaagtggctggtggttggagtgactatgactgctggact
ggtgttggcctcctttattgcacacacccatctgtag
>gnl|bcl2dbcds|A0A3P8XFS0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=660 residues).
atgtcttacagtaatagggaactggtggtgttttttataaactataaactgtcccagaggaattattcctgttgtgaatt
ggagctggagggtgcaagtggacggactgagggagaagaggctactgcaaatgggtctgtggggaacggcaggaacagca
gacgcaatttgggaaagccctcaactccacaggggtgcatggaggcagtgaaagcagcactacgggactctgcagatgag
tttgagctgcgctacacccgtgccttcagtgatctctcctcccagctccacatcacccccgccacagcctaccacagttt
tgaaagtgtgatggacgaggtgttcagggatggggttaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tatgtgttgagtgtgttgagaaggatatgagcctcctagtggcacgtattgcagactggatgaccacctacctggacgaa
cacatccagccctggatccaaattcaaggaggatgggatcgttttgctgacatttttggcagagatgcagctgcagacat
ccgacgttcccaagaaagcttgaggaaatggctgctatttggggtgatgctgctttcaggagtgctggttggcactctcc
tcatgaagaaacgccagtaa
>gnl|bcl2dbcds|A0A3P8XFS0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=627 residues).
atgtcttacagtaatagggaactggtggtgttttttataaactataaactgtcccagaggaattattcctgttgtgaatt
ggagctggagggtgcaagtggacggactgagggagaagaggctactgcaaatgggtctgtggggaacggcaggaacagca
gacgcaatttgggaaagccctcaactccacaggggtgcatggaggcagtgaaagcagcactacgggactctgcagatgag
tttgagctgcgctacacccgtgccttcagtgatctctcctcccagctccacatcacccccgccacagcctaccacagttt
tgaaagtgtgatggacgaggtgttcagggatggggttaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tatgtgttgagtgtgttgagaaggatatgagcctcctagtggcacgtattgcagactggatgaccacctacctggacgaa
cacatccagccctggatccaaattcaaggaggatgggatcgttttgctgacatttttggcagagatgcagctgcagacat
ccgacgttcccaagaaagcttgaggaaatggctgctatttgggatggaaaatgcgcaatggacctga
>gnl|bcl2dbcds|A0A3P8XYL5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Esox lucius GN=BCL2L1 (length=696 residues).
attatgacttacaacaacaaagaactggtggcatactatattacctataaactatcccagagaaactaccccatcaatca
cactgggctcacaggagcatttgatcggactgaggggggagaggtggaagaggtggcagcagtcaccatgcaccccaatg
gcacaatgaatgggacgagtcctgggactccaacacaacagtcccccccctcatctcctcggcggactgttggcctggat
gcagtgaaagaggcactgcgggactctgccaacgagtttgagctgcgttacgccctagcattcagtgacctgtcatccca
gctgcacctcacaccggctacagcctaccagagctttgcaagtgtgatggatgaggtgttccgggatggggtgaactggg
gaagggttgtgggcctgtttgcgttcggaggggccctctgtgtagagtgcgtggagaaggagatgagcccccttgtggga
cggattgctgactggatgaccgtctacctggataaccacatccagccctggatcgagagccaaggaggatgggaccgttt
tgcagagatctttgggaaggatgctgcagccaacagcaggaagtctcaggagagctttaagaagtggctgctggcaggaa
tgacgctggttacaggagttgtcgttgggtctcttattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C4TWS5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Falco tinnunculus GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggtacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagcagaggaggccgagatggacggcgtcctcaatgggagcccctctt
ggcacccgcccgccagccacgtagtgaatggagctgccgtgcaccggagcagcctcgaagtccatgaaattgttcaagca
gccgatgtgaggcaggcgctgagggaggcaggggatgagtttgagttgaggtaccggcaggctttcagcgacctcacttc
ccagctccacatcacccccggcacagcgtatcagagctttgagcaggtagtgaatgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgtgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtagcttggatgaccacgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacaatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A5F5XYW0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=744 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggttgttattgagcaccaacggtgtgccaggctctgtgctccacagggtgcacacagcccagaacaaagcagcccat
ggagcacctcttctagagaaaggagacacgacggacaaggaaacaaacaagattgttccggggataaattgttctgcaac
caactaccccaaaacttaagctaa
>gnl|bcl2dbcds|A0A5F5XYW0_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=816 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggtcagaacaaacgccgaaa
cagagctgccacagagagtttgtccggtcctggggacgacgccttgcctggatttcgctgggacgggaagggactgttgg
cctggaaggtggaggaaacctcctttgggcgggtctgaccactctgcacagctcccgtcccagggcagaagttcccggag
gagggggcggtgctga
>gnl|bcl2dbcds|A0A5F5XYW0_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggtctggactggcttattttaccctgagttcctggcacagggcctgaggttgggtaagggcttggccagcatctgct
caatgaacatgaggttattattagatgcaggttag
>gnl|bcl2dbcds|Q8SQ42_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Felis catus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcggtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtcaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgctccaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A803VLI1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ficedula albicollis GN=BCL2L1 (length=630 residues).
atgtacagcagtaatcgggagttagtgattgactttgtttcttacaagctctcacagaaaggctacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggcgtgctcaacggaagcccctcct
ggcacgcacccaccagccacatagtgaacggagcctccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtggatcccagtcccgtggcagccactctctga
>gnl|bcl2dbcds|A0A8C5B4N8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcagatgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggtgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
>gnl|bcl2dbcds|A0A8C5FC81_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=759 residues).
atggcgcaactggaccccgcccgccccttggtttcccagaaccgcgagctggtgctgttctacatcacgcacaagctggc
ccagaagaacttccccctcaaccacctcacactggcggccacgcccccaaaccggactgaggtgggcggggccgcaccgg
gccccgcccgcgtccccgcgccgcacgccaacggcacgccgaacggcaccaccaccgccgccgccgccacgcccccccca
tcgcccccgcccaccgcgcctccgccccggcgccagtcgtccgcggagacggtcgccatggcggcggtgaaggaggcgct
gcgggacacggcgggcgagttcgagctgcgcttcacgcgggccttcagcgacctctcctcccagctgcacatcacgccgg
ccaccgcctaccagagcttcgagagcgtcatggacgaggtgttccgcgacggcgtcaactggggccgcgtggtgggcctg
tttgcctttggcggcgccctgtgcgtggagtgcgtggagaaggagatgagctccctggttgggcgcatcgccgagtggat
gacggtgtacctggacgtgcacatccagccctggatccaggcgcaggggggatgggagcgtttctccgaggtgtttggga
aggacgcggcggccgagagccggcgttcccaggagagcttcaggaagtggttcctggcggggatgaccctgttcacgggg
gtcgtggtggggtcactcttcgcccagaaacgcctctga
>gnl|bcl2dbcds|D2ITA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gadus morhua GN=BCL2L1 (length=684 residues).
atgagcattgacacaagcatgtcgatcagtaacagagaactggtgttcttcttcctaagccataaactgtctcagaggaa
ttacaggcctattcccttccagcccgagggggcaggtgaggggactgatgaggacaagtccaacaggattggtaataatg
ggttacggttgaacgacggtaacggcaatggccagttggcgccatcacctactccacaaggcacggaggctgtgagggca
gcgcttctagaatcggtggaagagtttgagttgcgctacacgctggccttcagcgacctgtcgtcccagctgcccatcac
ccccgccacggcctacggtagcttcgaaagcgtgatggacgaggtgttcagggacagcatcaactggggacgcatagtgg
gcctgtttgccttcgggggggccctctgcgtggagtgtgtggagaaggagatgagccacatggtgccccgcgtggcagag
tggatgaccaggtacctggacgaccacattgaccactggatccagagcaacggaggatggaaacactttgctgcggtttt
tggaagcgacgcggcagcgggagcgaggcgtacccgggacagtcacaggagatggatgctggtgggcgcggcgctgctga
ctggggtgctgctcggggctctgctcgccaagaaacatgtctag
>gnl|bcl2dbcds|G3NJY1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=573 residues).
atgtctcaaaacagagaactggtggttttctacataaactataaactctcccagaggaacttacccctcaaccacatagg
gctgtccgagcctcccaacaggactggcgggggggtagaggcaggggcggctggtgggcagcggggagcgacgcactcca
acgggactttcaacggcacgagtcccgggaccccgccggcgtccccgctgctccagcaacggtcgccgtcgacggcgagc
ctggatgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgatacgctcgggccttcagcgatctgca
caaccagctgcacatcacgccggccacggcctaccagagcttcgaggacgtgatggacgaggtgttccgggacggcgtca
actggggccgcatcgtggggctgttcgccttcggcggggcgctgtgcgtggagtgcgtggacaaggagatgagtccgctg
gtgggcaggatcgtcgagtggatgacgctctacctggacaaccacattcagccctggatccagaaccagggaggctggcg
ttcagacatttga
>gnl|bcl2dbcds|G3P7B4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gasterosteus aculeatus GN=BCL2L1 (length=663 residues).
atggcgaacattaacagggagctggtggagttcttcctaagctacaagctgtctcagaagaaccacccaacctctctgtt
gaggccggaggatgccggcggaaggacggagggagacaaggccaactcggcgtccgttcctggacgcgggagcagcgccg
gccagccggggatgtcgtcgccaccgccgccaccgtccggtgacaccgaggccgtaaaggcagctcttcaggactctgcg
aatgagtttgagctgctcttcacgcaagcgttcagtgacctctccttgcagctagacgtcacccccgacacggcctacca
cagcttcaagagcgtgatggacgaggtgttcaaggatggcgtcaactggggccgcgtggtgggcctgtttgccttcggcg
gcgtgctctgcgtggagtgcgtagagaaggacatgaccgagctggtgtcccgcatcgcggactggatgaccacgtacctg
gacgagcacatcagtgcttggatccagagccagggaggatgggactgttttgctgacattttcgggcgggacggcgcggc
agcggcgaggagatctcaggagacgatgagaaggtggctgctcgtcggggtggcgctgctaatgggagtgctcgtcggta
tggtcatggtcaagaagcggtga
>gnl|bcl2dbcds|A0A8C4W8N7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gopherus evgoodei GN=BCL2L1 (length=873 residues).
atgaaatttacaagagcaaagccttctcaacacacagttctcaattggagctcctcaggagaggatataagaactagccc
aagcctgtttgctttcagaagctggtccgataggggcggtgaactgagatttcccaggccagagctttctcccagcagct
actctagaggattgtctgctcagggttcagatgtttgccttgactccagaggagagcagagtctggacctgctatcgcag
aggggatacagctggagtcggttcgaaggggaggatgagatcaggactgattctgcagaagaggctgagatggcaagtgt
ccctaatgggagtccatcctggcatcagggtgccagccacatagtgaatggggctgctgggcacagtaacagccttgaag
cccatgaaagggttccagcaactggagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagg
gctttcagtgacctcacttcccaactccacatcactcctggcacggcataccagagctttgagcaggtagtgaatgaact
cttccgggacggagtgaactgggggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgaca
aggagatgcaggtgttggttggacgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaa
gagaatggcggttgggagcggtttgtggatctctatgggaatgacgctgctgccaagagcaggaaaggccaggagcagtt
caacaggtggcttctgaccggggcgactctggcaggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=774 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatgggcttcctttgcccagatcttcggacaggacgcggctgccaa
ggcgaggaaagctcggaccagtatgaaacggtggttcttgtttggtgccgttgtgctcacaggagttctgtttctcgtct
gctacgtcaagagacgagaaccacacttatgggtcacatacctcacattgctgaacacagcgcctctgtcataccaggaa
atatttctgttggatggatgtaatataacctcctccagcatcccacattcctag
>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=606 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatggagaaccacacttatgggtcacatacctcacattgctgaaca
cagcgcctctgtcataccaggaaatatttctgttggatggatgtaa
>gnl|bcl2dbcds|A0A8C5D4L1_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=660 residues).
atggcgcccgtcaacagagaacttgtgaagttttttttgtgccaccgactggctcagagggactttcccacatccccgct
gaggctgcaggataccagggacaggacggtggtggagaaggaaaaggccagcccgactgccggtaacggcctccaggaca
gagacggggtgatcccacctcgccacggcgatgacgacgtggaggcggtgaagttggcgctcgtggagtcagccgacgag
tttgaactcctcttcacgcaagcgtttaacgacctggccacgcagctgcagatcacccccgacacggcctacagcagctt
caaaagcgtcatggacgaggtgttcaaggacggcgtcaactggggacgcatcgtgggcctttttgtcttcggaggtgtgt
tgtgcttggagtgttcagagaaggacatgagcgagctggtgccccgcattgcagactggatgaccatgtacctggatgag
aacatcaacgagtggatagagagcgaaggaggaggatgggcttcctttgcccagatcttcggacaggacgcggctgccaa
ggcgaggaaagctcggaccagtatgaaacggtggttcttgtttggtgccgttgtgctcacaggagttctgtttctcgtct
gctacgtcaagagacggtga
>gnl|bcl2dbcds|A0A8C5G971_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Gouania willdenowi GN=BCL2L1 (length=675 residues).
atgactcagaacagagaactggttgtgttctacatcacatacaaactgtctcagaggaactaccctctggaccacatagt
gctcaatgagcctccacacaggaccgctgggtcggacgcagagcccgcagaggatgagcggacggacacgcagtccaatg
gaactttgaacgcgtctccggtgcagcagcagaggttgccgtcagcgacaagcctggatgcggtgaaggaagccctccga
gacacagccaacgagtttgagctgcgctactcgctggctttcagtgacctgcacagccagctgcacatcacgccggccac
ggcctaccagagctttgagaacgtgatggacgaggtgttccgggacggcgtcaactggggtcgcattgtggggctctttg
catttggtggagcactgtgtgtagagtgtgtggagaaggagatgagtcctttggtgggcaggattgtggagtggatgacg
gtctacctggacaaccacattcagccctggatccagagccaagggggatgggaacgctttgctgaggtcttcgggcagga
tgcggtggctgagatccggcggtccgaggaatcttttaaaaagtggctgctggtggggatgacggtggtgaccggggtgg
tggtgggttcgctcttcgcacaaaaacgtctgtga
>gnl|bcl2dbcds|A0A3Q2X557_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Haplochromis burtoni GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggctaacgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccaactgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggatacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-05 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-06 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-07 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-08 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-09 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-10 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-11 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-12 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=603 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtgccagatgccagttttagattctggctccaccactga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-14 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggatacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A7I2V597_BCL2L1-15 BCL2-like 1 gene OS=[Eukaryota] Homo sapiens GN=BCL2L1 (length=924 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcagacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctggctggattggtggtgcttctgctcagctcaccttagagtaatcatcactgacggaggagactggggaggtcccatcc
ttcccctgggctcagctgggtccccagacctacacctgaaccccacgcctgtctggtgtttacggattgaagctgccacc
ctttgggacctatcctgttttcatttctgctctcagctctctggtctctgtggacctcacttacaggatacttttgtgga
actctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactg
tggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A4W5JPK5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcagtt
ggggctggagggtgcaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaacaacaggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggaggcagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcaaagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggttggcactctca
tcatgaagaaacgccagtga
>gnl|bcl2dbcds|A0A4W5LYF9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcaatt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtaagccttcttctcctcaggggggcattgaggcagtgaaagcagcactacgggactccgttgatgag
tttgagctacgctacacccgcgccttcagtgatctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtaaactggggtcgtgtggtgggcctgtttgctttcggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccccctggtgatgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagtcaaggaggatgggaccgttttgcattgatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaagaaaatggctgctagttggggtcatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A4W5NQ40_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=699 residues).
atgatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagggactaccccttcaacca
cattgagctcacggaagcccagaatcggactgaggggggacaggtggaagggggtgcggcagtcatgacatatgtcaacg
gcacagtgaacgggacgagtcccgggactccaccaccacagcagtcgcccccctcctcccctcggcggacagcaggcctg
gacgcagtgaaagaggcgttgcgggactctgccaatgagtttgagctgcgttatgccagagcgttcagtgacctgtcctc
ccagctacacatcacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtgaact
ggggacgggtggtgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtg
ggaaggatcacagactggatgactgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccg
gtttgcagagatctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcgg
ggatgacgctggttacaggagtcgtcgtagggtcactctttgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A4W5R2W6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactttcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgaggggggtgagaggggacaggtggaagggggggcggcagtcacgacac
accccaacggcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaatgagtttgagctgcgttatgccagagcgtttagtgacct
gtcctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgatggtg
tgaactggggacgggtggtgggcctgtttgcctttggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagccgagaacaggaagtctcaggagagctttaagaagtggttgc
tggcggggatgacgctggtcacaggagtcatcttagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A4W5R2W6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Hucho hucho GN=BCL2L1 (length=702 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactttcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgaggggggtgagaggggacaggtggaagggggggcggcagtcacgacacacc
ccaacggcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggc
ctggacgcagtgaaagaggcattgcgggactctgccaatgagtttgagctgcgttatgccagagcgtttagtgacctgtc
ctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgatggtgtga
actggggacgggtggtgggcctgtttgcctttggaggggccctctgtgtagagtgtgtggagaaggagatgagcccacta
gtgggacggattgcagactggatgacagtctacctggacaaccacatccagccctggatccagagccaaggaggatggga
ccggtttgcagagatctttgggaaggacgctgcagccgagaacaggaagtctcaggagagctttaagaagtggttgctgg
cggggatgacgctggtcacaggagtcatcttagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A287CZ07_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ictidomys tridecemlineatus GN=BCL2L1 (length=675 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcgataaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgtggtactggcgggcattcagtga
cctgacgtcccagctccacatcaccctggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcacattgtggcctttctctcctttggcggggcactgtgcatggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatgccttggatccaagagaacggcggctgggacacttttgtggaactctacag
gaataatgcggcagcagagagccggaagggccaggagcgcttcaaccgttggttcctgacgggcatgactgtggccggtg
tggttctgctgggctcacttttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C5NZI4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Jaculus jaculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctcacctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaacaggactgaggccccagaagggactgaatcagagatggagacccccagtgctatcaatggta
acccatcctggcacctggtggacagcccggctgtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
tctaacatcccagcttcatataaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggccttcttctccttcggcggggcactgtgtgtggaaagcgtagacaaggagatgcag
gtgttggtgagtcggattgcaagttggatgaccacgtacctgaatgaccacctggagccttggatccaggagaacggcgg
ctgggacacttttgtggagctctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C5JFI3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Junco hyemalis GN=BCL2L1 (length=1011 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcagccaccagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtgcacgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcaggggatgagttcgagctgaggtaccggcgggcgttcagcgacctcacctc
ccagctccacatcacccccagcacggcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccctgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagacccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgaggaaaggccaggagaccttcaacaaatggctcctgacgg
gggcgacagtggctgaggccaatgcagcacttcagccaccagctcccagcgctggggagatccaggcagctggcgggggg
cgcaggctagaaggtgtcccagccctgcagggttctccaaataatttggaagagaataaacagacttatttttgcatgtg
tgagtgcgtgcgtgtgtgtagatgtgtcactaatataaaagttccccagccagagcaagggtcaggctccgtgcccccgt
ctctggcacacacaggcaccagggagaggcaggagcttccctgcagcatccctatcctgtccttgcttctccagtcagag
ctcatccctgaggcagggggaggaagaggaggaggcagaggccagaggtga
>gnl|bcl2dbcds|A0A3Q3B3X5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L1 (length=699 residues).
atgtctcaaaacaaagaactggtgcttttctatattatgtataaactgtcacagagaaactatcctgtcaatcacataat
actcagtgatcctccgaatagaactgatgcaggggatgcagggttggaggacgcagagatgacagagacacacgccaatg
ggacttttaacgggactagtcctgggaccccgccggcgtccccactgaggcagcaaccgctgccgacgacggcgaacatg
gacaaggtgaaggaagctctccgggacacggcaaacgagttcgagctgcggtacgcccgcgctttcagcgacctgcacag
ccagctgcacatcacgcccggcaccgtctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcattgtggggctctttgcattcggcggagcgctgtgcgtcgagtgcgtcgagaaggagatgagtcacctggtg
gccaggattgtggagtggatgaccgtctacctggacaaccacattcagccttggattcagagtcaagggggatgggagcg
ctttgctgaaatcttcggcgacaacgcggcggctgaaagcagaatctctcaggagggtttaaagaagtggctgctggtgg
ggatgacggtggtgaccgcggtggtggcgggttcgctcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3Q3BEB7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Kryptolebias marmoratus GN=BCL2L1 (length=657 residues).
atgtcacacagcaacagagatctggtgcagttctacataagctataagttgtctcagaggaactgttcgaagtctctgct
gatgccggaggttgccggtgaaaggaccgagaaggccagctcggctcccagtaacggcttgctggtcaacagtagggacg
gccagtcggggaagaagatctggccccgccgcagcgacatagaggccgtaaaatcagctctgaaggactctgcggatgag
tttgagcgtctctacacgcaaagtttcagccacctgtccctgcagctcgacatcagccccgacacggtctaccacagctt
caagagcgtgctggacgagctgttcaaggacggggtgaactggggccgcgtggtgggcctgtttgccttcggcggcgtgc
tgtgcgttcagtgcgtcgagagggacatgagtgagctggtctcccgcattgcagactggatgaccgtttacctggatgag
cagatcggtccgtggatcgacagccagggaggatgggacagcttcgctgagatgtacgggcgagatgccgctgcagaagc
gaggaggtttcaggagtccctgaagaaatggctgctagctggagcggcgctgctggctgggctgcttctcggcgtgctcg
tggctaagaagcgttaa
>gnl|bcl2dbcds|A0A3Q3FUB6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=666 residues).
atgtcatacagtaacagagagctggtggagttcttcataagctacaaactgtctcagaggaactatccaacctatgtgct
gaggtcagaggatgctggtgaaaggactgagggagacatggaaaactctgctgccagtaatggctttttggtcaacagca
ggaaccgggccggccagtcagtgatgtcatcatccccacacaccgacatagaggctgtaaaggcagctcttctggactct
gcagatgagtttgagcttctctttacgcaggcctttagtgacctttcctcgcagcttgacattactcccaacacagccta
tcacagctttaagagtgtgatggacgaggttttcaaggatggagtcaactgggggcgtatagtaggcctgtttgcctttg
gcggtgtactgtgtgtggaatgcgtccagaaggatatgggtgaactggtttcccgcatcgcaggctggatgactacgtac
ctggatgagcacattagtgcatggatcgagagccagggaggatgggactgctttgttgaaattttcggacggggcgctgt
tggagaagtgaggagatctcgggaaactctcaccagatggctgctagttggaatggcgctgctaatgggagtcgtggttg
gtgtttacatcgctaagaaacattaa
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A3Q3G2E1_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Labrus bergylta GN=BCL2L1 (length=705 residues).
atgtctcaaaacagagaactagtggttttctacataacctataaattctctcagagaaattatcctcttaatcacatgga
actcttagagcctccaaacaggactgatggggcgggggcagggtcgggtgaggaacagcaggtagcgacgcacgccaacg
ggacttttaacggcacgagtcctggaacccccccagcgtccccacaccggcagcagcaacaacggttaccagcaacgacg
aatctggacgcggtgaaggaggccctccgggactcggccaacgagtttgagctgcgatatgccagcgccttcagcgatct
gcacaaccagctgcacatcacgccggccacaacccaccagagctttgagaacgtgatggacgaggtgttccgggacggag
tcaactggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgagtgcgtggagaaggagatgagtccc
ctcgttggcaggatcatagagtggatgactgtctacctggacaaccgaattcaaccttggatcgagagccaaggaggatg
ggagcgcttctctgaaatctttgggcaggatgcggcgggagagatcaggaggtctcaggagagtttcaaaaagtggctgc
tggcggggatgacgctggtgaccggggtcgtggtgggctcactcatcgcccagaaacgcctgtag
>gnl|bcl2dbcds|A0A4W6BQD5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctctcagagaaactatccactcaaccacatgga
actcaatgagcctccaaacaggactgatgggggggaggcagggtcaagtgaggaagagcggatagcaacacacgccaacg
gaacttttaacagcacgagtcctgggacccctccagcgtccccactgcggcagcaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttgcgatatgcccgcgccttcagcgatctgcacaa
ccagctgcacatcacgccggccacagcttaccaaagcttcgagaacgtgatggatgaagtgttccgggacggcgtcaact
ggggccgcatcatagggctttttgcgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtccactggtg
ggcaggatcgtggagtggatgacagtttacctggacaaccacattcagccctggatccagagtcaaggaggatgggagcg
ctttgcagaaatctttgggcaggatgcagcagcagagagcaggaggtcccaggagagcttcaagaagtggctgctggcgg
ggatgaccctggtgaccggggtcgtggtgggctcactgattgctcagaagcgcctgtga
>gnl|bcl2dbcds|A0A4W6EST2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lates calcarifer GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctagtggagttctttataagctacaagctttctcagaggaaccacccaacctctctgct
gaggccagaggatgctggtggaaggactgagggagataagaccaactcagctgccagtaacggcttgctggtcaacagca
gggacaggtgtggtcagcagggggcgccatcgcccctgcgtggtggcatagaggctgtaaaggcagctcttagggactct
gctgacgagtttgaactgctcttcacccaagcgttcagtgacctttcctcgcagcttgacatcactcctgacacagccta
ccacagctttaagagtgtgatggatgaggtgttcaaggatggtgtcaactggggacgtatagtgggtctgtttgcctttg
ggggtgtactgtgtgtggaatgtgtcgagaagaatatgagtgagctggtttcccgcattgcagactggatgaccatgtac
ctggatgagcgcatcagtccgtggattcagagccaaggaggctgggactgctttgctgagatttttgggcaagacgcagc
tgcagaagcgaggagatctcgggagactatgaggagatggctgctagttggagtggcgctgctaacaggagtgctggtcg
gtgtcctcgtcgctaagaaacagtga
>gnl|bcl2dbcds|A0A8C5RX62_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Laticauda laticaudata GN=BCL2L1 (length=684 residues).
atgtcgagcggcaaccggtccctggtggtggacttcattgcctacaagctggcgcagcggggccacagctggcgcgagat
cgagggtgacggcgaggagcggacagagctgtccggcgagatgggcggtagcagcggtgtcctgaatggtgggagcccct
cctggcaccccagccccagcccggtggtcaacggggcagccagcattcacccggctctgctggaagagctgagcgacggc
ccccaggcggcggtgaggcagacgctgcgggaagctggggacgagttcgaactgcgctaccggcgggcctttagcgacct
gacctcacagctccacatcaccctgggcacggcttaccagagcttcgagcaagtggtgaacgaacttttccgggacgggg
tgaactgggggcggattgtggcctttttctccttcggaggggccctgtgcgtggagagcgtcgacaaggaaatgcggggg
ctggtgggaaggatcgccacctggatggccacgtacctgacggagcacctggacccctggattcaagacaacggaggctg
ggtaagtctttggctaaacttgcagggtaagggtctccagagagtcttcagcctttggggtaaaaccctccgtctggcat
ttctgtcggggggggggagatgcagggagggcgtgtggggttga
>gnl|bcl2dbcds|H3ANS8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Latimeria chalumnae GN=BCL2L1 (length=720 residues).
aaaatgtccttcaacaggttgctggtggtggaccatatatcccagaagctgatgcagcggggataccagtggagggaggt
tggtgagcaggaccacggtggtggaggagaccgcgcgagggaagcacagactcccgaggagggggccattccaggcatgg
acccacccaacggcagccaccctcatgcaggactcaatggtgcggttaacgggttgccggctggcagcagcagccgcctg
gaagcccaggcggtgtcggggcccgaagccgtgaaacggacattgcgagaggccggggaagagtttgagctgaggtatag
ccgagcattcagtgacctctcttcccagctccacatcacccccggcacagcctaccagagctttgaacaggtggtgaacg
aactcttccgggacggagtgaactgggggcgcgtggtggctttctttgcctttggaggggcgttgtgtgtggagagtatg
gacaaggagatgtcttcactagtagagcggatcgctgagtggatgacgacttacctagatgataacttaaacccttggat
tcaggaacaaggaggatgggcaaccataatacacattgacggggttgacgctatgcagcgctcaaacaccaggagtgaaa
aattgggttttgttgggttttttttttcctttcttctgcgtggggtggaaagaaacctcaaactctttttgcgcaaatga
>gnl|bcl2dbcds|E2IV76_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lemur catta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagggactgaatcggagatggaaacccccagtgccattaatggca
acccatcctggcacctggcagacagccctccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccctatggcagcagtgaagcaagcactgaaggaggcgggcgatgagtttgaacttcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctatgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|W5MG74_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lepisosteus oculatus GN=BCL2L1 (length=669 residues).
aagatgtcatacagcaacagagacctcgtcgtctactacatcaactataaactctcgcagaagaactactcctgggacca
gttcagcctggagggcaggaccggaggcgctgaggcggtgggttcggggagcccgaacgcagaggagcgtacgaacggcg
cggccaatggcgggggggggcccgtgtcgcgccagcccccccaggggatcgaggcggtgcagggggcgctgcgcgactcc
gccaacgagtttgagctccgctacggccgggcgttcagcgacctgtcctcccagctccacatcacgcccgccaccgccta
ccagagcttcgagcacgtcatggacgaggtcttccgggacggggtgaactgggggcgcatcgtggggctcttcgctttcg
ggggtgcgctgtgcgtggagtgcgtggagaaggagatgagcaacctggtgagccgcatagccgagtggatgaccgtctac
ctggacaacaacattcagccctggatccagagtcagggaggatgggacaggtttgcggagatctttggcaaggatgcggc
tgcggagtaccggagatcacaggagagcttcaagaagtggctgctggcgggcatgactctggttacggggctggtggtgg
gctcctacatcgccaagaaacgcttatag
>gnl|bcl2dbcds|A0A8C5WFB8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Leptobrachium leishanense GN=BCL2L1 (length=627 residues).
atggaaggtggaaataagaacctcgtgcaaaattttgtatgtaagaaattgtcccagagagatttcacatggaattgctg
cacagactcacattctgaggttctatctaatgggacatctcctggggagcagcctgccgcacgcgcaggaggacattctg
gaagcactgaaagtgaagctgtcctgcaagctctgctggacgcctcagaggagtttgagctgagatatcagcgggcgttt
agtgacctgacctcccagttgcacatcacccctgagacggcatatcagagcttcgagcaggtcgtgggggagctgtttag
agatgggacaaactgggggcgaatcgtagctttcttctcatttggaggggccctctgtgtcgaaagcgtccacaaggaga
tggaagatctgttgcctaggattgtccagtggatgaccacctatctggataatcagttggaagactggatccaaacgaac
gaaggctgggaagcattcgtgcgcctttacgggaatgatgcagctgccagcagcaggaaaagtcaggaacgcttcggccg
atggcttctgactggggtcacgctggctggaattatcctgcttatttcctacatggcccgcagatag
>gnl|bcl2dbcds|Q4U2V6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lonchura striata GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|G3SPN0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Loxodonta africana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagttggagtcagtt
tagtgatgtggaggagaataggactggggcctcggaaggcactgaatccgagatggagatccccagtgccatcaatggca
acccatcccggcacctggcagacagccctgcggtgaatggagctactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctctgagggaggcaggcgatgagttcgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaaggaccacgccccttttgtgcttcagtacctcagtgaaggaagacatagcctatgtgttcattcaggtcaaaa
cctatgcaagtgggaagttagtccagtgtttcctcaccctgacacaatggttcaccacccaa
>gnl|bcl2dbcds|A0A667HK09_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Lynx canadensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5VPG2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|I7GKS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=447 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctggcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtc
gcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcgg
atcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgt
ggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatga
ctgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|Q2PFS6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca fascicularis GN=BCL2L1 (length=570 residues).
atggagacccccagtgccatcaatggcaacccatcctggcacctggtggacagccccgcggtgaatggagccactggcca
cagcagcagtttggatgcccgggaggtgatccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttg
aactgcggtaccggcgggcgttcagtgacctgacatcccagctccacatcaccccagggacagcatatcagagctttgaa
caagtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtg
cgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacc
tagagccttggatccaggagaacggcggctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccga
aagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcag
tcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A5F7ZJK5_BCL2L1-05 BCL2-like 1 gene OS=[Eukaryota] Macaca mulatta GN=BCL2L1 (length=666 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctggagtcttgctgtgtcgcccaggctgaagttcagtggcgcaatctcagctcactacaagctccgcctcccgtgttcac
gccattctcctgcctcagcctcctga
>gnl|bcl2dbcds|A0A8C5U1E1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Malurus cyaneus samueli GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgacatggacggtgtcctcaatgggagcccctcct
ggcacgcacccaccagccacatagtgaacggagccaccgtgcaccggagcagcctcgaagtccatgagatccgtcgagca
gccgacgtgaggcaggcactgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctcttttggtggagccttgtgcgtggagagtgttgtcaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgacag
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=513 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctatggga
acaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccggcgtg
gttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K5YR37_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Mandrillus leucophaeus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C5YLY6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Marmota marmota marmota GN=BCL2L1 (length=606 residues).
atagagagttgtggtaggacaggaaggaacctggaactagtgatggactttctgtcctacaagctttcccagaaaggata
ccgctggagccagtttagccgtgaggaagagaaccgcgttcaagccccagaaagggctgaatcagaagaggggcccagca
atgccaccagcggcaacccatcccggcatcagggggacagtcccatggtgagtggagccgctggccataacaggagtttg
gatgcccccgacgtggtccccatggtagcagtgaagcaagcgatgagggaggcaggcgacaactttgaagggcggtaccg
gcaggcattccatgacctgacagcagagctccgcctcaccccggagacagcacatcacacttttgaacaggtagtggacg
aactcttccgggatgaggtaagctggggtcgcattgtggcctttttcttctttggaggagcactgtgcttggaaagcata
gacaaggagatgaaggtgttggtgtgtcagatcgcaagttggatgaccacttacctgaatgatcacctagatacttggat
ccaggaccacggcggctgggacacttttctggcttgtcttatctga
>gnl|bcl2dbcds|A0A3Q3MX20_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagggaactggtggttttctacataaaatataaactctcccagagaaactatcctctcatctacataga
actcaatgagcaacagaacaggactgatgggggagaggctgagtcaggtgaggaacagcggatagcaacgcatgccaacg
ggacttttaatggcacaagtcctgggacccccccagcgtccccgctgcgacaagaacatttgcagtccacggcaagcctg
gatgcagtgaaagaggccctccgggactcagccaacgagtttgagctacgatacgcccgtgctttcagcgatctgcacaa
ccagctgcatatcacgccagccacggcctaccaaagcttcgagagtgtgatggatgaagtgttccgggacggtgtcaact
ggggtcgcatcatagggctttttgcattcggcggggctctgtgtgtcgagtgtgtggagaaggagatgagtccactggtg
ggcaggattgtggagtggatgaccctctacctggacaaccacattgagccctggatccaaagccagggaggatgggagca
ctttgctgaaatctttgggcaggatgcagcagcagagagcaggaggtcccaagagaatttcaagaagtggctgctggcag
ggatgacgctggtgactggggtcgtggtgggttcacttattgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3NFM4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mastacembelus armatus GN=BCL2L1 (length=666 residues).
atgtcgtacagtaacagagagctggtggagttctttattagctacaagctgtctcagaagaactacccgacctctctgct
gaggccagaagatgctggtggaaggacagagggagacatgaccggtgcagctgccaccaacggcttgctggtcaacagca
ggtatgtcagcggccggccggggatgtcatcatccccacatggaggcgtagaggctgtaaaggcagctcttagggactcc
gctgaagagtttgaactgctcttcactcaggcgtttagtgacctttcctcacagcttgacatcactcctgacacagctta
ccacagctttaaaagcgtgatggatgaggtgttcaaggatggagtcaactggggacgcatagtgggcctgtttgctttcg
gtggtgtactgtgtgtggaatgcattgagaagaacatgagtgcgctggtgtcccgcatcgcagattggatgaccatgtat
ctggatgagcacatcagtccgtggatcgagagccaaggaggctgggactgctttgctgagatttttgggcgagatgcagc
tgcagaagcaaggagatcacaggaaaccctgaggaggtggctgctagttggagtggcgctgctaacgggagtgctgatag
gtgtgctcatcgctaagaaacagtga
>gnl|bcl2dbcds|A0A3P9D632_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Maylandia zebra GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9D632_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Maylandia zebra GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|G1N5N5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Meleagris gallopavo GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccgcctgccggccacgtagtgaatggagccgccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcagacgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgatctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaacgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagacccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtatgggaataatgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tattgatgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcaggcgatgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcactctagcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8B7FNN3_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Microcebus murinus GN=BCL2L1 (length=438 residues).
atgcagaagaaaataggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggcaaccca
tcctgcgacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggccctgtgcgtggaaagcgtggacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacactttcgtggaactcta
cgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggttcctgacaggcatgactgtggctg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8F0MQ26_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Miichthys miiuy GN=BCL2L1 (length=699 residues).
atgactcaaaacagagaactggtgattttctatataaactataaactctcccagaggaactatcctctcaactacatggg
actcagagagcctccgaacaggactgatgaaggggaggctggggtgggtgaggaacagcgggtagcaacgcacgccaacg
ggacttttaacggcacgagtcccggtacccctccaggatccccgccgcggcagcaacagccggcgtcagcgacgagcatg
gacgcggtgaaagaagccctccgggaatcggccaacgagttcgagctgcgatacgcccgcgccttcaacgacctgcacaa
ccagctccacatcacgccggctacagcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggagtcaact
ggggccgcatcgtggggctgttcgctttcggcggggcgctgtgcgtcgagtgcgtggagaaggagatgagcccgctggtc
agcaggattatcgagtggatgacggtctacctagacatccgcattcagccgtggatccagagccaaggaggatgggagcg
cttcgccgaaatcttcgggcaggacgcggcggcggagggcaggaggtctcaggagagcttcaagaagtggctgctggcgg
ggatgaccctggtgaccggggtcgtggtgggctcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3WIW8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mola mola GN=BCL2L1 (length=693 residues).
atgtctgtaaacagagaactggtggcttactacataaactataaactctcccatagaggctgtcctctcaaccacatggg
actcatagagcctcccaacaggactgagggggggcaggcagtgtcagatgaggaacagcgggtagcgacacacgccaatg
ggacttttaacggtacgagtcccgggacccctccaaggtccccgctgcggctgcaaccgtcgacaacaagtctggacgca
gtaaaagatgccctgcgggactctgccaacgagttcgagctgcggtatgcccgcgccttcagtgacctgcacaaccagct
ccacatcacaccggccaccgcctaccaaagctttgagaacgtgatggacgaggtgttcagggacggtgtcaactggggac
gcatagtcggactcttcgctttcggcggtgcactgtgcgtagagtgcgttgagaaggagatgagtccactggtgggcagg
atcatcgagtggatgacggtctatctggacaaccaaatccagccctggatcgagagccagggaggatggcaacgctttgc
cgaaatcttcggacaggacgcggctgctgagagcaggaggtctcaggagagcttcaagaagtggctgctggccgggatga
ccctggtgaccggagtcgtggttggctcgctcattgtccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q3X5M5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mola mola GN=BCL2L1 (length=657 residues).
atgtcgcacagtaacagagagctggtggagttctttataagctacaaactgactcaaaagaactacccaacctctctgtt
aaggccagaagataccggtgggaggactgaaggagacaaggccagctctgctgccagaaatggcttgctggtcaacagca
gtagtaggggtggactgtctccttccacaggtgctgacatggaggctgttaagtcggcgcttagggactcagccaatgag
tttgagcagctcttcacacaagcgttcagtgacctctcctcgcagcttgacatcacccctgacacagcctatcacagttt
taagagcgtgatggacgaggtgttcaaggacggggtcaactggggacgtatagtgggactgtttgcctttggaggtgttc
tatgtgtggaatgtgctgagaaggatacaggtgagcttgtttgccgcattgcagactggatgaccacttacctggatgag
catattaatccgtggatccagagtcaaggtggatggggctgctttgctgaggtttttgggcacaacgccgctgcagaagc
aaggagatctcaggagactctgaatagatggctcctagtcggggtggcgctgctaatgggagttatggtcggtgtgttca
ttgctaagaaacagtaa
>gnl|bcl2dbcds|F6WA14_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodelphis domestica GN=BCL2L1 (length=684 residues).
atgtcgcacagtaaccgggagctggtgattgactttctttcttacaagctctcacagaaaggatacaattggagtcagtt
tgaagatgagaacaggactgaggttctagaaggggcagagatacctagtactgtgaatggcagtccctcttggcaccctg
ctgacagccgtgctgtgagtggggccacagggcacagcagcagcctggatgcccatgagacaataccagtggctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaacttcggtacaggcgggcattcagtgacctgacatcccagctcca
catcacgccaggaacagcttatcagagctttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaggagatggaagtcttggtaggacgcatc
acctcctggatggccacttacttggatgaccacctagacccttggatccaagaaaatggcggctgggacacctttgtgga
actttatgggaatgatgcagctgcagagagccggaagggccaggaacgcttcaaccgatggctgctgactggcatgacag
tggccggtgtagtcctgctggggtccctattcagccggaagtga
>gnl|bcl2dbcds|A0A8C6F2V6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Monodon monoceros GN=BCL2L1 (length=702 residues).
atgtctcagagcaatcgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggacgagaacagaactgaggccccagaagggactgaatcagacatggaaacccccagtgccatcaatggca
acccgtcctggcacctggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacggcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C6DX24_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagaaaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcctggcacctggcggatagccctgcggtgaatggagccactggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggtgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaacgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgcttggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C6FN58_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L1 (length=738 residues).
atgtctcagagcaactgggaactagtggttgactttctctcttacaagctttcccagaaaggatacatctggagtcagtt
tagtgatatggaagagaacagaactgagaccacagaagggacagaatcagatatggaaaccctaaaagccatcaatggca
acccatcctggcacctagcagatagccctgcagtgaagggagccactggccacagcagaagcttggacgcccggaaaatg
atccctgtgacaacagtaaagcaagccctggggcaggcaagcaatgagtttgaactgaggtaccaacagacattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtaataaatgaactcctccgggacg
gggtgagctggagtcgcattgtggcctttttctccttcggtggggcattatgcatgaaaagcatagacaaggagatgcag
gtattggtgagtcaggtcacaacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacacttttgtggaactctacgaaaacaatacagcaaccgagagccagaagggccaagagcgcttcagctgctggt
ccctgatggacatgactgtgtggtatggttctgctgggcttgcttttcaactcataataactattccttttgttatagtc
attcaaattttatactag
>gnl|bcl2dbcds|O35843_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=708 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgttgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctggggtgtgagtggaggtacacccctcagatctgtcttcagaaggcttgttcaagtgccaggagtggcggagcacgttt
gtgatcccagcctttgggaggtggaaacagaaggatcggaagttcaaggccctcctcagctattatag
>gnl|bcl2dbcds|Q5HZH3_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Mus musculus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagaaactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagcccggccgtgaatggagccactggccacagcagcagtttggatgcgcgggaggtg
attcccatggcagcagtgaagcaagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggaccgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A8C6G6C7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mus spicilegus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtcgaagagaataggactgaggccccagaagacactgaagcagagagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgccgtgaatggagccactggccacagcagcagtttggatgcacgggaggtg
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcgttcagtga
tctaacatcccagcttcacataaccccagggactgcgtatcagagctttgagcaggtagtgaatgaactctttcgggatg
gagtaaactggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|M3Z2H9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mustela putorius furo GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatctcagcttcacatcaccccagggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgtgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|G1P9D2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myotis lucifugus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggaactggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccctgcggtgaatggagccactggccacagcagtagcttggatgcccgggaggtg
attcccatggcagcggtgaagcaagcgctgagggaggcaggcgacgagtttgaactgaggtaccggcgggcgttcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgagcaagtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctcgttcggtggggcattgtgcgtggaaagtgtggacaaggagatgcag
gtattggtgagtcggattgcaacgtggatggccacttacctgaatgaccacctagagccttggatccaggagaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggaacgcttcaatcgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A667Y1V0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myripristis murdjan GN=BCL2L1 (length=669 residues).
atgtcatacagtaacagagaactggtggttttctttataaactataaactgtctcagaggaactatcccacttgtcagct
ggggctggaggaggccagcgaaaggactgagggagacgacgccgacgccgtcatctctaatggctcactggccaacagca
ggaccggcgccggccagccggggacgccgtcgcctccgtacggcggcatagaggtcgttaaggctgcgcttcaggaatcg
gcggatgagtttgaactgcgctacacgcaggcgttcagcagcctctcctcccagctccacatcacccccgccacagccta
ccacagctttgagagcgtaatggacgaggtgtttcggaacggagtcaactgggggcgggtggtgggcctgtttgccttcg
ggggcgccctctgtgtggagtgtgtggagagggatatgaaccagctggtgccccgcattgcagactggatgaccacgtac
cttgataaccacattgagccatggatccagagggaaggaggctgggaccgcttcgctgagatttacgggcgagacgccgc
tgcagaggcgaggagagctcaggagagtctaaggagatggctgctggttggcgtggtgctgctcacaggcgtgctgctcg
gcgctctcatcgcaaagaaacatccctga
>gnl|bcl2dbcds|A0A667ZHE8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Myripristis murdjan GN=BCL2L1 (length=699 residues).
atgtcccaaaacagagaactggtggttttctacataacctataaactctcccagaggaactatcctttcaaccacatcgg
gctcatagagtccccaaacaggactgatggggggcaggcaggggcggccgaggaacagcgggtagcgacacatgccaacg
ggacactcaacggcacgagtccgggcaccccgccggcatcgcccttgcggcgggagcggtcggcgtccacgacgagcctg
gacgcggtgaaggaggccctgcgggactcggccaacgagttcgagctgcgttacgcccgcgccttcaacgacttgcacga
ccagctgcacatcacgccggccacggcctaccagagcttcgagagcgtgatggatgaggtgttccgggacggcgtcaact
ggggacgcgtggtcgggctgttcgcgttcggcggcgcgctgtgcgtcgagtgcgtggagaaggagatgagtccgctggtg
tcaaggatcgccgagtggatgacagtctacctggacaaccacatccagccctggatccacagccaaggaggatgggaacg
ctttgccgagatctacgggcaggacgcggcggcagagggcaggagggctcaggagagcttcaggaagtggctgctggccg
ggatgaccctggtcaccggagtcgtcgtggggtcgcttatcgcccagaagcgcctgtga
>gnl|bcl2dbcds|R4JQR8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Mytilus galloprovincialis GN=BCL2L1 (length=558 residues).
atgaaccagtttagttcaagatatttagtggcagactttattaatgaccgacttcgaaaacatggaatgcgatgggacaa
ctgtcctacgttagacttgccaccatcacaaattcagcttaaattacgttcacttggagatgaattccaagaaagatttc
agactcagtttgacgatatggtcaatcagttacacataactgaggctactgcatatccaacgtttcaaagagttgttcag
gaattatttattgatggaaatattaactggggaaggattgtggctcttttcggttttggtgggtctttgtcagtgaaatg
tgtacaaagaggaatgccacaacttgtggattcaattgttgactgggtatctacctatttgtgtaatagtttagagcaat
ggattacagataacggtggttggcaaggatttgtggaagcctataaccaaggacagaatcataatgacagtccgtgggat
gtgaaaggacttgttaaatacggagcaataggtgtaataggcgcaatggcgttaagtgcttttctacatagaacgtga
>gnl|bcl2dbcds|A0A8C6V6T2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Naja naja GN=BCL2L1 (length=1068 residues).
atgacaaggaggatcagccagtgcctggaacgctttgcctgcctgcctgcctcctccacattctcaacatttgctccgcc
gcgcacagctccctctgctgagatctcttccccctgcttgaagccaactaactgctccttttccagggcgccattcccgg
ggaggttggtgcctgtagccgggacgggcagggggttccatgcatcgcctgcccccttcttggaatgcgactcaccggat
gactcatcgccgagtttccgcgcctggcgctgggatggccgtgcccgaagcggaagggcaccgcgtcctcctacggtaag
caggacggctgaggctgcagaccatggactcactgagacgggcagaggtgtgaaaatgtcgagcggcaaccggtccctgg
tggtggacttcattgcctacaagctggcgcagcggggccacagctggcgcgagatccagggcgacagcgaggagcggacg
gagctgtccggcgagatgggcagcggcgtcctgaacggcgggagcccctcctggcaccccagccccagcccggtggtcaa
cggggcagccggcattcacccggctctcctggaagagctgggcgacggcccccaggcggcggtgaggcagacgctgcggg
aagccggggacgagttcgaactgcgctaccggcgggcctttagcgacctgacctcacagctccacatcacccccggcacg
gcttaccagagcttcgagcaggtggtgaacgaacttttccgggacggggtgaactgggggcggattgtggcctttttctc
cttcggaggggccctgtgcgtggaaagcgtcgacaaggaaatgcacggcttggtggagaggatcgccacctggatggcca
cgtacctgacggaacacctggacccctggattcaagacaacggaggctgggagcgttttgtggatctctacgggaacgac
gcggccgccaagagccggaagggccaggagcgcttcaacaagtggctgtggacgggggccaccgtggccggcgtggtcct
cctgggctccctgctgagccgcaaatag
>gnl|bcl2dbcds|A0A8C6W748_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nannospalax galili GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcgtacaagctttcccagaaaggatacagctggagtcagtt
cagtgatgtcgaagagaacaggactgaggccccagaaggaactgaatcagagagggagacccccagtgccatcaatggca
acccatcctggcatctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggagctg
atccccatggttgcagtgaagcaagcgctaagagaggctggggatgagtttgaactgcggtaccggcgggcattcagtga
cctaacatcccagcttcatataaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatg
gggtaaactggggtcgcattgtggcctttttctcctttggcggtgcactgtgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaacgcagcagctgagagtcggaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttcttctgggttcactctttagccggaagtga
>gnl|bcl2dbcds|A0A8C6UPI9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neogobius melanostomus GN=BCL2L1 (length=621 residues).
ataatgtctcacagtaatcgagagctggttgagttcttcctaagttacaagttaacacagaaaaactacccatgctctct
gctcatgtcagactctgctcgggttcaatctgatggaaacaaggcagcttgtgtcctgaacggtctgctgtctaacccca
atggcagtagacgaactctgagctcccagtctcatgatcacatagaggatgttaagactgcactccgggactctgcagat
gaatttgaagagctgttcacacaagcattcagcaacctctcctcccaacttgacatcactcctgatacagcttatcacag
ctttaaaagcgtcatggacgaggtgttcaaagatggggtcaattggggacgcatatgtgtagaaaaggacatgagcaatc
tggttcctcgcatcgctgactggatgactatctacctggatgagaatatcgcctcatggatccaaagccaagggggctgg
gactgttttgcgcaaatctttgggcagaatgctgctgcagaggccaggagatctcgggagactctgaagaaatggctgct
agttggagtggggttgctaacaggtgtgctggtcgctatgctcatcgctaggaaacagtga
>gnl|bcl2dbcds|A0A3Q4N4B5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neolamprologus brichardi GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggctttttgcgttcggtggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcacttcgctgaaatctttgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgtcgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7BPR9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Neovison vison GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctaagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatctcagcttcacatcacccccgggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgcgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C7BPR9_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Neovison vison GN=BCL2L1 (length=666 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgcagaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtaaagcaagcgctaagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatctcagcttcacatcacccccgggacagcgtatcagagctttgagcaggtggtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggctctgtgcgtggagagcgtagacaaggagatgcag
gcattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggtccggactggcttattttaccccgagttcctggcacacggcctgaggttgggtaagggcttagccagcatctgct
cagtgaacatgaagggttattattag
>gnl|bcl2dbcds|G1RER8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nomascus leucogenys GN=BCL2L1 (length=651 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggc
>gnl|bcl2dbcds|A0A1A7ZDF6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L1 (length=702 residues).
atgtctcaaaaccaagaactagttcttttctatattagatataaactgtcacagaggaactatcccctcaaccacatagt
cctcaatgaccccctaaacaggactggtgcgggggatgcggtggtggggggtgaggaggagaggacagagacacacgcca
atgggacctttaacaggacgagtcccgggaccccagcggcgtccccgctacggcagcagccgccggcgtccacgacggac
atggaccgggtgaaagaggccctccgagacacggccaacgagttcgagctgcgatacgcccgcgccttcaacgacctgca
cagccagctgcacatcacgcccgccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtca
actgggggcgcatcgtgggactcttcgcgttcggcggcgcgctgtgtgtagagtgcgtggagaaggagatgagtcccctg
gtggtcaggatcgtggagtggatgaccgtctacctggacaaccacattcagccctggatccagagtcagggaggatggga
gcgcttcgccgacatctttgggcacgacgcggcggctgaaagcaggaggttccaggagagctttaggatgtggctgctgg
tgggaatgaccgtgctcacggcggtcgtggcaggctcgctgttcgcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A1A8A2S0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothobranchius furzeri GN=BCL2L1 (length=660 residues).
atgccacacagtaacagagagctggtggagtactacatcagctacaagttgtcccaaaggaactgtcccatgtctctgct
ggggccagaggatgggggtaagaagactcgggaggactgggacaattcagctgctagcaatggccggctggtcagcagca
gggacagcccaccagggaagacttgtgccccccgtggtggcatggaggcagtgaaatcagctctaaaggactcagcagat
gagtttgaacttttatacgcacagagttttagtcacctttccctgcagctcgatatcacgccagacacggcctaccacag
cttcaagagcgtgctggacgagctgttcagagatggggtaaactggggacgggtggtgggcctctttgtctttggggggt
tgctgtgtgtgcagtgtaaggagaggaatttaagcgagctggttccccgcattgcagactggatgaccacctacctggat
gatcagatcgggctgtggatcagcagccaaggaggatgggactgttttgcagagatttatgggcgaggagctgcggcaga
ggcaaggaggttccaggagaccctgaagaagtggctgttagcaggagtgctgctgctgtcaggggtgctgctcggtgtgc
tcattgcaaagaaacggtga
>gnl|bcl2dbcds|A0A8C7ECQ9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Nothoprocta perdicaria GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagctctcgcagaaggggtacagctggagtcagct
gcaggaggaggatgagaacaggactgactttgcggtagaccccgaggtggacggcgtcctcaacgggagcccgtcctggc
accccccgggcagccacatagtaaacggagccgctgtgcacaggagcagccccgaagtccgcgagatcgtccacgccgcc
gacgtgaggcaggcgctgaaagaggcgggggacgagtttgagctgaggtaccggcgagcgttcagcgacctcacctcgca
gctccacatcacccccggcacggcctaccagagcttcgagcaggtggtgaacgaactgttccgcgacggcgtcaactggg
gccgcatcgtggctttcttctccttcggcggggcgctgtgcgtggagagcgttgacaaggagatgcgggtattggtggga
cgcattgtagcttggatgaccacgtacttgaccgaccatctagatccctggatccaagagaacggcggatgggagcggtt
cgtggacctctacgggaatgatgctgctgccgagatgaggaagggccaggagagcttcaacaaatggctcctgaccgggg
ccaccgtggccggggtgcttctgctgggctccctgctgagccgcaagtga
>gnl|bcl2dbcds|C3VIT1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Odontesthes bonariensis GN=BCL2L1 (length=708 residues).
atgtctcaaaacagagaactggtggttttctacataaagtataaactctcccagagaaactatcctctcaaccacatagt
gctcaatgagcctccgaacaggactggtgccggggacgggggtctgggcgaggagcagagcacagagacgcacgccaacg
ggacttttaccgggaccagtcccgggaccccgccggtgtcccctctgaggcagcaaccgttgccgtcgacgacgacgacg
acgcgcctggacgcggtgaaagaggccctccgagacacggccaacgagttcgagctgcggtacgcccgcgccttcagcga
cctccacagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacg
gcgtcaactggggtcgcatcgtggggcttttcgctttcggcggggcgctgtgcgtggagtgcgtggagagggagatgagc
cccttggtgggcaggatcgtggagtggatgacggtctacctggacaaccacattcagccctggatccagagccagggagg
atgggaacgcttcgctgagatcttcgggcaggacgcggcggccgaaagcaggaggtctcaggagagcttcaagaagtggc
tgctggtggggatgaccgtggtgaccggggtggtggtgggctcgctgttcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7CBC7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgtgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C7CBC7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=837 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgtgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacatacattctttccaaatggacacttta
cataacattgaagattctaaaatattgtttttatttagtgtgctccaagaagttaaaccaaacctgttttcatttgacat
tttctttaagtgttccgttccttccttgctgtgctga
>gnl|bcl2dbcds|A0A8C7FX38_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtagtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaactactggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggtggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagattggatgaccacatacctggacaac
catatccagccctggatccagagccaaggaggatgggaccattttgcagagatctttggcagagatgctgctgcagatgt
tcgacggtcccaggagaacataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
>gnl|bcl2dbcds|A0A8C7IJ10_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=693 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgaggggggacaggtggaagggggggcggcagtcacgacacaccccaatggca
cagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggacgca
gtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagct
acacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggggac
gtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccactagtgggacgg
attgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatgggaccggtttgc
agagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgcttgctgggatga
cactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7IJ10_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=696 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgaggggggacaggtggaagggggggcggcagtcacgacacaccccaatg
gcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggac
gcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctccca
gctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggg
gacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccactagtggga
cggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatgggaccggtt
tgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgcttgctggga
tgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7J9N8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus kisutch GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtatactatatcacctataaactatcacagagggactaccccttcaacca
catggagctcacagaagcccagaatcggactgagggggggcaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttctggcggggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A060XE41_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgacggagatgaggccattgcaaatgggtctgtggggaactaccggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctacgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggatgaccacctatctggacaac
catatccagccctggatccagagccaaggcggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
>gnl|bcl2dbcds|A0A286MU87_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgacggagatgaggccattgcaaatgggtctgtggggaactaccggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgag
tttgagctacgctacacccgtgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggatgaccacctatctggacaac
catatccagccctggatccagagccaaggcggatgggcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|A0A8C7P574_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacac
accccaacggcacagtgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtg
tgaactggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
ttgcggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C7RD80_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggggatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgcattcagtgatctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagtgtgatggatgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccatagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C7UB69_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus mykiss GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactagtggtatactatatcacctataaactatcacagagggactaccccttcaacca
catggagctcacagaagcccagaatcggactgaggggggacaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagacctttaagaagtggcttctggcggggatgaccctgt
tcacaggagttgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8D057_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=702 residues).
atgtgtattaacctacctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacacacc
ccaatggcacagtgaacgggacgagtcctgggactccaccgcgacagtctccccccttgtcccctcagcggacaatgggc
ctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtc
ctcccagctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtga
actggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagcccacta
gtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatggga
ccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgctgg
cggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8D057_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=705 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgagggggatgaggggggacaggtggaagggggggcggcagtcacgacac
accccaatggcacagtgaacgggacgagtcctgggactccaccgcgacagtctccccccttgtcccctcagcggacaatg
ggcctggacgcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacct
gtcctcccagctacacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtg
tgaactggggacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaggagatgagccca
ctagtgggacggattgcagactggatgactgtatacctggacaaccacattcagccctggatccagagccaaggaggatg
ggaccggtttgcagagatctttgggaaggacgctgcagctgagagcaggaagtctcaggagagctttaagaagtggttgc
tggcggggatgacactggttacaggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8FJG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtatactatatcacctataaactatcacagagggactaccctttcaacca
catggagctcacagaagcccagaattgtactgagggggggcaggtggaagggggtgcggcagtcatgacatacgtcaacg
ggacgagtcccggtactcctccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagctttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctatcagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgtttgctttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggtaggatcaca
gactggatgaccgtctatctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgccgagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggtttctggcggggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C8GSY4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggagatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatctttggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A8C8GSY4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=720 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtggacggactgagggagatgaagccattgcaaatgggtctttggggaacaacaggaacggca
gaagcaatttgggtatgccttcctctgcacaagggggaattgaggcggtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctgctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggcctgtttgcttttggcggggccc
tgtgtgttgagtgtgttgagaaggatatgagccacctggtgacgcgcatcgcagactggatggccacctacctggacaac
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatctttggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaaaaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtttgtgtgttaccctgtataccctaggaccaactacatacattctttccaaatggacacttga
>gnl|bcl2dbcds|A0A8C8J941_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oncorhynchus tshawytscha GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacagactgagggagatgaggccatttcaaatgggtctgtggggaactactggaacagca
gaagcaatttggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcggtggatgag
tttgagctgcgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccatagctt
tgagagtgtgatggacgaagtgttcagggacggtgtcaactggggtcgcgtggtgggtctgtttgctttcggcggggcct
tgtgtgttgagtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagattggatgaccacatacctggataac
catatccagccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgt
tcgacggtcccaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctca
tcatgaagaaacgccaatga
>gnl|bcl2dbcds|A0A668RI12_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oreochromis aureus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagcctttgaacaggactgatgggggggcggcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccgccatcaacgacggacctc
gacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttcacag
ccagctgcacatcacgccggccacggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttggtg
ggcaggatcgtagagtggatgaccgtctacctagacaaccacattcagccctggatccagagccaaggaggatgggagcg
cttcgctgaaatcttcgggcaggatgcggcggccgaaagccggaggtctcaggagagtttcaagaagtggctgctggtgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcagaaacgcctgtga
>gnl|bcl2dbcds|I3IZK7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oreochromis niloticus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagcctttgaacaggactgatgggggggcggcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcacgagtcccgggacccctccggcatccccgcagcggcagcagcagccgccatcaacgacggacctc
gacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttcacag
ccagctgcacatcacgccggccacggcctaccaaagctttgagaacgtgatggacgaggtgttccgggacggcgtcaact
ggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgttgagtgcgtcgagaaggagatgagccccttggtg
ggcaggatcgtagagtggatgaccgtctacctagacaaccacattcagccctggatccagagccaaggaggatgggagcg
cttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctggtgg
ggatgacggtggtgacgggcgttgtggctggtgctcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A6I8PIR3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ornithorhynchus anatinus GN=BCL2L1 (length=615 residues).
atgtctctgcggaactacgacctggtgagagacttcgtctcctacaagctggcccagcgcgggcacgactggagccggct
ggtcgacccggaggccccggacacgggggccgagggggccgaggggggccgggcggccccggcggcggcggaggacgacg
acgaggccgtgaggcggaccctgagggaggccggggacgagttcgaggtgaggtaccggcgggcgttcagcgacctggcc
tggcagctgcacatcaccccggccacggcctaccagagcttcgagcaggtggtcaacgagctcttccgcgacggcgtcaa
ctggggccgcgtggtggccttcttcgccttcggcggggccctctgcgtggagagcgccgacaaggagatgggccccctcg
tcggacgcgtcgggagctggatggccacctacctcgaccgccgcctcgacccctggatccgagacaacggaggctgggac
acgttcgtggagctctacggcaacgacgcggccgcccagagccggaaggaccaagaacgcttcaaccgctggctgctcac
cggcctcaccgtggccgccgtcctgctgctcggctccctgttcacccgcaagtga
>gnl|bcl2dbcds|A0A3B3I2Q5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggtccggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtcagcagtgaggacg
gccggctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgt
gtgtcgagtgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3B3I2Q5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccgatgcccggaatcgcaggctggtcagcagtgaggacggccggctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccagacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgagt
gtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3B3IB64_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgcccttgccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgcggctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9I2N4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagggagctggttcggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagatgatgggggagaaactgaagaggaccactccgctgcccggaacggcaggcaggtcagcagtgaggacg
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcaag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3P9I2N4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agatgatgggggagaaactgaagaggaccactccgctgcccggaacggcaggcaggtcagcagtgaggacggccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcaaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3P9JYH1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgctgctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3P9MKK4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggtccggttctatttagcctacaagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccgctgcccggaatggcaggccggtcagcagtgaggact
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttatttgtctttggtggtgcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgag
gagatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgcttggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A3P9MKK4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias latipes GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctacaagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccgctgcccggaatggcaggccggtcagcagtgaggactgccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttatttgtctttggtggtgcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgctgcagaagcgaggagatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaactggactgctgcttggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A3B3DHA1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias melastigma GN=BCL2L1 (length=693 residues).
atgtcccgcaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcagagcacagagacgcacgccaacgggacgt
ttaacgggacgagtcccgggaccccgccgctatccccgctgcgtcagcagcagttgccgtcgacgacgaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctgcggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactgggggc
gcatcgtggggctcttcgcgttcggcggggcgctgtgcgtcgagtgcgtggagaaggagatgagccccctggtggacagg
attgtggagtggatgaccgtctacctggacaaccacatccagccgtggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaggccgcagccgaaagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B3E2W4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias melastigma GN=BCL2L1 (length=654 residues).
atgtcccactgtaaccgagagctggtgcagttctatttaggctataagatgtcatccagagactatcctgtgtccctgct
gaaacccacagatgatgggggacaaactgcagaggaccgctctgctacctgcaacggcacactggtcaacagcgaggacg
gccagctgaagaagtcctgcccctgttgtgctagcatggatgccatcaaatccacccttaaagattcggccaatgagttt
gagcgtcgcttcagtcaaggttttagtgatctctctctgcagtttcacatcactcctgacacggcctaccaaaacttcaa
aagtgtgttggatgagctgttcaaggatgggataaactgggggcgtgttgtgggtttgtttgtctttggtggtgtgctgt
gtgttgagtgtgtcgagaggaatatgagtgagctggtctcccgcattgctgaatggatgaccatgtacctagacgagcaa
ataagtccatggatccacagtcaaggaggatgggattgctttgcacagctgtatgggcaggatggcgctgcagaagcgag
aagatttcaagagacgctgaaaaagtggacgctggtcgcagtggcacttctaaccggactgctgcttggtttgctcattg
ccaagaaacggtga
>gnl|bcl2dbcds|A0A8C7XSQ2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=654 residues).
atgtcccactgtaacagagagctggttcggttctatttagcctataagatgtcatgcagggactatcctgtgtccctgct
gaagcccacagacgatgggggagaaactgaagaggaccactccactgcccggaacggcaggccggtcagcagtgaggacg
gccagctgaggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagttt
gaacgtcgtttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaa
aagggtgttggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggggcgctgt
gtgtcgagtgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaa
ataagtccatggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcgag
gcgatttcaagagacgctgaagaagtggatgctggtcacagtggcccttttaaccggactgctgctgggtgtgctcatca
ccaagaaacggtga
>gnl|bcl2dbcds|A0A8C7XSQ2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=645 residues).
atgactaagtggaagaaatcatggcatctgacctataagatgtcatgcagggactatcctgtgtccctgctgaagcccac
agacgatgggggagaaactgaagaggaccactccactgcccggaacggcaggccggtcagcagtgaggacggccagctga
ggaggtcctgtccctgttgtgctagcatggacgccatcaaatcaactctcaaagattcggccgatgagtttgaacgtcgt
ttccatcaaggttttagtgatctctccgtgcagcttcatatcactccggacacggcctaccaaaacttcaaaagggtgtt
ggatgagctgttcaaggatgggatcaactgggggcgcgttgtgggtttgtttgtctttggtggggcgctgtgtgtcgagt
gtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggatgacccagtacctggatgagcaaataagtcca
tggatccacagtcatggaggatgggattgctttgcacggctgtatggccagaacggcgccgcagaagcgaggcgatttca
agagacgctgaagaagtggatgctggtcacagtggcccttttaaccggactgctgctgggtgtgctcatcaccaagaaac
ggtga
>gnl|bcl2dbcds|A0A8C7YJI1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Oryzias sinensis GN=BCL2L1 (length=693 residues).
atgtcccggaacagagaactggttgttttctacgtgaagtataaactgtctcagaggaactaccccctcaaccacatagt
gctcaatgagtctccgaacaggactgctgcgggggaggtgggcgaggagcacagcacggagacgcacgccaacgggacgt
ttaacgggacaactcccgggaccccgccgctctccccgctgcgagagcaacagttgccgtcgacgacaaacatggacgca
gtgaaggaggcgctccgggacacggccaacgagttcgagctccggtacgccctggccttcaacaacctgcacagccagct
gcacatcacgcccgccacggcctaccagagcttcgagaacgtgatgaacgagctgttccgcgacaacatcaactggggcc
gcatcgtggggctcttcgcattcggcggggcgctgtgcgtggagtgcgttgagaaggagatgagccccctggtggaccgg
attgtggagtggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggcggatgggagcgttttgc
tgaaatctttgggcaggaagccgcggctgagagcagaaggtctcaggagagcttcaagaagtggctgctggtggggatga
cggtggcgaccggcgtcctggtgggatccttcctcgcccagaaacgcctgtga
>gnl|bcl2dbcds|C1BLI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Osmerus mordax GN=BCL2L1 (length=669 residues).
atgtcttacagtaaccgtgagctggtggtgttcttcataagctataaactttcacagaggaattatcctatttctcagtt
gggactggaagatgccagtgaacggactaatgttgacaagaccaatgtctccccagttaatggatctgttgaaaatgacc
gaaattgcataggcagtctggggatatcttcatctccacaggggggtatagaggcggttaaagcagctcttagagactct
gcagatgagtttgaattgcgttacaccagagccttcaatgatccctcttctcaactgcatatcacccctgctacagcata
ccatagctttgaaagtgtaatgaacgaggtgttcagggacggcgtcaactggggacgtgtagtaggcctgtttgcttttg
gtggtgctctttgtgctgagtgtgtcgagaaggatatgagtcacctggtagcgcgtattgcagattggatgaccacctac
ctggacaaccacatccagccatggatacagagacagggtggatgggaccgatttgctgacattttcggcagggatgctgc
tgctgaggttcgacgttcccaggagaacctaagaagatggctgctagtaggggcgatactgcttgcaggagtgttggtcg
gctctctcattgcaaagaaacatcattga
>gnl|bcl2dbcds|H0X6V2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Otolemur garnettii GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggagctggtggttgactttatctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaggccccagaagggaatgaatcagagctggagacccccagtgccattaatggca
acccatcctggcacctggctgacagccccacggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatctcagctgcacatcaccccagggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgaattgtggcctttttctccttcggcggggctctgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacttgaatgaccacctagagccttggatccaggagaacggcgg
ctggtggaggtgtcaggcctttccagagcttctctctcccaaatcaaattccatttatttcaaagtttgcatgtgtggca
atttttgctctttggctgcagctgggagatgcttgactataggagttatgggttattct
>gnl|bcl2dbcds|A0A8C8A4L8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Otus sunia GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagtggaggacgccgagatggacggtgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccgtgcaccggagcagcctcgaagtccatgaaatcgttcaagcg
gccgatgtgaggcaggcgctgagagaggcgggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccccggcacggcgtaccagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccatgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacaatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|Q9MZS7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctacgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|W5PSA5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ovis aries GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagttttttcagaaaggatacagctggagtcagtt
tagtgacatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagtgccatcagtggca
acccatcctggcacctggcagatagccctgtggtgaatggagccactggtcacagcagaagcttggacaccgggaaaatg
atccccatggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggaaagcatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggggtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacctcaaccgctggt
ccctgacggacatgactgtggccggtatggctctgctgggcttgctcttcaactgtaag
>gnl|bcl2dbcds|A0A2R8Z9D7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pan paniscus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2R8Z9D7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Pan paniscus GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggatacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C9D5N1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Panthera leo GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C9M2S8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Panthera tigris altaica GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcggccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8I5MVB8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Papio anubis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctaggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A3B3QRZ2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BCL2L1 (length=714 residues).
atgtcttacagcaacagagaactggtgatggacttcataacgtataaactgtcccagaggaactacaatggccactttgg
gcttcctgaagacaggggtcggacagagggctcgggtcaggccgatgggcgcgagggggttatggtaacagcaactcatg
tcaatgggtcggtcattgctggcggcaccagcagccaggtgtccccagtgcctgagcagccgctccattccccatcgccc
tctccacaaggcctggaggcggtgaaggaggcattgcgggattctgccaacgagtttgagctacgctacagccgcgcctt
cagcgacctctcctcccagcttcacatcacacccgtcacggcctaccagagctttgagagtgtaatgaacgaggtgttcc
gcgatggaatcaactggggccgcatcgtgggcctctttgcctttggcggggccctgtgcgtggagtgtgtggagaaggag
atgggccacctggtggatcgtattgctgactggatgaccgtttacctggacagcaacatccagccctggatccagcggca
gggaggatgggaccgttttgctgaaatctttgggaaggatgcagcagctgagagcaggaggtcccaagagaacttcaaaa
agtggctgttagctgggatgacgctcatcactggagttgttgtgggctctctcattgcacagaagcgcctgtga
>gnl|bcl2dbcds|A0A3B3TFR4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Paramormyrops kingsleyae GN=BCL2L1 (length=681 residues).
atgtcctacagcaatagggagctggtagagtactttgtcagctataagctggcccagaagaattactccattgcccacat
catacaggacgaagccgacgagcagacagggggaggtgagggcgaagcagcaggcgctgtggctcatgccaatggatcgg
tcagtagcgggaactctgtgggccagggtgctcccctggaaggcgccaccccccagggcctggaggcggtgaaggaggcg
ctgcgactctcagccaacgaatttgagttccggtaccagcgtgccttcagcgacctgtcgtcacagctgcatatcacgcc
ggccacagcctaccagagcttcgagagcgtcatgaacgaggtgttccgggacggtgtcaactggggccgagtggtgggcc
tcttcgcctttggtggcgcgttgtgcgtggagtgtgtcgagaaggagatgagcccgctggtgggccacattgtggactgg
atgaccgtctacttggacaaccatatccagccctggattcaaacccaaggaggatgggatcgcttcgccgagatcttcgg
caacgacgcagccgccgaaggccgccgctctcgggagaggttccagcagtggctgccggcggcgatggcgctggtcgcgg
gagcgctggtcggcttcctcatcgccaagaaacgccagtga
>gnl|bcl2dbcds|A0A8C9EN38_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pavo cristatus GN=BCL2L1 (length=690 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcggcagaggcagagatggacagcgtcctcaatgggagcccgtcctggc
accctcctgccggccacgtagtgaatggagccaccgtgcaccggagcagcctggaagttcaccaaattgttcgagcatct
gacgtgaggcaggcgctgagagaagcaggggatgagttcgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacggcgtaccagagctttgagcaggtagtgaatgaactcttccatgatggtgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtacttgaccgaccatctagatccctggatccaggagaatggcggctgggagcgctt
tgtggacctgtacgggaacaacgctgctgccgagctgaggaagggccaggagaccttcaacaaatggctcctgaccgggg
cgaccgtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|K7F655_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pelodiscus sinensis GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgacttcctctcctacaagctatcgcagaggggacacagctggagctggtt
cgagggggaggatgagatcaggactgaggctgcagaagaggcggagatggcaagcgtccctaatgggagtccatcctggc
atccaggtgccagccacgtagtgaacggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcagcc
gaagtgaggcaggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcaccctgggcacggcttaccagagcttcgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgcgtggagagtgtggacaaggagatgcaggtgttggtggga
cgcatcgcctcttggatgaccacttacctgactgaccaccttgatccctggatccaagagaatggcggttgggagcgctt
tgtggatctctacgggaacgatgctgctgccaagagcaggaaaggccaggagcagttcaacagggggctgctgacggggg
cgactgtggccggcgtgctcctcctgggctcgctgctgagccgcaagtag
>gnl|bcl2dbcds|A0A8C8S850_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pelusios castaneus GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgattgactttatatcctacaagctatcgcagaggggatacagctggagtcagtt
ccacgcagaggatgagaacaggactgagtttgccgaggagatagagatggcaagcgtccctaatgggagtccatcctggc
atcagggtgccagccacatggtgaatggggctgccgggcacagtcccagccttgaagctcatgaaaggtttccagcagct
gaagtgaggcaggcactgagggaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacgtccca
gctccacatcactcctggcacggcataccagagcttcgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctatgcgtggagagtgtcgacaaggagatggaggtgttggttgga
cgcatcgcctcctggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctatggaaatgatgctgcagccaagagcaggaaaggccaggagcagttcaacaggtggcttctgacggggg
cgaccgtggcaggagttctcctcctgggctctctgctgacccgcaagtaa
>gnl|bcl2dbcds|A0A3B3ZMX9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=708 residues).
atgtccctcaacagagaactggtggaattctacatccagtacaaactgtctcagcgggactgtcctctgcagcacctggg
gctgggggacaggagcacacagagtgacacggagcatcttggacttggggataggggcgtagacagggctcggctgcaga
gagaaacagaggtggacagtacggaactcagacttgactccgcctctgattctgcccccgtccacagccccgcccccttg
ttggacctggacgccgttaaagaggctcttcgtgactccgctaatgagttcgagctccgttttagccgcgctttcagcga
cctgcaccgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgtcatggacgaagtgttccgcgatg
gcgttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggagtgtgtggacaaagagatgagc
accctagtggctcgcatcgtcacctggatgactgtgtatctggacgaacacatccaagactggatcgactcgcaaggggg
atgggcccgtttcgcagagatctacgggcaggacgccgccgcgcagagccgccattccgaagaacgcttcaagaaatggc
tttttgccggaatgaccctggtcaccggggtcgtggtggggtcactgctcgcccagagacgcctgtga
>gnl|bcl2dbcds|A0A3B3ZMX9_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=645 residues).
atgtccctcaacagagaactggtggaattctacatccagtacaaactgtctcagcgggactgtcctctggggctggagga
tggtacggagattgacacagagagagacagggaccttctgggactgggggacaggagcgtggacaggaactccaccccct
cacttagactcagacttgactccgcctctgattctgcccccgctcttcgtgactccgctaatgagttcgagctccgtttt
agccgcgctttcagcgacctgcaccgccagctgcacatcacgcccgccacagcctatcagagcttcgagagtgtcatgga
cgaagtgttccgcgatggcgttaactgggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggagtgtg
tggacaaagagatgagcaccctagtggctcgcatcgtcacctggatgactgtgtatctggacgaacacatccaagactgg
atcgactcgcaagggggatgggcccgtttcgcagagatctacgggcaggacgccgccgcgcagagccgccattccgaaga
acgcttcaagaaatggctttttgccggaatgaccctggtcaccggggtcgtggtggggtcactgctcgcccagagacgcc
tgtga
>gnl|bcl2dbcds|A0A3B4BFZ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Periophthalmus magnuspinnatus GN=BCL2L1 (length=657 residues).
atgtctcccagtaaccgagagctggttgaattcttcataagctacaaattatcacagaaaaactacccaagttcgctgct
tatgtcagaccccgctagggtccagtgtgagggcaacaaggcagctaatgtcccgaatggtatgctaacaaaccggaatg
gcaacagacaaacactggcctcactgcctcctgatgatcacttagacgctattaagactgctctgacggactctgcagat
gaatttgaagagttgttcacacaagcattcagcaacctttcctctcagctcgacatcacacctgatacagcttataacag
ctttaaaagtgtcatggacgaggtgttcaaagatggggttaattggggacggattgtgggtctttttgtttttggagggg
ttttgagtgtggagtgtgtggagaaggatatgagcattctggttcctcgcattgctaactggatgactatctacctggat
gagaatatcgccacgtggattcaaaaccagggaggctgggccagctttgctcaaatttttgggcagaatgcagcaggaga
ggccagaaggtcccgagagactctgaagaaatggctgctagttggagtagggttgctagctggagtgctggttgctatgc
tcattgctaagaaatag
>gnl|bcl2dbcds|A0A346RRN1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Perna viridis GN=BCL2L1 (length=558 residues).
atgaaccagtacagttcacgttatttagtggtcgattttgtgaacgaccgactaagaaagaatggattacaatgggaaaa
ctgtccctcgttggaagtcccaccttcacaagttcagctcacattacggacgattggggacgaatttcaggaacgatttc
gcacacaatttgacgatatggtcgatcagttacatataacggaagcaacagcatatcctactttccaaagagttgttcaa
gagttattcattgatgggaatataaactgggggagggtcgttgccttgttcggttttggaggggccctctcagtagaatg
tgtacaaaatggaatgccacaacttgtagactcgatcgttgactgggtttctgtatatttatgtgataatttagaaccat
ggattacttcaaatggtggctggcagggctttgtggaatactataaccaagcacagaaccataatgacaatcagtggaac
ttgggagaatttgtacgttatggggccattggtgtggttggtgcccttgcccttggtgctttactacaaagggtatga
>gnl|bcl2dbcds|A0A6I9LMY5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Peromyscus maniculatus bairdii GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctgtcccagaaagggtacagctggagtcagtt
tagtgatgtcgaagaggacaggactgaggctccagaaggaactgattccgagagggagacccccagtgccgtcaatggca
acccatcctggcgcctggccgacagccccgcggtgaacggagccactggccacagcagcagtttggatgcgcgggaggtg
atccccatggcggcggtgaagcaggcgctgagagaggccggcgatgagtttgaactgcggtatcggcgggccttcagtga
tctaacatcccagcttcatataaccccagggacagcctatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcatcgtggcctttttctccttcggtggagccctgtgtgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggacaacggagg
ctgggacacttttgtggaactctacgggaacaacgcagccgctgagagccgaaaaggccaggagcgcttcaaccgctggt
tcctgacgggcatgaccgtggctggtgtggttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|A0A669P0Q7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Phasianus colchicus GN=BCL2L1 (length=705 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaaggggcactgctggagcgagct
ggaggaagaggatgagaacaggactgacactgcagcagaggcagagatggacagcgtcctcaatgggagcccatcctggc
acccgcctgccggccacgtagtgaatggagccaccgtgcacaggagcagcctggaagttcatgaaattgttcgagcatct
gacgtgaggcaggcgctgagagatgcaggggatgagtttgagctgaggtaccggagggctttcagcgacctcacctccca
gctccacatcacccctggcacagcgtaccagagctttgagcaggtagtgaacgaactcttccatgatggcgtgaactggg
ggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggagagcgtggacaaggagatgcgggtactggtggga
cgcattgtgtcttggatgaccacgtatttgaccgaccatctagatccctggatccaggagaatggcggctggctgctctg
gataatgctggtcatcttgatcatcccgcccttgtgtagaagggagctgggtccttccctcagcacaacccattgtagct
gctgtggggcaccacgacccagccaggagggttgggaaggagcagcgtgctctgcagcattctga
>gnl|bcl2dbcds|A0A8C9BM97_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Phocoena sinus GN=BCL2L1 (length=702 residues).
atgtctcagagcaatcgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggacgagaacagaactgaggccccagaagggactgaatcagacatggaaacccccagtgccatcaatggca
acccgtcctggcacctggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaagcaagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagctccacatcaccccagggacggcatatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C9GFE0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Piliocolobus tephrosceles GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctagtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A670IBZ4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Podarcis muralis GN=BCL2L1 (length=684 residues).
atgtcacgcaataacagggcgctcgtggtagactttgtttcctacaagctgtcagagaggggccacagctgggatgagct
ggaggaggacagcgagaacaggactgagttgagagacgagatggacagcgtccccaatgggagtccgtcttggcatcaaa
gtaccagcccggtcgtaaatggggctactggacacccgagcatcctcagtgatcttgaagacagcccaaggttggacgtg
aggcagacgctaagagaggcaggcgatgagtttgaactgaggtaccggagagctttcagtgacctcacatcccagctcca
catcacccctggcacagcataccagagctttgagcaggtggtgaatgaacttttccgggacggggtgaactgggggagga
ttgtggcatttttctccttcggaggggccctgtgcgtggagagcgtcgacaaggagatgcgagtgctggtgggacggatt
gtcagctggatgaccacttacctgacggaccacctggacccgtggatccaagaaaatggcggctgggagaggtttgtgga
cctctacgggaacgacgccgcagccaagagcaggaaaggccaggaacgcttcaacaagtggctgtggacgggggccaccg
tggccggggtcgtcctcctcggctccctcctgagccgcaaatag
>gnl|bcl2dbcds|A0A087X9B7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgctggggacgcggccggggacgcggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcggcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggaatgcgttgagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaaggaggatgggaccgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagtgtggtgacggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A087YBW4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia formosa GN=BCL2L1 (length=660 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggatggggacagccggggccctagcaatggtccgctggtcaacagct
gggccggctccccagggaagtcccgggaccctcccaccggcgtcaaggttgtcaaattggttctgaaggacgcggcagag
gagtttgaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccagag
cttcaagaccgtgctggatgagttgttcaagggtgaggtcaactggggtcgggtggtggccatgtttacctttgggggaa
ttctgtgtgtggattgcgttcagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcaatccctggatccaaagccagggaggatgggaccgcttcgctaacctgtacggccaggatgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A3B3TUS7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia latipinna GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactagtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgctggggacgcggccggggacgcggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcggcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggaatgcgttgagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaaggaggatgggaccgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagtgtggtgacggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3B3VWI7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia latipinna GN=BCL2L1 (length=660 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggatggggacagccggggccctagcaatggtccgctggtcaacagct
gggccggctccccagggaagtcccgggaccctcccaccggcgtcaaggttgtcaaattggttctgaaggacgcggcagag
gagtttgaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccagag
cttcaagaccgtgctggatgagttgttcaagggtgaggtcaactggggtcgggtggtggccatgtttacctttgggggga
ttctgtgtgtggattgcgttcagaagaatatgagcgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcaatccctggatccaaagccagggaggatgggaccgcttcgctaacctgtacggccaggatgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A3B3WI27_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgctggggacgcggccggggacgcggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcggcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcgtaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgaatcgtggggctcttcgcgtttggtggcgcgctctgcgtggagtgtgtggagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacttggatgagcggattgaaccttgggtggagagccaaggaggatgggaccgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagtgtggtgacggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3B3XN57_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia mexicana GN=BCL2L1 (length=660 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggacggggacagccggggccctagcaatggcccgctggtcaacagct
gggccggctccccagggaagtcccaggaccctcccaccggcgtcgaggttgtcaaatcggttctgaaggacgcggcagag
gagtttgaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccagag
cttcaagactgtgctggatgagttattcaagggtgaggtcaactggggtcgggtggtggccatgtttacctttgggggaa
ttctgtgtgtggattgcgttcagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcaatccctggatccagagccagggaggatgggaccgcttcgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgt
ttgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A3P9N9Y4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L1 (length=696 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactatctcagaggaactatccgatccaacacatatt
gcccaatgagcccccggacagcaccgctgccagggacgcggccggggacggggggatggacgacgagcagacgttggaga
cgcacgctaatgggacttttaacgggacaagtccaggatccccgaggcggcaacaggcggcgtcggcgtcaacgatggac
gcggtgaaagtgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgccttcaacgaccttcacagcac
gctgcacatcacaccggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggg
gccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggagtgtgtggagaaggagatgagccacctggtagcc
aggattgtagagtggatgaccgtctacctggatgagcggattgaaccttgggtggagagccaaggaggatgggagcgttt
cgctgagatcttcgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctgggga
tgagcgtggtgacggccttcatagccgggtccatctttgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A3P9QFB3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Poecilia reticulata GN=BCL2L1 (length=654 residues).
atgtcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggccgacggggccaggaccaattgggacggggacagccggggccctagcaatggcccgctggtcaacagcc
gggctggctcccgggggaagtcccagggccctcccgtcgaggtcgtcaaatcggttctgaaggacgcggcagaggagttt
gaacgcctctacacccaaagctttaaacacctttccttgcagctggacatcacccccgacacggcctaccacagcttcaa
gaccgtgctggatgagttgttcaagggcgaggtcaactggggtcgggtggtggccatgtttacctttggggggattctgt
gtgtggactgcgtccagaagaatatgagcgagctggtctcccgcattgctgaatggatgaccacttacttggacgagcag
ctcaatccctggatccagagccagggaggatgggaccacttcgctaacctgtacggccaggacgccgctgcagagggccg
gaggtttcgggagaccttgaacaaatggctgctagtcggtgtggctctgctgaccggagctctgctcgtcatgtttatcg
ctaagaaacgatga
>gnl|bcl2dbcds|A0A6D2VXZ3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pongo abelii GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctatgggaacaatgcagcagctgagagccgaaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C8YN28_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Prolemur simus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcagacagccctccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccctatggcagcagtgaagcaagcactgaaggaggcgggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcaaagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctatgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6G3C5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tatcgatgcagaagagaacaggactgaggccccagaagcgactgaatcggagatggagacccccagtgccattaatggca
acccatcctggcacctggcggacagccccccagcgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcactgaaggaggcgggcgatgaatttgaactgcggtaccggcgggcattcagtga
cctgacatcccagctccacatcaccctagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggccctctgcgtcgaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6G3C5_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Propithecus coquereli GN=BCL2L1 (length=438 residues).
atgcagaagagaacaggactgaggccccagaagcgactgaatcggagatggagacccccagtgccattaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgagatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggccctctgcgtcgaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcaact
tggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
cggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgctggttcctgacgggcatgactgtggctg
gcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A670Z9Y4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pseudonaja textilis GN=BCL2L1 (length=594 residues).
atgtcgagcggcaaccggtccctggtggtggacttcattgcctacaagctggcgcagcggggccacagctggcgcgagat
cgagggggacggcgaggagcggacggagctgtccggcgagatgggcagcggcagcggcggcgtcctgaacggcgggagcc
cctcctggcaccccagccccagcccggtggtcaacggggcggccagcattcacccggccctgctggaagagctgagcgac
ggcccccaggaggcggtgaggcagacgctgcgggaagccggggacgagttcgaactgcgctaccggcgggcctttagcga
cctgacctcgcagctccacatcaccctgggcacggcttaccagagctttgagcaggtggtcaacgaacttttccgggacg
gggtgaactgggggcggattgtggcctttttctccttcggaggggccctgtgcgtggagagcgtcgacaaggagatgcgg
ggcctggtgggaaggatcgccacctggatggccacctacctgacggagcacctggacccctggattcaagacaacggcgg
ctgggtaagtctcgggctaaacttgcaaggttga
>gnl|bcl2dbcds|A0A3B4FNX1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pundamilia nyererei GN=BCL2L1 (length=702 residues).
atgtctcaaaacagagaacttgtgcttttctacataaggtataaactctcccagagaaactatcctctcaaccacatagt
actcaacgagccttcgaacaggactgatgggggggcagcggggttggatgaggaacagcgaatagacacacacgccaatg
ggacttttaatggcaccagtcccgggaccccaccggcatccccgcagcggcggcagcagcagccgccatcaacgacggac
ctcgacgcagtgaaggaggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgccttcagcgaccttca
cagccagctgcacatcacgccggccacggcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtta
actggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgagtgcgtcgagaaggagatgagccccttg
gtgggcaggatcgtagagtggatgacggtctacctagacaaccacattcagccctggatccagagccaaggaggatggga
gcgcttcgctgaaatcttcgggcaggatgcggcggctgaaagccggaggtctcaggagagtttcaagaagtggctgctgg
tggggatgacggtggtgacaggcgttgtggcgggtgcgcttatcgcgcaaaaacgcctgtga
>gnl|bcl2dbcds|A0A3B4DTL9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Pygocentrus nattereri GN=BCL2L1 (length=717 residues).
atgtcttactacaacagagaactggttgtgtactttatcaagtacaaactctcccagaggaactatccctataaccacat
tgggcttatggaagacacaaatcggactgaagggggtcaggcggcagaggagaacgcagagggggcggcggtgacgccca
cggcagttgtcaacggatccgtaaatgggacaagtcacggtccagcggggtcgcccacctcttccccccaaagaaggtcc
aacggggccggagggctggacgccgtgaaggaagcactgcgggactcagccaacgagtttgagctgcgatattcacgcgc
ctttagcgacctctcctcccagctccatatcacgccagccacggcgtatcagagcttcgaaagcgtgatggacgaggtgt
tccgagacggcgtcaactggggccgtgttgtgggcctgttcgcgttcggtggggccctgtgcgtggagtgtgtggaaaag
gagatgagcccactcgtgggacgcatcgcagagtggatgactgtctacttggacaaccatatccagccctggatccagga
acaaggaggatgggagcgctttgcagagatctttgggaaggatgccgcagcagagagcagaaggtcacaggagaacttta
agaagtggctgctggcagggatgaccctggtcacaggggttgtggtgggctccctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|Q7TS62_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggatctctacgggaacaatgcagcagccgagagccggaaaggccaggagcgtttcaaccgctggt
tcctgacgggcatgactgtggctggtgtagttctgctgggctcactcttcagtcggaagtga
>gnl|bcl2dbcds|Q7TS62_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|Q7TS62_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rattus norvegicus GN=BCL2L1 (length=855 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctctcccagaaaggatacagctggagtcagtt
tagcgatgtcgaagagaacaggactgaagccccagaagaaactgaaccagaaagggagacccccagtgccatcaatggca
acccatcctggcacctggcggatagccccgcggtgaatggagccactggccacagcagcagtttggatgcgcgggaggta
atccccatggcagcagtgaagcaagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagcattcagtga
tctaacatcccagcttcatataaccccagggacagcatatcagagctttgaacaggtagtgaatgaactctttcgggatg
gggtaaactggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggattgcaagttggatggccacctacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggtaagaaccacgccccttgtgtgtccgccccttgtgtgtctctcctctgtggagatccctaactgccctttttggt
ctcctggcatggttgttgaagatatcgattattcaggagacattcctggcttcactttaataccaggggttaactttggg
aatattgatgaccctgtttttaaggaacctgtatttttcattctggctacccttgtggccccgcagtttcatagttttgt
tccaatttctcggcaaagaaaaacagcctgtgtgtttacttggcttaaaacctag
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6QFA2_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Rhinopithecus roxellana GN=BCL2L1 (length=438 residues).
atgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggcaaccca
tcctgggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatggggtaaactggggtcgcattgtgg
cctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgcagct
tggatggccacttatctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaactcta
tgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggccg
gcgtggttctgctgggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K6UWY8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis boliviensis GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatggggtgaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaagtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|E2IV77_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Saimiri boliviensis GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccagcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcaataaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcaaagctttgaacaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaa
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcagcagccgagagcagaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A672IDC1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salarias fasciatus GN=BCL2L1 (length=759 residues).
atgtctgagaaccgggagctggtcgttttctacatcacctacaaactgtcccagaggaactaccctctcaaccacatagt
gctcaatgagcctcccagcaggactgacgggggggacggcggggacgccggggacgccgggtcgggccccgaccagcgga
cggagacgcacgccaacgggacttttaccagcaggagcagcgggagcccgccgccgtccccgctgcggcagctgggcgct
ggcggcgggggcggggctggcggcgggggcggggctggcggcgggggcggggccggcctggacgcggtgaaggaggccct
gcgggacacggccaacgagttcgagctgcgctactccatggccttcagcgacctgcacagccagctgcacatcacgcccg
ccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactgggggcgcatcgtgggcctg
ttcgccttcggcggcgcgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggggaggatcgtggagtggat
gacggtctacctggacaaccacatccagccctggatccagagccaagggggatgggagcgctttgccgagatcttcgggc
aggacgcggcggcggagggccggcggtccgaggagagcttcaggaagtggctgctggtggggatgacggtggtgacgggc
ttcgtggtgggctcgctgttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A672IDC1_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Salarias fasciatus GN=BCL2L1 (length=684 residues).
atgtctgagaaccgggagctggtcgttttctacatcacctacaaactgtcccagaggaactaccctctcaaccacatagt
gctcaatgagcctcccagcaggactgacgggggggacggcggggacgccggggacgccgggtcgggccccgaccagcgga
cggagacgcacgccaacgggacttttaccagcaggagcagcgggagcccgccgccgtccccgctgcggcagctgggcgag
gccctgcgggacacggccaacgagttcgagctgcgctactccatggccttcagcgacctgcacagccagctgcacatcac
gcccgccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactgggggcgcatcgtgg
gcctgttcgccttcggcggcgcgctgtgcgtggagtgcgtggagaaggagatgagccccctggtggggaggatcgtggag
tggatgacggtctacctggacaaccacatccagccctggatccagagccaagggggatgggagcgctttgccgagatctt
cgggcaggacgcggcggcggagggccggcggtccgaggagagcttcaggaagtggctgctggtggggatgacggtggtga
cgggcttcgtggtgggctcgctgttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|A0A672JL90_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salarias fasciatus GN=BCL2L1 (length=651 residues).
atgtcgtccagcaaccgagagctggtggagttctttttaagccacaggctgtctcagaggaaccatccgtcctccctgct
gagaccgcaggatgcacggcaaaggaccgaggaagaccaggccagctcatcggccagcaatggctcggtgttcagcggca
gtgctgggcggtcccagtctccacgcgccgaaactgaccctgtgaagtctgcccttctggactccgccgacgagttcgaa
cttctcttcaagcaagctttcagcgatctttcctcgcagctcgacatcactcccgacacggcctaccacagcttcaagag
cgtgatggacgaggtcttcaaggatggcgtcaactgggggcgtatcgtaggcctgtttgccttcggcggcgtgctgtgcg
tggagtgtgtggagaaggacatgagcgagctggtgtcacgcattgcagactggatgaccatgtacctggatgagaacatc
aatttctggattgagagccaggggggatgggaatacttcgctgagattttcgggcgtggcgctgcttcagaggcgaggag
atcccgggagaagatgacgaggtggctgctagttggggtggcgctgctagcgggagtgctgatcggcgtgggcatcgcta
agagacagtga
>gnl|bcl2dbcds|B5XAY3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtgtactatattacctataaactatcacagagggactaccccttcaacca
catggagctcacggaagcccagaatcggactgaggtgggacaggtggaagggggtgcggcagtcctaacatacgtcaacg
ggacgagtcccgggactccaccaccacggcagtcgcccccctcctcccctcggcggacagcgggcctggacgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgttttccttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttggaatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcagggatgaccctgg
tcacaggagtcgtcgtagggtcactcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|C0HAD8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo salar GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgacgccattgcaaatgggtctgtggggaacagcagaagcaatt
tggcgaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgagtttgagctg
cgctacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctttgagagtgt
gatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
agtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaaccatatccag
ccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagttggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgccagtga
>gnl|bcl2dbcds|A0A673Z4J6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=651 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctatagactgtcccagaggaattattcatgttgtcaatt
ggggctggagggtgcaagtggacggactgagggagatgaggccattgcaaatgggtctgtggggaacagcagaagcaact
tggcaaagccctcatctccacaggggggcatggagccagtgaaagcagcactacgggactcagtggatgagtttgagctg
cgctacacccgcgcctttagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctttgagagtgt
gatggacgaagtgttcagggacggggtcaactggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttg
agtgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggatgaccacctacctggacaaccatatccag
ccctggatccagagccaaggaggatgggaccgttttgcagagatctttggcagagatgctgctgcagacgttcgacggtc
tcaggagagcataattaaatggctgctagctggggtgattctgctttcaggagtgctggtcggcactctcatcatgaaga
aacgtcagtga
>gnl|bcl2dbcds|A0A674C337_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=687 residues).
atgatgacttacaacaacagagaactggtggtgtactatattacctataaactatcacagagggactaccccttcaacca
catggagctcacggaagcccagaatcggactgaggggggacaggtggaagggggtgctgcagtcataacatacgtcaacg
ggacgagtcccgggactccaccaccacggcagtcacccccctcctcccctcggcggacagcgggtctggatgcagtgaaa
gaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagctacacat
cacgccgtccacagcctaccagagctttgagaacgtgatggacgaggtgttccgggacggtgtcaactggggacgggtgg
tgggcctgttttccttcggaggggccctctgtgtagaatgtgtggacaaggagatgaaccccttggtgggaaggatcaca
gactggatgaccgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgcagagat
ctttgggatggacgctgcagccgagagcaggaagtctcaggagagctttaagaagtggcttctggcagggatgaccctgg
tcacaggagttgtcgttgggtcaatcttcgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A674C4N2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=660 residues).
atgtcttacagtaacagggaactggtggtgttttttataagctataaactgtcccagagaaattatccatgttgtcagtt
ggtgctggagggtgcaagtgggcggactgagggggatgaagccattgcaaatgggtctttgggaaacaacaggaacggca
gaagcaatttgggtaagccttcctctccacaggggggaattgaggcagtgaaagcagcactacgggactcagtggatgag
tttgagctgcgttacacccgcgccttcagtgacctctcctcccagctccacatcacccctgccacagcctaccacagctt
tgagagcgtgatggacgaagtgttcagggatggggtcaactggggtcgcgtggtgggcctgtttgctttcggcggggccc
tgtgcgttgagtgtgttgagaaggatatgagccacctggtgatgcgcatcgcagactggatggccacctacctggacaat
catatccagccctggatccagagccaaggaggatgggaccgttttgcggagatcttcggcagagatgcagctgcagacgt
ccgacggtcccaggagagcttaagaaaatggctgctagttggggtgatgctgctttcaggagtactggtcggcactctca
tcatgaagaaatgccagtga
>gnl|bcl2dbcds|A0A674C578_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=693 residues).
atgtgtattaacctatctgaactggtggtatactatattacctataaactatcacagagagactaccccttcaaccacat
tgggctcacagaagctcccagtcggactgaggggggacaggcggaagggggggcggcagtcacgacacaccccaacggcg
cagcgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggacgca
gtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctcccagct
gcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggggac
gtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaagagatgagcccactagtgggacgg
attgcagactggatgactgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtttgc
agaaatctttgggaaggacgctgcagctgagagcaggaagtcgcaggagagctttaagaagtggttgctggcggggatga
cgctggttaccggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A674C578_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Salmo trutta GN=BCL2L1 (length=696 residues).
attatgacttacaacaacagagaactggtggtatactatattacctataaactatcacagagagactaccccttcaacca
cattgggctcacagaagctcccagtcggactgaggggggacaggcggaagggggggcggcagtcacgacacaccccaacg
gcgcagcgaacgggacgagtcctgggactccaccgcgacagtctcccccctcgtcccctcagcggacaatgggcctggac
gcagtgaaagaggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcgttcagtgacctgtcctccca
gctgcacatcacgccggccacagcctaccagagcttcgagaacgtgatggatgaggttttccgtgacggtgtgaactggg
gacgtgtggtgggcctgtttgccttcggaggggccctctgtgtagagtgtgtggagaaagagatgagcccactagtggga
cggattgcagactggatgactgtctacctggacaaccacatccagccctggatccagagccaaggaggatgggaccggtt
tgcagaaatctttgggaaggacgctgcagctgagagcaggaagtcgcaggagagctttaagaagtggttgctggcgggga
tgacgctggttaccggagtcatcgtagggtcactcattgctcagaaacgcctgtga
>gnl|bcl2dbcds|A0A8D0E1K1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Salvator merianae GN=BCL2L1 (length=675 residues).
atgtcgagcgggaaccgcgcgctcgtcatagactttatctcctacaagctctcccagaggggccacaactggagcgacct
ggaggggaacggcgaggacaggactgagctggccgaggggatgagcggcgtccccaacgggagcccctcgtgggcctccg
gcagcagcccggtgacgaacggggcgaccgggcacccgagcatccttgaagacaacgccaggtgggacgtgaggcagacg
ctcagggaggcgggcgatgagtttgaactgaggtaccggcgggctttcagcgacctgacgtcccagctgcacatcacccc
cggcaccgcttaccagagctttgagcaggtggtgaacgaactctttcgggacggggtgaactgggggcggattgtggcgt
ttttctccttcggaggagccctgtgcgtggagagcgtcgacaaggagatgcacgtgctggtgagtcggatcgccgtctgg
atgaccacttacctgactgaccatctggagccgtggatccaagataatgggggctgggaccggtttgtggatctctatgg
gaatgacgccgctgccaagagccggaagggccaagaacgcttcaacaagtggctgttgacgggggccaccgtggccgggg
tcctgctcctcggctccctgctgagccgcaaatag
>gnl|bcl2dbcds|A0A8C9WU15_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sander lucioperca GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggctttctacataaactataaactctcccagagaaactatcctctcaaccacatggg
actcatagagccttcgaacaggactgatggggggcacgcagggttggttgaggaggagagggtagcgacgcacgccaacg
ggactttgaacggcacgagtcccgggaccccaccagcgtccccgctgcggcagcaacagttggcgtctacgacgagcctg
gacgcagtgaaagaggccctccgggactccgccaacgagtttgagctgcgatacgcccgcgccttcagcgatctgcacaa
ccagctgcacatcacgccagccacggcctaccaaagcttcgagaacgtgatggatgaggtgttccgggacggggtcaact
ggggccgcatcgtagggctttttgctttcggcggggctctgtgcgtggagtgcgtggagaaggagatgagtccgctggtg
ggcaggatcattgagtggatgacggtttacctggacaaccacattcagccctggatccagagccaaggaggatgggagcg
ctttgccgaaatcttcgggcaggacgcggcggcagagagcaggcggtctcaggagagtttcaagaagtggctgctggcgg
gtatgaccctggtgaccggagtcgtggtgggctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8D0AAQ8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sander lucioperca GN=BCL2L1 (length=675 residues).
atggaaataatgttgtacagtaacagagagctggtggagttctttataagctacaagctgtctcagagaaactattcaac
ctctctgctgaggccagaggatgctggcagaaggactgaaggagacaaggccaactcagctgccagtaacggcctgctgg
tcaacagccgaaatgggggcggccagccagggatgtcgttgcccccacgtggtgacatagaggctgtaaaggcagctctt
caggactcagcaaatgagtttgaactgctcttcacacaagcgtttagtgacctctcctcgcagctagacatcactcctga
cacagcctaccacagctttaagagcgtgatggacgaggtgttcaaggatggaatcaactggggtcgtgtagtgggtctgt
ttgcctttggcggcgtgctgtgtgtggaatgtgtagagaaggatatgagcgagctggtttcccgcatcgcagactggatg
accatgtacctggatgagcacatcagtccatggatccagagccaaggaggatgggactgctttgctgaggttttcgggcg
agacggcgctgcagaagcgaggagatctcaggagactatgagaagatggctgctagttggagtggcgctgctaatgggag
tgctggttggtgtggccatcgctaagaaacgatga
>gnl|bcl2dbcds|A0A7N4P3X2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L1 (length=684 residues).
atgtctcacagtaaccgggagctggtggttgactttctttcttacaagctttcacagaagggatacaattggagtcagtt
tgaagatgagaacaggactgaggcctcagaagggacagagatacctagtactgtgaatggcagcccctcttggcaccctg
ctgacagccgtgcagtgagtggggccacaggacacagcagcagcctggatgcccatgagacaattcctgtagctgctgtg
aagcaagctttgagggaggcaggagatgaatttgaactccggtaccggcgggcattcagtgatctgacatcccagctcca
catcactccagggacggcttatcagagttttgagcaggtagtgaatgaactcttccgggatggggtgaactggggccgaa
ttgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaagagatggaagtcttggtagcacgcatc
acctcctggatggccacttacttggatgagcacctagacccatggatccaagaaaatggcggttgggacaccttcgtgga
gctttatgggaatgatgcagcagcagagagccggaagggccaggaacgcttcaacagatggctgctgactggcatgacag
tggctggtgtagtcctgctggggtccctgttcagccggaagtga
>gnl|bcl2dbcds|A0A7N4P3X2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sarcophilus harrisii GN=BCL2L1 (length=708 residues).
atgccagaaccagcatttttgcccaggatttcagaagagagctgtcaagcagatcccagactcagagagcagctttcaca
gaagggatacaattggagtcagtttgaagatgagaacaggactgaggcctcagaagggacagagatacctagtactgtga
atggcagcccctcttggcaccctgctgacagccgtgcagtgagtggggccacaggacacagcagcagcctggatgcccat
gagacaattcctgtagctgctgtgaagcaagctttgagggaggcaggagatgaatttgaactccggtaccggcgggcatt
cagtgatctgacatcccagctccacatcactccagggacggcttatcagagttttgagcaggtagtgaatgaactcttcc
gggatggggtgaactggggccgaattgtggcattcttctccttcggaggggcattgtgtgtggaaagcgtggataaagag
atggaagtcttggtagcacgcatcacctcctggatggccacttacttggatgagcacctagacccatggatccaagaaaa
tggcggttgggacaccttcgtggagctttatgggaatgatgcagcagcagagagccggaagggccaggaacgcttcaaca
gatggctgctgactggcatgacagtggctggtgtagtcctgctggggtccctgttcagccggaagtga
>gnl|bcl2dbcds|A0A8D2AGI2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sciurus vulgaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagataataggactgaagccccagaaggaactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcacctgacggacagcccggcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctctgcgggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagcga
cctgacgtcccagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaataacgcggcggccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C9SET9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scleropages formosus GN=BCL2L1 (length=675 residues).
atgtcctacagcaacagagagctggtggagttctacgtcagctacaagctggcccagaagaactactcgtttgcccactt
cgtgccggaaagggcccgcgaggagaatgaagacccgggcactaccgaggttgggagggctcgcaccaacggcgcggtga
gcaggggcgcctctcctggaccagcgacgctgccggagccccgctctcggggcctgcaggcggtgaaggaagcgctgcgc
gactctgccaacgagtttgagctgcgctaccagcgcgccttcagcgacttgtcgtcacagctgcacatcacgcccggcac
ggcgtaccagagcttcgagagcgtcatgaacgaggtgttccgcgacggcgtcaactggggccgcatcgtagggctttttg
ccttcgggggagcactttgcgtcgagtgcgttgagaaggagatgagccacttggtggcccgcatcatggactggatgacg
gtctacttggacaaccacatccagccctggatccagagccaaggaggatgggaccgctttgccgagatctttgggaacga
cgcggcggcggagagcaggcggtggcgggagaacgtctcctggtggctcatggccggcctcgtgctgtttgtcggtgccg
tgctcggctccatcgtcgccaagaggtgccagtga
>gnl|bcl2dbcds|A0A8C9SVL8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scleropages formosus GN=BCL2L1 (length=702 residues).
atgtcgtacagcaacagggaactggtgaagttttatataagctataaactgtcccaaaggaactactgtagtcactttga
gtttcccgaggacgggagtcggaccgagcgctcggatcaggcggaagcgaacggggaggaggcgttggccgccgctcatg
cgaacgggtctgcgaacggagggagtcggggattggggcagccgcccccgttgccctcctcctccccgcccccgcggggc
acgaaggcggtgaaggaggcgctgcgggacgcggccaacgagtttgagctgcgctacaaccgcgccttcaccgacctctc
ctctcagctgcacatcacgccggcgacggcctaccggagcttcgagagcgtgatgaacgaggtgttccgcgacgacgtga
actgggggcgcatcgttggcctctttgcgttcggaggagccctctgcgtcgagtgcgtggagaaggagatgagctacctg
gtgggccgcatagcagactggatgaccgtctacctggacaacaacatccagccctggatccaaaaccaaggaggatggga
ccgatttgcggagatctacgggaacgatgccgccgccaacagcaggcggtcccaggagaacatgaagaagtggctttttg
ccggggtaacgcttgtgatgggagtgctggtggcctccatcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8D3CTR5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Scophthalmus maximus GN=BCL2L1 (length=600 residues).
atgtcggacagtaacagagagctggtcgagttcttcatcggctataagctgtcccagaggaactacccgacctctctact
gaggccggaggatgctggtggaaggactgagggagacaaggccaactcagctgccagcaatggcttgttggtcgacggcg
gcaacagggactccgctcatgagtttgaacagctcttcaaccaagcgttcagtgacctctccctgcagctcgacatcacc
cctgacacggcctaccaaagctttaagagtgtgatggacgaggtgttcaaggacggagtcaactggggacgtatagtggg
cctgttcgcttttggcggcgtgctgtgtgtggaatgcgtcgagaagaataggggcgagctggtcgcccgtatcgctgact
ggatgaccatgtacctggatgagcacatcagcccctggatccagagccaaggaggctggggctgctttgcggagattttt
gggcaaggcgccggcgcagaagcaaggagatatcgggagagcgtgaggcgatggctgctagttggagtggggatgctgac
aggagtgctgattgctatgttcatcgctaagaaacagtga
>gnl|bcl2dbcds|A0A8C9NN65_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Serinus canaria GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagagcagcctcgaagtccatgagatccgtcgagca
gccgatgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A3B4V3T1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola dumerili GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtcgttttctacataaagcataagctctcccagagaaactatcctctcacccacatgga
actcaatgagtctcccaacaggactgatggcggggaggcagggttggttgaggaacagcggatagcgacgcacgccaatg
gaacttttaatggcacaagtcctgggacccgtgcagagtccccgcagcggcagcaacggctgccgtcaacaacgagcctg
gacgcagtgaaagaggccctccgggattccgccaacgagtttgagttgcgatactcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgccggccacagcttaccaaagctttgcgaacgtgatggatgaagtgttccgggacggcttcaact
ggggccgcatcatagggctttttgtgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtcctctggtg
ggcaggatcgtagagtggatgaccgtctacctggacaaccgcattcagccatggatccagagtcaaggaggatgggagcg
ctttgctgaaatcttcgggcaggacgcagcagcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcgg
ggatgaccctggtgaccggggttgtggtgggctcactgattgcccaaaagcgcctgtga
>gnl|bcl2dbcds|A0A3B4V9K8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola dumerili GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctggtggagttcttcataagctacaaactgtctcaaagtaactgcccaacctcactgct
gaggccagaggatgctggtggaaggactgagggagacaaggccaactcagctgccagtaatggcttgttggtcaacagca
gtgacaggtgtggtcagcccgggacgtcctcgcccccgcatggtggcatagaggccgtaaagtcagcccttaaggactct
gctgacgaatttgaattgctcttcaaccaagcgtttagtgacctttccacgcagcttgacatcactcctgacactgcata
ccacagctttaagagtgtgatggatgagttgttcaaagatggagtcaactggggacgtatagtgggcctatttgcctttg
ggggtgtactgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatcacagactggatgaccatgtac
ctggatgagcacatcagtccgtggatccagagccaaggaggctgggactgctttgctgagatgtttgggcaagacgccgc
tgcagaagcgaggagatctcgggaagctgtgatgaagtggctgctagttggagtggcaatgttggcaggagtgctgatgg
gcgtgctcatcgttaagaaacattaa
>gnl|bcl2dbcds|A0A3B4XS24_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L1 (length=666 residues).
atgtcgtacagcaacagagagctggtggagttcttcataagctacaaactgtctcaaagtaactgcccaacctcactgct
gaggccagaggatgctggtggaaggactgagggagacaaggccagctcagctgccagtaatggcttgttggtcaacagca
gtgacaggtgtggtcagcccgggacgtcctcgcccccgcatggtggcatagaggccgtaaagtcagcccttaaggactct
gctgacgaatttgaattgctcttcaaccaagcatttagtgacctttccacgcagcttgacatcactcctgacactgcata
ccacagctttaagagtgtgatggatgagttgttcaaggatggagtcaactggggacgtatagtgggcctgtttgcctttg
ggggtgtactgtgtgtggaatgcatacagaagaatatgagcgagctggtttcccgtatcgcagactggatgaccatgtac
ctggatgagcacatcagtccgtggatccagagccaaggaggctgggactgctttgctgagatgtttgggcaagacgccgc
tgcagaagcgaggagatctcgggaggctgtgaggaggtggctgctagttggagtggcgatgttggcaggagtgctgatgg
gcgtgctcatcgttaagaaacattaa
>gnl|bcl2dbcds|A0A3B4XU17_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Seriola lalandi dorsalis GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtcgttttctacataaagtataagctctcccagagaaactatcctctcacccacatgga
actcaatgagtctcccaacaggactgatggcggggaggcagggttggttgaggaacagcggatagcgacgcacgccaatg
gaacttttaatggcacgagtcctgggacccgtccagagtccccgcagcggcagcaacggctgccgtcaacaacgagcctg
gacgcagtgaaagaggccctccgggattccgccaacgagtttgagttgcgatactcccgcgccttcagcgatctgcacaa
ccagctgcatatcacgccggccacagcttaccaaagctttgcgaacgtgatggatgaagtgttccgggatggcttcaact
ggggccgcatcatagggctttttgtgttcggcggggcgctgtgtgtcgagtgtgtggagaaggagatgagtcctctggtg
ggcaggatcgtagagtggatgaccgtctacctggacaaccgcattcagccatggatccagagtcaaggaggatgggagcg
atttgctgaaatctttgggcaggacgcagcagcagacagcaggaggtctcaggagagttttaagaagtggctgctggcgg
ggatgaccctggtgaccggggttgtggtgggctcactgatcgcccaaaagcgcctgtga
>gnl|bcl2dbcds|A0A671K7W7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacgacgaacctca
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccacttcaaccccccagcatcag
acgaacgggactgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgatattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
tgttccgtgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccactagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagtggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A671K7W7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacgacgaacctca
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccacttcaaccccccagcatcag
acgaacgggactgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgatattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
tgttccgtgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccactagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagtggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A671QPE4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus anshuiensis GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggaggcagcaggaacgacgaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acaaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaaacatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagcggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggcgggaatgaccttgctcacgggggtcgtgggcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A672K8R2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L1 (length=654 residues).
atgtcttactataaccgagaactggtggtattttttattaaatacaaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaatgacgaacctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggatgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcataccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggtgagtggaaagttacttgtatttttctcctaccctgttagtttgaagattaagtcctatcggt
ttggaacaacatga
>gnl|bcl2dbcds|A0A672N8N5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus grahami GN=BCL2L1 (length=720 residues).
atgtcttactataaccgagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggaggcagcaggaacgacaaccctcg
ttaatggctccctgaacggaacaagtactggttccactgggaccccgccaaggtcccccgcttcaaccccccagcgtcag
acaaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagcggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggcgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A673IGS5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL2L1 (length=720 residues).
atgtcttactatcaccaagaactggtggtattttttattaaatataaactctcgcagaggaactacccctacaaccacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacaacgaccctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggacgctgtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcctcgcagctccacatcacgcctgccacggcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgcctttggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccactagtgggaagcatcgcggaatggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagcggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggtgggaatgaccttgctcacgggtgtcgtggtcgggtcactcattgcacaaaaacgcctgtga
>gnl|bcl2dbcds|A0A673M4N6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL2L1 (length=720 residues).
atgtcttactatcaccaagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacaacgaccctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcgtcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggaacgcttcgcagagatctttggaaaagatgcagtggcagagagcagaaaatcacaagaaaact
tcaagaagtggttgctggcgggaatgaccttgctcactggtgtcgtggtcgggtcactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|A0A673M4N6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sinocyclocheilus rhinocerous GN=BCL2L1 (length=660 residues).
atgtcttactatcaccaagaactggtggtattttttattaaatataaactctcacagaggaactacccctacaatcacat
tgaatttacagaagacacaaatcggactgatgcggcggaagggaatgatgatgaggcggcagcaggaacaacgaccctcg
ttaatggctccctaaacggaacaagtactggttccactgggaccccaccaaggtcccccgcttcaaccccccagcgtcag
acgaacgggactgggggtctggatgcagtaaaggaggcgcttcgcgattctgccaacgagtttgagctgcgttattccca
agcattcaacgacctgtcgtcgcagctccacatcacgcctgccacagcgtaccagagcttcgagagcgtgatggatgagg
tgttccgcgacggcgtcaactggggccgcatcgtgggactgtttgccttcggaggggctctgtgtgttgagtgcgtggag
aaggagatgagcccgctagtgggaagcatcgcggattggatgaccgtctacctagacaacaaaattcagccctggatcca
gagccaaggaggatgggttggacgagtggcaggtaatggaggggtcctggtccagtcagctttttctctttgtgatcagg
gctgcgatctgattgggtga
>gnl|bcl2dbcds|A0A671WXV0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sparus aurata GN=BCL2L1 (length=669 residues).
atgtcacaaaacagagaactggtggttttctacataaactataaactctcccagagaaactatcctctcaaccacatggg
actcatagagtctccaaacaggactgatgggggggcgacgcacgccaatgggacttttaacggcatgagtcctggcacac
ccccagcatcccctcttcggcagcaacggttgccgtcaacaacaagcctggacgcagtgaaagaagccctacgggactct
gccaatgagttcgagctgcgatatgcgcgcgccttcagcgacctgcacaaccagctgcacatcacaccggccacagccta
ccaaagcttcgaaaacgtgatggacgaggtgttccgggacggagtcaactggggtcgtgtagtagggctttttgctttcg
gtggagcgctgtgcgtggagtgcatggagaaggagatgagtccgctggtcggcaggatcatagagtggatgacggtctac
ctggacaaccacattcagccctggatccagagccaaggaggatgggagcgctttgctgaaatcttcgggcaggacgcggc
ggcagagagcaggaggtctcaggagagtttcaagaagtggctgctggcggggatgaccctggtgaccggggtcgtggtgg
gctcactcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8C9UNM3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Spermophilus dauricus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacaggactgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcggcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|A0A672Z262_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sphaeramia orbicularis GN=BCL2L1 (length=660 residues).
atgtcgcacagtaacagggagctggtggagttcttcatatgctacaagctgtcgcagaaaaattacccgtcctctctgct
gaggccagatgatgccaggactgaaggagacaaggccaacaccactgtctctaatggcttattggcgaacagtaggaacg
gaggtggacaggcagtggtgtcgctgccccccagtggtgacgtagacgcagtaaaggcagcgcttcaggactctgctgat
gagtttgagctgctctacacgcaggcatttagtgggctgtcctcccagctcgacatcactcctgacactgcctaccaaag
ctttaaaagtgtcatggatgaggtgttcaaggacggggtcaactgggggcgtatcgtgggcctgttcgcattcggaggag
tcctttgtgtggaatgtgctgagaaggacatgagtgagctggttcctcggatcgccgactggatgaccacgtacctggat
gagcacatcagcccatggattgagagcgcaggaggctgggacagcttcggtgagatttttggacaaagcgcagctgccga
agcacggaggtctggggagacgctgaagcgatggctgctggtcggagtggtgttgttaactggagtgctgatcggtgtgc
tcgttgctaaaaaacagtaa
>gnl|bcl2dbcds|A0A673BZP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sphaeramia orbicularis GN=BCL2L1 (length=696 residues).
atgtctcaaaacagagaactggtggttttctacataaactataaactctcccagagaaactatcccatcaaccacattgg
actcatagaaccccccagcaggactgatggtggagaggcggggttgggtgaggaacagcgggtaagtacgcatgccaacg
ggacttttaatggcacaagtcctgggacccctccagcatctcctgtgcggcagcgtttaccgtcaacgacaaacctggac
tcggtgaaagaggccctccgggactcggccaatgagtttgagctgcggtacgcccgcgccttcagcgatctgcacaacca
gctgcacatcacaccagccactgcataccaaagctttgaaaatgtgatggatgaggtgtttcgggacggtgtcaactggg
gccgcatcgtagggctttttgcattcggcggggcgctctgtgtcgagtgtgtggagaaggagatgagtccactggtgggc
aggatcgtagagtggatgacggtgtacctggataaccacattcagggctggatccagagccaaggaggatgggagcgctt
tgccgaaatctttggccaggatgcagcggcagagggcaggaggtctcaggagagtttcaagaagtggctgctggcgggga
tgacccttgtgaccggggtcgtggtggggtcactcattgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A8D0HVA8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL2L1 (length=690 residues).
atgttgagtggcaaccgagcgctagtcgttgactttatatcctacaagctgtcgcagaggggctacagctggagccagct
cgaagggcacgatgagaacaggactgagacggtagaaggggcagcgatggggagtgtgcctaatgggagcccatcctggc
atcccagtgccagtcccatagtgaacggggctgctgggcacaccaacggcgtggaagcccacgaagggctcacagtggtg
gacgtgaggcaggcgctgagagaggcaggggaggagtttgaactccgataccggagggcgttcagtgacctcacctccca
gctccacatcacccccgtcacggcgtaccagagcttcgagcaagtggtgaacgaactctttcgggatggagtgaactggg
ggcgcatcgtggcttttttctcctttggaggggccctgtgcgtggagagcgtcgacaaggagatgcaggggctggtggga
cgcatcgtcacctggatggccacttacctgactgaccatctagatccctggatccaggagaatggcggctgggagaggtt
tgtcgatctctacgggaacgacgctgcagccaagagcaggaaaggccaggaacgcttcaacaagtggcttctgactgggg
ccaccgtggcaggcgtcgtcctcctgggctccctcttgagccgcaaataa
>gnl|bcl2dbcds|A0A8D0HVA8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL2L1 (length=690 residues).
atgttgagtggcaaccgagcgctagtcgttgactttatatcctacaagctgtcgcagaggggctacagctggagccagct
cgaagggcacgatgagaacaggactgagacggtagaaggggcagcgatggggagtgtgcctaatgggagcccatcctggc
atcccagtgccagtcccatagtgaacggggctgctgggcacaccaacggcgtggaagcccacgaagggctcacagtggtg
gacgtgaggcaggcgctgagagaggcaggggaggagtttgaactccgataccggagggcgttcagtgacctcacctccca
gctccacatcacccccgtcacggcgtaccagagcttcgagcaagtggtgaacgaactctttcgggatggagtgaactggg
ggcgcatcgtggcttttttctcctttggaggggccctgtgcgtggagagcgtcgacaaggagatgcaggggctggtggga
cgcatcgtcacctggatggccacttacctgactgaccatctagatccctggatccaggagaatggcggctgggagaggtt
tgtcgatctctacgggaacgacgctgcagccaagagcaggaaaggccaggaacgcttcaacaagtggcttctgactgggg
ccaccgtggcaggcgtcgtcctcctgggctccctcttgagccgcaaataa
>gnl|bcl2dbcds|A0A8D0HVA8_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Sphenodon punctatus GN=BCL2L1 (length=690 residues).
atgttgagtggcaaccgagcgctagtcgttgactttatatcctacaagctgtcgcagaggggctacagctggagccagct
cgaagggcacgatgagaacaggactgagacggtagaaggggcagcgatggggagtgtgcctaatgggagcccatcctggc
atcccagtgccagtcccatagtgaacggggctgctgggcacaccaacggcgtggaagcccacgaagggctcacagtggtg
gacgtgaggcaggcgctgagagaggcaggggaggagtttgaactccgataccggagggcgttcagtgacctcacctccca
gctccacatcacccccgtcacggcgtaccagagcttcgagcaagtggtgaacgaactctttcgggatggagtgaactggg
ggcgcatcgtggcttttttctcctttggaggggccctgtgcgtggagagcgtcgacaaggagatgcaggggctggtggga
cgcatcgtcacctggatggccacttacctgactgaccatctagatccctggatccaggagaatggcggctgggagaggtt
tgtcgatctctacgggaacgacgctgcagccaagagcaggaaaggccaggaacgcttcaacaagtggcttctgactgggg
ccaccgtggcaggcgtcgtcctcctgggctccctcttgagccgcaaataa
>gnl|bcl2dbcds|A0A3B4Z3X2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Stegastes partitus GN=BCL2L1 (length=690 residues).
atgtctcaaaacagagaactggtggtttactacataaagtataaactctcccagagaaactatcccctcaatcacatggt
gctcaatgaggctcccaacaggactgacgggggggaggcgaggttggctgaggaacagcggacagagacacacgccaacg
ggacttttaatggcacgagtcccgggaccccgccgccgtccccgcggcggttggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgccggccaccgcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtagggcttttcgcgttcggcggggcgctgtgtgtcgagtgcgtcgagaaggagatgagccccctggtgggccggatc
gtagagtggatgacggtttacctggacaaccacattcaggactggatccagagccaaggcggatgggaccgcttcgctga
aatcttcggccaggacgcggcagccgagagccggaggtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgaccggggtcgtggtcggttcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B4Z3X2_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Stegastes partitus GN=BCL2L1 (length=690 residues).
atgtctcaaaacagagaactggtggtttactacataaagtataaactctcccagagaaactatcccctcaatcacatggt
gctcaatgaggctcccaacaggactgacgggggggaggcgaggttggctgaggaacagcggacagagacacacgccaacg
ggacttttaatggcacgagtcccgggaccccgccgccgtccccgcggcggttggcgtcgacggcgaccatggacgcggtg
aaggaggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgccttcagcgacctgcacagccagctgca
catcacgccggccaccgcctaccaaagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgca
tcgtagggcttttcgcgttcggcggggcgctgtgtgtcgagtgcgtcgagaaggagatgagccccctggtgggccggatc
gtagagtggatgacggtttacctggacaaccacattcaggactggatccagagccaaggcggatgggaccgcttcgctga
aatcttcggccaggacgcggcagccgagagccggaggtctcaggagagcttcaagaagtggctgctggtggggatgacgg
tggtgaccggggtcgtggtcggttcgctcatcgcccagaaacgcctgtga
>gnl|bcl2dbcds|A0A3B5B4X7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Stegastes partitus GN=BCL2L1 (length=636 residues).
atggaaataatgtcgtacagtaacagagagctagtggagttctttataagctacaagctgtctcaaaggaactatccaac
gtctctgctgaggccggaggatgctgcaggaaggactgagggagacaagaccaactctgctgccagtaacggcttgctgg
tgaacagcagaggcggcatagaggctgtaaaagcagcgcttaaggactcggcagatgagtttgaacttctcttcacgcaa
gcttttagtgacctgtcttcacagcttgacatcactcctgacacggcctaccacagcttcaagagtgtgatggacgaggt
gttcaaggatggggtcaactggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaatgcgtagaca
agaatatgaacgagctggttccccgcatcgcagactggatgaccatgtacctggatgagcacatcagtctgtggatccaa
agccaaggaggatgggagtgctttgctgaaattttcgggcaagacgccgccgcagaagcacggagatctcgggattctct
gaagcgatggctgctagtcggaggggcgctgctaacgggagtgctggctggtgtgctcatcgctaagaaacagtga
>gnl|bcl2dbcds|A0A672UKR0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Strigops habroptila GN=BCL2L1 (length=693 residues).
atgtccagcagcaaccgggcgttagtgattgactttgtgtcctacaagctctcgcagaagggccacagctggagccagct
ggaggaggaggatgagaacaggactgactttgcagccgaggaggtggagatggacggcgtcctcaacgggagcccctcct
ggcaccctcccgccagccacgtagtgaacggagccgccgtgcaccggagcagcctccaggtccacgacatggttcaagca
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacgtc
ccagctccacatcacccccggcaccgcgtaccagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
gggggcgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccacctacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgaggaagggccaagagaccttcaacaaatggctcctgaccg
gggcgacggtggccggggtgctcctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8D0FHG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Strix occidentalis caurina GN=BCL2L1 (length=693 residues).
atgtccagcagtaaccgggagttagtgattgactttgtttcctacaagctctcgcagaagggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcagtggaggacgccgagatggacggcgtcctcaacgggagcccctcct
ggcacccgcccgccagccacgtagtgaacggagccgccgtgcaccggagcagcctcgaagtccatggaatcgttcaagcg
gccgatgtgaggcaggcgctgagagaggcgggggatgagtttgagttgaggtaccggcgggctttcagcgacctcacttc
ccagctccacatcacccctggcacggcgtatcagagctttgagcaggtagtgaacgaactcttccgcgatggagtgaact
ggggtcgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgacaaggagatgcgggtattggtg
ggacgcattgtatcttggatgaccatgtacttgaccgaccacctagatccctggatccaggagaatggcggatgggagcg
gtttgtggacctctacgggaacgatgctgctgccgaggtgaggaagggccaggagaccttcaacaaatggctcctgaccg
gggcgacggtggcaggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A673UUI0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Suricata suricatta GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggtcgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccgtcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggacgcccgggaggtg
atccccatggcagcggtgaagcaggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcgtatcagagtttcgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacgtggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A4X1SQU7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=864 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggc
cctgtggctccaaccctccagtagaaacccaaacagaaacaggcagctctcactcagttgatctgatccagggagcccct
gagattctgcccagacacaaacacctgcaacaggatctcagcatcctgccggtaagaccctttccccaccccacgccgtt
caggtttcatgcaggacccacttccgtcccctcagaccagaggagacaactgaggaagacgtag
>gnl|bcl2dbcds|A0A4X1SQU7_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A4X1SQU7_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A4X1SQU7_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A4X1SQU7_BCL2L1-05 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=528 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggagaacggcggctgggacacttttg
tggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggttcctgacgggcatg
actctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A4X1SRM7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D0J6V8_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccggggggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D0J6V8_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccggggggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D0J6V8_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccggggggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D0J6V8_BCL2L1-04 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccggggggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D0J6V8_BCL2L1-05 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccggggggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D0XF62_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=864 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggc
cctgtggctccaaccctccagtagaaacccaaacagaaagaggcagctctcactcagttgatctgatccagggagcccct
gagattctgcccagacacaaacacctgcaacaggatctcagcatcctgccggtaagaccctttccccaccccacgccgtt
caggtttcatgcaggacccacttccgtcccctcagaccagaggagacaactgaggaagacgtag
>gnl|bcl2dbcds|A0A8D0XF62_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D1ALD6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=864 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggc
cctgtggctccaaccctccagtagaaacccaaacagaaagaggcagctctcactcagttgatctgatccagggagcccct
gagattctgcccagacacaaacacctgcaacaggatctcagcatcctgccggtaagaccctttccccaccccacgccgtt
caggtttcatgcagaacccacttccgtcccctcagaccagaggagacaactgaggaagacgtag
>gnl|bcl2dbcds|A0A8D1ALD6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtagtgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggagcgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|O77737_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Sus scrofa GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tactgatgtggaagagaacagaactgaggccccagaagggactgaatcagaagcggaaacccctagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggctgcagtgaagcaagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggcattcagtga
cctgacgtcccagctccacatcaccccagggacagcgtatcagagctttgagcaggtattgaacgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacggaaacaatgcagcagctgagagccggaagggccaggaacgcttcaaccgatggt
tcctgacgggcatgactctagctggggtggttctgctgggttcgctcttcagtcggaaatga
>gnl|bcl2dbcds|H0Z8G3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaagaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcggccaccagccacatagtgaatggagccaccgtgcaccagaacagcctcgaagtccatgagatccgtcgagca
gctgatgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtctcttggatgaccacgtacttgaccgaccacttagatccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgagaaaaggccaggagaccttcaacaaatggctcctgacgg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A0F7L1T6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu obscurus GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccatcttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccgctgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcattgaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacggcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagacaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagagggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|A0A3B5K6B9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtctcaaaacagagaactggtcattttctatattaagtacaaactctcccaaagaaattaccctttcaatcacaatgg
actcatattagagcctccaagtaggactgatgggcagtttgtaactactcagttcaatggaacttttaatggtgcaagcc
ctggaacacccccagcaacaagtctggcaacaagtctggatacagtaaaggaagccctccgggacacaggcaatgaattt
gagctgcgatacacttgtgctttcagtgacctgcacaaccagctacacatcaccccagctactgcttaccaaagttttga
gaatgttatggatgaggtatttagggatggagtcaactgggggcggatagtggggctttttgcatttggtggtgctctct
gtgtggagtgtgttgagaaggagatgagtcccctggtgggccggattatagagtggatgacagtctatcttgacaaccac
attcaaccatggatccagagtcaaggaggatgggtccgttttgctgaactctttgggcaggatgcagcagcagaaagcag
gagatctcaggagagattcagaaacggactcctggtggggatgagcctggcagcagggatcgcaatcgggtcgttcatag
tgaggaaactcctgtga
>gnl|bcl2dbcds|H2U5I3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Takifugu rubripes GN=BCL2L1 (length=657 residues).
atgtcgtataacaacagagagctggtggagcacttcttaagatacaagctgtctcagaggaactacccaacttctctgct
gagaccagaggatactgatggaaggacagagggagaaaagaggagccccgctgcttccaatggcctgctggtccgcagca
ggaacaggggtggagcgtctccatccgcaggtgctggcatagaggctgtgaacgcagctcttcgggactcggcagaagag
tttgagaagctctttgctcaagcattcagcgacctctcctcacagctcgacatcactcctgacacagcttaccagagctt
taagaatgtgatggacgaggtgttcaaggacggagtcaactggggacgagttgtgggactatttgcctttggcggggtac
tatgtgtggaatgtgtcgagaaggatgcgagccaactggtttgccgcattgcagactggatgaccatttacctggatgag
catattaacccgtggatccagagtcaaggaggatgggattgcttcgcgaagatttttggggacgacgccgcggcagaggg
gaggagagctcgcgagaacctgagtagatggatgctgggcggattggcgctgctgatgggagttttggtcggcgctttca
tcgtcaagaaacattga
>gnl|bcl2dbcds|A0A674J5J7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Terrapene carolina triunguis GN=BCL2L1 (length=690 residues).
atgtcgaacactaacagggaattagtgactgactttctctcctacaagctatcgcagcggggatacagctggagtcggtt
tgagggggaggatgagatcaggactgagtctgcagaagaggctgagatggcaagcgtccctaatgggagtccatcctggc
atccgggtgccagccacgtggtgaatggggctgccgggcacagtaacagccttgaagcccatgaaagggttccggcaact
ggagtgaggcaggcactgagagaggcaggagatgagtttgaattgaggtatcggagggctttcagtgacctcacttccca
gctccacatcacccctggcacggcataccagagctttgagcaggtggtgaatgaactcttccgggacggagtgaactggg
ggcgcattgtggcttttttctcctttggaggagccctgtgtgtggagagtgtcgacaaggagatgcaggtgttggttgga
cgcatcgtctcatggatgaccacttacctgactgaccacctagatccctggatccaagagaatggcggttgggagcggtt
tgtggatctctacgggaatgacgctgctgccaagagcaggaaaggccaggagcagttcaacaggtggcttctgaccgggg
cgactgtggcgggagtgctcctgctgggctctctgctgagccgcaagtaa
>gnl|bcl2dbcds|H3CH49_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Tetraodon nigroviridis GN=BCL2L1 (length=696 residues).
cgaagtcaccccggagcaaagtcaaaaggcgcatctacgcagaggatgtctctaaacagagaactggtcattttctacat
taaatacaaactttcccaaagaaactaccctttgagtcacattgtagagccttcaagtaggactgaagggcagtttggaa
ccacccagtccaatggaacttttaatggggcaagtcctggaacccccccagcaccctcccagcaccagcagtcattgaca
agtctggacgcagtcaaggaagccctccgggacaccggcaatgaatttgagctgcggtacacctgcgcgttcagtgacct
gcacaaccagctccacatcacgccagccacggcttaccaaagttttgagaacgttatggatgaggtgtttcgggatggag
tcaactgggggcggatagtgggcctttttgccttcggtggtgccctgtgtgtggagtgtgtggagaaggagatgaatcct
ctggttggccggatcatagagtggatgacggtctatctggacaaccacatccagccctggatccagagtcaaggaggatg
ggaacgttttgctgaactcttcgggcaggacgcggctgcagaaagccgcaggtcccaggagcgattccgaaacgggctgt
ttctgggcatgagtctggcggcagggatcgccctcggctccttcatcgtcatgagg
>gnl|bcl2dbcds|A0A8D2ERY7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Theropithecus gelada GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcaatt
tagtgatgtggaagagaacaggactgaggccccagaagggactgaatcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggtggacagccccgcggtgaatggagccactggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcgttcagtga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatgggaacaatgcagcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctaggctcactcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D2I760_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Urocitellus parryii GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaataagattgaagccccagaagggactgaatcagaggtggagacccccagtgccatcaatggca
acccatcctggcatctggccgacagccccgcggtaaatggagccactggtcacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggcattcagtga
cctgacgtcccagctccacatcaccccggggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaataatgcngcagcagagagccggaagggccaggagcgcttcaaccgttggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcgcttttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D2IA38_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Urocitellus parryii GN=BCL2L1 (length=612 residues).
atgcggcagtctggctggaggaacctggaactagtgatcgactttctgtcctacaagctttcccagaaaggatatagctg
gagccagtttagccatgaggaagagaaccgcgttcaaggcccagaaagggctgaatcagaagaggggtccagcaatgcca
ccaacagcaacccatcccggcatcagggggacagtcccatggtgagtggagccgctggccataacaggagtttggatgcc
ccagacgtgatccccatggtagcagtgaagcaagcgctgagggaggcaggcgacaactttgaacggcggtaccggcaggc
catccttaacatgacagcagagctctgcctcaccccggagacagcacatcacacttttgaacaggtagtggacgaactct
tccaggataaggtaagctggggtcgcattgtggcctttttctcctttggaggagcactgtgcttggaaagcatagacaag
gagatgaaggtgttggtgtgtcagatcgcaagttggatggccayttacctgaatgatcacctagatacttggatccaggg
ccatggcggctgggacacttttgtgaaacaatgcttaatggagtatcactaa
>gnl|bcl2dbcds|A0A8D2IA38_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Urocitellus parryii GN=BCL2L1 (length=693 residues).
atgcggcagtctggctggaggaacctggaactagtgatcgactttctgtcctacaagctttcccagaaaggatatagctg
gagccagtttagccatgaggaagagaaccgcgttcaaggcccagaaagggctgaatcagaagaggggtccagcaatgcca
ccaacagcaacccatcccggcatcagggggacagtcccatggtgagtggagccgctggccataacaggagtttggatgcc
ccagacgtgatccccatggtagcagtgaagcaagcgctgagggaggcaggcgacaactttgaacggcggtaccggcaggc
catccttaacatgacagcagagctctgcctcaccccggagacagcacatcacacttttgaacaggtagtggacgaactct
tccaggataaggtaagctggggtcgcattgtggcctttttctcctttggaggagcactgtgcttggaaagcatagacaag
gagatgaaggtgttggtgtgtcagatcgcaagttggatggccayttacctgaatgatcacctagatacttggatccaggg
ccatggcggctgggacacttttgtgaaacttggttttctagaactactacacttctttgacagccaccttcctgcatacc
tcagttatcttggcatcaaagtctacaatattttccccaaatctgtcccatga
>gnl|bcl2dbcds|A0A452SDS4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ursus americanus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaaggaactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggccggggatgagttcgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcgtatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcggctgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A384D3U1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ursus maritimus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaaggaactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcggacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcagtgaagcaagcgctgagggaggccggggatgagttcgaactgaggtaccggcgggcattcagcga
cctgacatcccagcttcacatcaccccagggacagcgtatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaacgaccacctagagccttggatccaggagaacggcgg
ctgggacactttcgtggaactctacgggaacaatgcagcggctgaaagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8D2L5P2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Varanus komodoensis GN=BCL2L1 (length=684 residues).
atgtcgagcagaaacagggcgcttgtgacagacttcatttcctacaagctgtctcagcggggccacagctggaatgagat
cgaaggcgacgagggaagcaggactgagctggccgacgagatggggggcgtcctcaacgggagcccctcttggcacaccg
gcagcagcccggtcgtcaatggggcgacggggcacctgaccatcctcgaagacctggaagacggtccccgggaggatgtg
aggcagacgctcagggaggctggcgacgagttcgaactgcggtaccggcgggctttcagcgacctcacctcccagctgca
catcacccccggcaccgcgtaccagagcttcgagcaggtggtgaacgaactcttccgcgacggggtgaactgggggcgga
ttgtggcgtttttctccttcggaggggccctgtgcgtggagagtgtcgacaaggagatgagagtgttggtgggccggatt
gccagctggatggctacttacctgaccgagcacctggacccctggatccaagagaacggcggctgggagcggtttgtgga
tctctatgggaacgatgccgccgcgaagagcaggaaagggcaggagcgcttcaacaggtggctcttgacgggggccaccg
tggccggcgtgctcctcctcggctcgctgctgagccgcaagtag
>gnl|bcl2dbcds|A0A4X2KZ04_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Vombatus ursinus GN=BCL2L1 (length=558 residues).
cctcaaactccggccccagaagggacagaaactagtactgtgaatggtagcccctcttggcaccctgctgacaaccatgc
agtgagtggggccacaggacacagcagcagcctggatgcccatgagacaataccagtggctgctgtgaagcaagctttga
aggaggcaggagatgaatttgaactctggtaccgatgggccttcagtgacctgacatcccactttgagcaggtagtgaat
gagctctttcgggatagggtgaactggggccgaattgtggcattcttctccttcggaggagcattgtgtgtggaacgcgt
ggataaggagatggaagtcttggtaggacgaatcacctcctggatggccacttacttggatgaccacctagacccttgga
tctcagaaaatggcggttgggacacctttgcggagccttatgagaataacgcagctgcggagagccgggagggccaggaa
agcttcatccgatggctgctgactggcatgacagtggctggtgtagtcctgctggggtccctattcagccggaagtga
>gnl|bcl2dbcds|Q2TAP5_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatccccaacccaatgccatatctaatggaacttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgattctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|Q90ZH2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatccccaacccaatgccatatctaatggaacttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacagaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgttggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgatgctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|Q91828_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xenopus laevis GN=BCL2L1 (length=615 residues).
atggagggcagcagtagagatctggtggagaagtttgttagtaagaaactttcccagaatgaagcctgcaggaagttctc
caataatcccaacccaatgccatatctaatggaaccttctacttcagagcgccccggggaaggggccacgcagggcattg
tggaggaggaagtccttcaagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgccttcagtgacctg
acctcacagctgcacatcacccaggacacggcccagcagagcttccagcaagttatgggagagttgttcagggatgggac
aaactgggggagaattgtggctttcttctcatttgggcgggccctatgtgtggagagtgcaaacaaggagatgactgatc
tgctacccagaattgtccagtggatggtgaattatctagagcacacactgcagccctggatgcaggagaatggaggctgg
gaagcttttgtcggcctgtatggaaagaatgccgcagcccagagcagagaaagccaggaacgatttggcaggttgctgac
tatagtgatgctgactggtgttttcgcattggtctgctacatgaggcgccgatag
>gnl|bcl2dbcds|A0A3B5MGS2_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus couchianus GN=BCL2L1 (length=660 residues).
atggcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggttgccgggggcaggaccaattgggaaggggacagccgggtccctcgcaatggcccgctggtcaacagct
gggccgggcacccggggaaacccaggggccctccggccggcgtcgaggtcgtcaaatcggttctgaaggacgcggcggag
gagtttgagcgcctctacacccaaagctttaaacacctctccttgcagctggacatcacccccgacacggcctaccacag
cttcaagaccgtgctggacgagttgttcaagggcggggtcaactgggggcgggtggtggccatgtttaccttcgggggga
ttctgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggac
gagcagctcagtccctggatccagagccagggaggatgggaccgctttgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagttggtgtggctctgctgaccggagctctgctcgtcgtgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A3B5PQJ0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=684 residues).
atgtcacgaaacagagaactggtgcttttctacattaagtttaaactgtctcagaggaactatccgatccaacacatatt
gcccaacgagcccccggacggcaccgctgccggggacgtggggatggacgacgagcagacgttagagacacacgctaatg
ggacttttaacgggacgagtccaggatcccctaggcggcaccaggcggcgtcggcgtcaacgatggacgcggtgaaagtg
gccctgcgcgacacggcccgtgagtttgagctgcgctactcccgcgccttcaacgaccttcacagcacgctgcacatcac
accggccaccgcctaccagagcttcgagaacgtgatggacgaggtgttccgggacggcgtcaactggggccgcatcgtgg
ggctcttcgcgtttggtggcgcgctgtgcgtggagtgcgtggagaaggagatgagccacctggtagccaggattgtagag
tggatgaccgtctacctggatgagcagattgaaccttgggtagaaagccaaggaggatgggagcgcttcgctgagatctt
cgggggcaacgcggcggcagagagcagaagatctcaggagagcttcaaaaactggctgctgctggggatgagcgtggtga
cggccttcatagccgggtccatcttcgcccagaagcgcctgtga
>gnl|bcl2dbcds|M4A558_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Xiphophorus maculatus GN=BCL2L1 (length=660 residues).
atggcctacagcaacagagaactggtggagttctacataagctacaaattgtctcagagaaactattcaagctctctgct
gaggtccgaggttgccgggggcaggaccaattgggaaggggacagccgggtccctagcaatggccggctggtcaacagcc
gggccgggcccccggggaagcccaggggcccaatggccggtgttgaggtcgtcaaatcagttctgaaggacgcggcggag
gagtttgagcgcctctacacccaaagctttaaacacctctccttgcagctggacatcacccccgacacggcctaccacag
cttcaagaccgtgctggacgagttgttcaagggcggggtcaactgggggcgggtggtggccatgtttaccttcgggggga
ttctgtgtgtggactgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggatgaccacttacctggat
gagcagctcagtccctggatccagagccagggaggatgggaccgctttgctaacctgtacggccaggacgccgctgcaga
gggccggaggtttcgggagaccttgaacaaatggctgctagttggtgtggctctgctgaccggagctctgctcgtcgtgt
tcgtcgctaagaaacgatga
>gnl|bcl2dbcds|A0A8D2M680_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Zonotrichia albicollis GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcagccagcagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtgcacgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggacgagttcgagctgagataccggcgggcgttcagcgacctcacctc
ccagctccacatcacccccagcacggcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccctgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagacccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgaggaaaggccaggagaccttcaacaaatggctcctgacgg
gggcgacagtggctggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8D2NN48_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Zosterops lateralis melanops GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggmgttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaagatgagaacaggactgactttgcaggggaggaggacgaggtggacggcgtcctcaacgggagcccctcct
ggcacgcgccgaccagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtccacgagatccgtcgagcg
gccgacgtgaggcaggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcgttcagcgacctcacttc
ccagctccacatcactcccagcacagcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggagagcgttgttaaggagatgcgggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagacccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgaggtgagaaaaggccaggagaccttcaacaaatggctcctgacyg
gggcgacggtggccggagtgcttctgctgggatccctgctgagccgcaagtga
© 1998-2023Legal notice