Dataset for CDS BCL2L1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

212 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      atgttccgacggcacgtgaaggcgtcatattacgtaatagggaggcaggg
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ccgagcggacgtaggaggatacgtgcgagcacacacactcgtgaacacaa
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agtggatgtgtgacattcttgtggagcttgacagctttttgtgcgcaccg
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agcgacagacggactggagacagcgtcacggagcggaggacagcttcccg
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ggaatcccgtgcttttgtttcggttcttgctgggcctgagctggtttgtc
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      agccttgtgtaggtttggttttcacccccgagcgtcctgtggatatcagc
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ggaccatggtggtctgagcagagggcagcaggaaggcagcctggcacagt
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        ----------------------cgaagtcaccccggagcaaagtcaaaag
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        -------------------------------------------------a
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      gtgtgttcactctaacgcagcgagacggaccagagccacgaggacggaaa
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        -----------------atgaaccagtttagttcaagatatttagtggca
A0A346RRN1_BCL2L1-      -----------------atgaaccagtacagttcacgttatttagtggtc
Q2TAP5_BCL2L1-01        -----------------atggagggcagcagt---agagatctggtggag
Q91828_BCL2L1-01        -----------------atggagggcagcagt---agagatctggtggag
H9GHK7_BCL2L1-01        -----------------atgtcgagcagtaac---cgagcgctcgtggtg
F6WA14_BCL2L1-01        -----------------atgtcgcacagtaac---cgggagctggtgatt
G3WKX6_BCL2L1-01        -----------------atgtctcacagtaac---cgggagctggtggtt
A0A452FHY1_BCL2L1-      -----------------atgtctcagagcaac---cgagagctggtggtt
A0A452FHY1_BCL2L1-      -----------------atgtctcagagcaac---cgagagctggtggtt
A0A3Q1LRT3_BCL2L1-      -----------------atgtctcagagcaat---cgggaactagtggtt
A0A452E1B1_BCL2L1-      -----------------atgtctcagagcaac---cgggaactagtggtt
W5PSA5_BCL2L1-01        -----------------atgtctcagagcaac---cgggaactagtggtt
G3SPN0_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
H0X6V2_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
O35843_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtc
P53563_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctggtggtt
P53563_BCL2L1-03        -----------------atgtctcagagcaac---cgggagctggtggtt
Q64373_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtc
Q64373_BCL2L1-09        -----------------atgtctcagagcaac---cgggagctggtggtc
P53563_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
Q9MYW4_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A1U7QU73_BCL2L1-      -----------------atgtctcagagcaac---cgggagctagtggtt
G3HEA7_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctagtggtt
G3HEA7_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctagtggtt
B2Z3Z4_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctagtggtt
O77737_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
G1P9D2_BCL2L1-01        -----------------atgtctcagagcaac---cgggaactggtggtt
A0A1S3EPX7_BCL2L1-      -----------------atgtctcagagcaac---cgtgagctggtggtt
A0A286Y5D6_BCL2L1-      -----------------atgtctcaaagcaac---tgggagctggtggtt
M3XA94_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
M3XA94_BCL2L1-03        -----------------atgtctcagagcaac---cgggagctggtggtt
M3XA94_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
L8J061_BCL2L1-01        -----------------atgtctcagagtaac---cgggagctggtggtt
Q05KJ0_BCL2L1-02        -----------------atgtctcagagtaac---cgggagctggtggtt
Q05KJ0_BCL2L1-01        -----------------atgtctcagagtaac---cgggagctggtggtt
A0A452FWV3_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
Q9MZS7_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A1S2ZQT6_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A3Q2H0F6_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A287CZ07_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
I3MUP5_BCL2L1-02        -----------------atgtctcagagcaac---cgggagctggtggtt
I3MUP5_BCL2L1-03        -----------------atgtctcagagcaac---cgggagctggtggtt
I3MUP5_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A250YD48_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A1L5BWY3_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A3Q2H0F6_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
E2IV76_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2J8VIH3_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
G1RER8_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      -----------------atgtctcagagcaac---cgggagctagtggtt
A0A096NV05_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5VPG2_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A0D9RJZ8_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6QFA2_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
E2IV77_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5Q6R6_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
E2IV75_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
Q76LT7_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
Q8SQ42_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
M3Z2H9_BCL2L1-01        -----------------atgtctcagagcaac---cgggagctggtggtt
A0A452SDS4_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A384D3U1_BCL2L1-      -----------------atgtctcagagcaac---cgggagctggtggtt
A0A493TIA6_BCL2L1-      -----------------atgtccagcggcaac---cgggagctggtgatc
A0A452ILL8_BCL2L1-      -----------------atgtcgaacactaac---agggaattagtgatt
A0A452ILL8_BCL2L1-      -----------------atgtcgaacactaac---agggaattagtgatt
K7F655_BCL2L1-01        -----------------atgtcgaacactaac---agggaattagtgatt
U3JSL7_BCL2L1-01        -----------------atgtacagcagtaat---cgggagttagtgatt
H0Z8G3_BCL2L1-01        -----------------atgtacagcagtaac---cgggagttagtgatt
A0A218USB3_BCL2L1-      -----------------atgtacagcagtaac---cgggagttagtgatt
A0A218USB3_BCL2L1-      -----------------atgtacagcagtaac---cgggagttagtgatt
A0A218USB3_BCL2L1-      -----------------atgtacagcagtaac---cgggagttagtgatt
A0A218USB3_BCL2L1-      -----------------atgtacagcagtaac---cgggagttagtgatt
Q4U2V6_BCL2L1-01        -----------------atgtccagcagtaac---cgggagttagtgatt
Q07816_BCL2L1-04        -----------------atgtccagcagtaac---cgggagttagtgatt
Q07816_BCL2L1-03        -----------------atgtccagcagtaac---cgggagttagtgatt
Q07816_BCL2L1-02        -----------------atgtccagcagtaac---cgggagttagtgatt
Q07816_BCL2L1-01        -----------------atgtccagcagtaac---cgggagttagtgatt
G1N5N5_BCL2L1-01        -----------------atgtccagcagtaac---cgggagttagtgatt
H3ANS8_BCL2L1-01        --------------aaaatgtcctt---caac---aggttgctggtggtg
C1BLI0_BCL2L1-01        -----------------atgtcttacagtaac---cgtgagctggtggtg
A0A3P8XFS0_BCL2L1-      -----------------atgtcttacagtaat---agggaactggtggtg
A0A3P8XFS0_BCL2L1-      -----------------atgtcttacagtaat---agggaactggtggtg
A0A286MU87_BCL2L1-      -----------------atgtcttacagtaac---agggaactggtggtg
C0HAD8_BCL2L1-01        -----------------atgtcttacagtaac---agggaactggtggtg
H3CH49_BCL2L1-01        gcgcatctacgcagaggatgtctct---aaac---agagaactggtcatt
A0A345BSW9_BCL2L1-      -----------------atgtcttactataac---agagaactagtggta
Q90Z98_BCL2L1-02        -----------------atgtcttactataac---cgagaactggtggta
Q90Z98_BCL2L1-01        -----------------atgtcttactataac---cgagaactggtggta
A0A059PJI5_BCL2L1-      -----------------atgtcttactacaac---agagaacttgtcgtg
A0A3B3ZMX9_BCL2L1-      -----------------atgtccct---caac---agagaactggtggaa
A0A3B3ZMX9_BCL2L1-      -----------------atgtccct---caac---agagaactggtggaa
D2ITA2_BCL2L1-02        tgagcattgacacaagcatgtcgatcagtaac---agagaactggtgttc
A0A3P8UWG7_BCL2L1-      -----------actttgacctttaatattaac---agaaaactggtggtc
A0A3B3QRZ2_BCL2L1-      -----------------atgtcttacagcaac---agagaactggtgatg
A0A3B1JJ42_BCL2L1-      --------------gttatgtcgtactataac---cgagaattagtggtg
A0A3B4DTL9_BCL2L1-      -----------------atgtcttactacaac---agagaactggttgtg
A0A3P8XYL5_BCL2L1-      -----------------atgacttacaacaac---aaagaactggtggca
B5XAY3_BCL2L1-01        --------------atgatgacttacaacaac---agagaactggtggtg
A0A3B3TFR4_BCL2L1-      -----------------atgtcctacagcaat---agggagctggtagag
A0A3Q3DUT7_BCL2L1-      -----------------atgtctca---aaat---cgagaactggttttg
A0A3Q3DUT7_BCL2L1-      -----------------atgtctca---aaat---cgagaactggttttg
A0A3Q3DUT7_BCL2L1-      -----------------atgtctca---aaat---cgagaactggttttg
W5MG74_BCL2L1-01        --------------aagatgtcatacagcaac---agagacctcgtcgtc
A0A3Q3WIW8_BCL2L1-      -----------------atgtctgt---aaac---agagaactggtggct
A0A2U9BY16_BCL2L1-      -----------------atgtctca---gaac---aaagaactggtggtt
A0A2U9BY16_BCL2L1-      -----------------atgtctca---gaac---aaagaactggtggtt
A0A2U9BY16_BCL2L1-      -----------------atgtctca---gaac---aaagaactggtggtt
A0A2U9BY16_BCL2L1-      -----------------atgtctca---gaac---aaagaactggtggtt
A0A2U9BY16_BCL2L1-      -------------------gacgcc---agac---aacgattttgtggag
A0A3B5PQJ0_BCL2L1-      -----------------atgtcacg---aaac---agagaactggtgctt
A0A3P9N9Y4_BCL2L1-      -----------------atgtcacg---aaac---agagaactggtgctt
A0A3B3WI27_BCL2L1-      -----------------atgtcacg---aaac---agagaactggtgctt
A0A087X9B7_BCL2L1-      -----------------atgtcacg---aaac---agagaactggtgctt
A0A3B3TUS7_BCL2L1-      -----------------atgtcacg---aaac---agagaactagtgctt
A0A3Q2FR43_BCL2L1-      -----------------atgtctca---gaac---agagaactggtcctt
A0A3Q2QPL9_BCL2L1-      -----------------atgtctca---aaac---cgagaactggtgctg
A0A3Q3B3X5_BCL2L1-      -----------------atgtctca---aaac---aaagaactggtgctt
A0A3Q0RTF8_BCL2L1-      -----------------atgtctca---aaac---agagaactggtgctt
I3IZK7_BCL2L1-01        -----------------atgtctca---aaac---agagaactggtgctt
A0A3Q4N4B5_BCL2L1-      -----------------atgtctca---aaac---agagaacttgtgctt
A0A3Q2X557_BCL2L1-      -----------------atgtctca---aaac---agagaacttgtgctt
A0A3P8P0F1_BCL2L1-      -----------------atgtctca---aaac---agagaacttgtgctt
A0A3P9D632_BCL2L1-      -----------------atgtctca---aaac---agagaacttgtgctt
A0A3P9D632_BCL2L1-      -----------------atgtctca---aaac---agagaacttgtgctt
A0A3B4FNX1_BCL2L1-      -----------------atgtctca---aaac---agagaacttgtgctt
G3NJY1_BCL2L1-01        -----------------atgtctca---aaac---agagaactggtggtt
A0A3B3DHA1_BCL2L1-      -----------------atgtcccg---caac---agagaactggttgtt
A0A3B3IB64_BCL2L1-      -----------------atgtcccg---gaac---agagaactggttgtt
A0A3P9JYH1_BCL2L1-      -----------------atgtcccg---gaac---agagaactggttgtt
C3VIT1_BCL2L1-01        -----------------atgtctca---aaac---agagaactggtggtt
A0A3B4Z3X2_BCL2L1-      -----------------atgtctca---aaac---agagaactggtggtt
A0A3B4Z3X2_BCL2L1-      -----------------atgtctca---aaac---agagaactggtggtt
A0A3Q1FR00_BCL2L1-      -----------------atgtctca---gaac---agagaactggtggtt
A0A3Q1FR00_BCL2L1-      acacattggcacgcaacatgtctca---gaac---agagaactggtggtt
A0A3Q1DHJ3_BCL2L1-      -----------------atgtctca---gaac---agagaactggtggtt
A0A3Q1DHJ3_BCL2L1-      -----------------atgtctca---gaac---agagaactggtggtt
A0A3Q1DHJ3_BCL2L1-      -----------------atgtctca---gaac---agagaactggtggtt
A0A3P8TL99_BCL2L1-      -----------------atgtctca---gaac---agagaactggtggtt
A0A3P8TL99_BCL2L1-      -----------------atgtctca---gaac---agagaactggtggtt
A0A219P0Y3_BCL2L1-      -----------------atgtgtca---aaac---agagaactggtggtt
A0A3Q3G2E1_BCL2L1-      -----------------atgtctca---aaac---agagaactagtggtt
A0A3Q3G2E1_BCL2L1-      -----------------atgtctca---aaac---agagaactagtggtt
A0A3Q3G2E1_BCL2L1-      -----------------atgtctca---aaac---agagaactagtggtt
A0A3B4V3T1_BCL2L1-      -----------------atgtctca---aaac---agagaactggtcgtt
A0A3B4XU17_BCL2L1-      -----------------atgtctca---aaac---agagaactggtcgtt
A0A3Q3IVF5_BCL2L1-      -----------------atgtctca---aaac---aaagaactggtggtt
A0A3Q3MX20_BCL2L1-      -----------------atgtctca---aaac---agggaactggtggtt
A0A3Q1GZ93_BCL2L1-      -----------------atgtctca---aaac---agagaactggtggtt
A0A3Q1GZ93_BCL2L1-      -----------------atgtctca---aaac---agagaactggtggtt
A0A3Q1GZ93_BCL2L1-      -----------------atgtctca---aaac---agagaactggtggtt
A0A0D6DR75_BCL2L1-      -----------------atgtctca---aaac---agagaactggtggtt
A0A3B3E2W4_BCL2L1-      -----------------atgtcccactgtaac---cgagagctggtgcag
A0A3P9MKK4_BCL2L1-      -----------------atgactaagtggaag---aaatcatgg------
A0A3P9MKK4_BCL2L1-      -----------------atgtcccactgtaac---agagagctggtccgg
A0A3B3I2Q5_BCL2L1-      -----------------atgactaagtggaag---aaatcatgg------
A0A3B3I2Q5_BCL2L1-      -----------------atgtcccactgtaac---agagagctggtccgg
A0A3P9I2N4_BCL2L1-      -----------------atgtcccactgtaac---agggagctggttcgg
A0A3P9I2N4_BCL2L1-      -----------------atgactaagtggaag---aaatcatgg------
A0A3B4BFZ8_BCL2L1-      -----------------atgtctcccagtaac---cgagagctggttgaa
A0A3P8VMA1_BCL2L1-      -----------------atgtcgtgcagtaac---agagaattggttaag
A0A0F7L1T6_BCL2L1-      -----------------atgtcgtataacaac---agagagctggtggag
H2U5I3_BCL2L1-01        -----------------atgtcgtataacaac---agagagctggtggag
G3P7B4_BCL2L1-01        -----------------atggcgaacattaac---agggagctggtggag
A0A3Q3FUB6_BCL2L1-      -----------------atgtcatacagtaac---agagagctggtggag
A0A3Q3X5M5_BCL2L1-      -----------------atgtcgcacagtaac---agagagctggtggag
A0A2U9BIG9_BCL2L1-      -----------------atgtcggacagtaac---agagagctggtcgag
A0A3Q1JZ46_BCL2L1-      --------atggaagaaatgtcgaacagtaac---agagagctggtggag
A0A3Q1JZ46_BCL2L1-      --------atggaagaaatgtcgaacagtaac---agagagctggtggag
A0A3Q3NFM4_BCL2L1-      -----------------atgtcgtacagtaac---agagagctggtggag
A0A3Q3NFM4_BCL2L1-      -----------------atgtcgtacagtaac---agagagctggtggag
A0A3Q3J5K3_BCL2L1-      -----------------atgtcgtacagtcac---agagagctggtggag
A0A3B4V9K8_BCL2L1-      -----------------atgtcgtacagcaac---agagagctggtggag
A0A3B4XS24_BCL2L1-      -----------------atgtcgtacagcaac---agagagctggtggag
A0A3B5B4X7_BCL2L1-      --------atggaaataatgtcgtacagtaac---agagagctagtggag
A0A3Q1EVP6_BCL2L1-      -----------------atgtcgtgcagtaac---agagagctggtggag
A0A3Q1BQA0_BCL2L1-      -----------------atgtcgtacagtaac---agagagctggtggag
A0A3P8U812_BCL2L1-      -----------------atgtcgtacagtaac---agagagctggtggag
E6ZFR0_BCL2L1-01        -----------------atgtcgtacagtaac---agagagctggtggag
A0A0B4KJI5_BCL2L1-      -----------------atgtcgtacagtaac---agagagctagtggag
A0A3Q3BEB7_BCL2L1-      -----------------atgtcacacagcaac---agagatctggtgcag
A0A3Q2C6K4_BCL2L1-      -----------------atgtcatacagtaac---agagaactggtagag
A0A3Q2NRP4_BCL2L1-      -----------------atgtcatatagtaac---agagaactggtggag
A0A3B5MGS2_BCL2L1-      -----------------atggcctacagcaac---agagaactggtggag
M4A558_BCL2L1-01        -----------------atggcctacagcaac---agagaactggtggag
A0A3P9QFB3_BCL2L1-      -----------------atgtcctacagcaac---agagaactggtggag
A0A3B3XN57_BCL2L1-      -----------------atgtcctacagcaac---agagaactggtggag
A0A087YBW4_BCL2L1-      -----------------atgtcctacagcaac---agagaactggtggag
A0A3B3VWI7_BCL2L1-      -----------------atgtcctacagcaac---agagaactggtggag
                                                                          

R4JQR8_BCL2L1-01        gactttattaat------------------gaccgacttcgaaa------
A0A346RRN1_BCL2L1-      gattttgtgaac------------------gaccgactaagaaa------
Q2TAP5_BCL2L1-01        aagtttgttagt--------------aagaaactttcccagaat------
Q91828_BCL2L1-01        aagtttgttagt--------------aagaaactttcccagaat------
H9GHK7_BCL2L1-01        gacttcctttcc--------------tacaagctgtcgcagcgg------
F6WA14_BCL2L1-01        gactttctttct--------------tacaagctctcacagaaa------
G3WKX6_BCL2L1-01        gactttctttct--------------tacaagctttcacagaag------
A0A452FHY1_BCL2L1-      gactttctctct--------------tacaagctttcccagaaa------
A0A452FHY1_BCL2L1-      gactttctctct--------------tacaagctttcccagaaa------
A0A3Q1LRT3_BCL2L1-      gactttctctct--------------tacaagctttcccagaaa------
A0A452E1B1_BCL2L1-      gactttctctct--------------tacaagtttttccagaaa------
W5PSA5_BCL2L1-01        gactttctctct--------------tacaagttttttcagaaa------
G3SPN0_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
H0X6V2_BCL2L1-01        gactttatctcc--------------tacaagctttcccagaaa------
O35843_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
P53563_BCL2L1-02        gactttctctcc--------------tacaagctctcccagaaa------
P53563_BCL2L1-03        gactttctctcc--------------tacaagctctcccagaaa------
Q64373_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
Q64373_BCL2L1-09        gactttctctcc--------------tacaagctttcccagaaa------
P53563_BCL2L1-01        gactttctctcc--------------tacaagctctcccagaaa------
Q9MYW4_BCL2L1-01        gactttctctcc--------------tacaagctttcgcagaaa------
A0A1U7QU73_BCL2L1-      gactttctctcc--------------tacaagctctcccagaaa------
G3HEA7_BCL2L1-01        gactttctctcc--------------tacaagctctcccagaaa------
G3HEA7_BCL2L1-02        gactttctctcc--------------tacaagctctcccagaaa------
B2Z3Z4_BCL2L1-01        gactttctctcc--------------tacaagttctcccagaaa------
O77737_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
G1P9D2_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
A0A1S3EPX7_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A286Y5D6_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
M3XA94_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
M3XA94_BCL2L1-03        gactttctctcc--------------tacaagctttcccagaaa------
M3XA94_BCL2L1-02        gactttctctcc--------------tacaagctttcccagaaa------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
L8J061_BCL2L1-01        gactttctctct--------------tacaagctttcccagaaa------
Q05KJ0_BCL2L1-02        gactttctctct--------------tacaagctttcccagaaa------
Q05KJ0_BCL2L1-01        gactttctctct--------------tacaagctttcccagaaa------
A0A452FWV3_BCL2L1-      gactttctctct--------------tacaagctttcccagaaa------
Q9MZS7_BCL2L1-01        gactttctctct--------------tacaagctttcccagaaa------
A0A1S2ZQT6_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A3Q2H0F6_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A287CZ07_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
I3MUP5_BCL2L1-02        gactttctctcc--------------tacaagctttcccagaaa------
I3MUP5_BCL2L1-03        gactttctctcc--------------tacaagctttcccagaaa------
I3MUP5_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
A0A250YD48_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A1L5BWY3_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A3Q2H0F6_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
E2IV76_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A2J8VIH3_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
G1RER8_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A096NV05_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A2K5VPG2_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A0D9RJZ8_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A2K6QFA2_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
E2IV77_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A2K5Q6R6_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
E2IV75_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
Q76LT7_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
Q8SQ42_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
M3Z2H9_BCL2L1-01        gactttctctcc--------------tacaagctttcccagaaa------
A0A452SDS4_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A384D3U1_BCL2L1-      gactttctctcc--------------tacaagctttcccagaaa------
A0A493TIA6_BCL2L1-      gactttgtctcc--------------tacaagctgtcgcagaaa------
A0A452ILL8_BCL2L1-      gactttctctcc--------------tacaagctatcgcagagg------
A0A452ILL8_BCL2L1-      gactttctctcc--------------tacaagctatcgcagagg------
K7F655_BCL2L1-01        gacttcctctcc--------------tacaagctatcgcagagg------
U3JSL7_BCL2L1-01        gactttgtttct--------------tacaagctctcacagaaa------
H0Z8G3_BCL2L1-01        gactttgtttcc--------------tacaagctctcacagaaa------
A0A218USB3_BCL2L1-      gactttgtttcc--------------tacaagctctcacagaaa------
A0A218USB3_BCL2L1-      gactttgtttcc--------------tacaagctctcacagaaa------
A0A218USB3_BCL2L1-      gactttgtttcc--------------tacaagctctcacagaaa------
A0A218USB3_BCL2L1-      gactttgtttcc--------------tacaagctctcacagaaa------
Q4U2V6_BCL2L1-01        gactttgtttcc--------------tacaagctctcacagaaa------
Q07816_BCL2L1-04        gactttgtttcc--------------tacaagctctcacagagg------
Q07816_BCL2L1-03        gactttgtttcc--------------tacaagctctcacagagg------
Q07816_BCL2L1-02        gactttgtttcc--------------tacaagctctcacagagg------
Q07816_BCL2L1-01        gactttgtttcc--------------tacaagctctcacagagg------
G1N5N5_BCL2L1-01        gactttgtttcc--------------tacaagctctcgcagaag------
H3ANS8_BCL2L1-01        gaccatatatcc--------------cagaagctgatgcagcgg------
C1BLI0_BCL2L1-01        ttcttcataagc--------------tataaactttcacagagg------
A0A3P8XFS0_BCL2L1-      ttttttataaac--------------tataaactgtcccagagg------
A0A3P8XFS0_BCL2L1-      ttttttataaac--------------tataaactgtcccagagg------
A0A286MU87_BCL2L1-      ttttttataagc--------------tatagactgtcccagagg------
C0HAD8_BCL2L1-01        ttttttataagc--------------tatagactgtcccagagg------
H3CH49_BCL2L1-01        ttctacattaaa--------------tacaaactttcccaaaga------
A0A345BSW9_BCL2L1-      ttttttattaaa--------------tataaactctcgcagagg------
Q90Z98_BCL2L1-02        ttttttatcaaa--------------tataaactctcgcagagg------
Q90Z98_BCL2L1-01        ttttttatcaaa--------------tataaactctcgcagagg------
A0A059PJI5_BCL2L1-      tacttcatcaag--------------tacaagctctcccagaaa------
A0A3B3ZMX9_BCL2L1-      ttctacatccag--------------tacaaactgtctcagcgg------
A0A3B3ZMX9_BCL2L1-      ttctacatccag--------------tacaaactgtctcagcgg------
D2ITA2_BCL2L1-02        ttcttcctaagc--------------cataaactgtctcagagg------
A0A3P8UWG7_BCL2L1-      gactacatacag--------------tataaactttcccagagg------
A0A3B3QRZ2_BCL2L1-      gacttcataacg--------------tataaactgtcccagagg------
A0A3B1JJ42_BCL2L1-      tactttattaag--------------tacaaactctcacagagg------
A0A3B4DTL9_BCL2L1-      tactttatcaag--------------tacaaactctcccagagg------
A0A3P8XYL5_BCL2L1-      tactatattacc--------------tataaactatcccagaga------
B5XAY3_BCL2L1-01        tactatattacc--------------tataaactatcacagagg------
A0A3B3TFR4_BCL2L1-      tactttgtcagc--------------tataagctggcccagaag------
A0A3Q3DUT7_BCL2L1-      ttttacattagg--------------tacaaactttcccagaaa------
A0A3Q3DUT7_BCL2L1-      ttttacattagg--------------tacaaactttcccagaaa------
A0A3Q3DUT7_BCL2L1-      ttttacattagg--------------tacaaactttcccagaaa------
W5MG74_BCL2L1-01        tactacatcaac--------------tataaactctcgcagaag------
A0A3Q3WIW8_BCL2L1-      tactacataaac--------------tataaactctcccataga------
A0A2U9BY16_BCL2L1-      ttctacatacag--------------tataaactctcccagagg------
A0A2U9BY16_BCL2L1-      ttctacatacag--------------tataaactctcccagagg------
A0A2U9BY16_BCL2L1-      ttctacatacag--------------tataaactctcccagagg------
A0A2U9BY16_BCL2L1-      ttctacatacag--------------tataaactctcccagagg------
A0A2U9BY16_BCL2L1-      aacaccattcaaggcctgagtggattcgtcagcttttctgtaggtttggc
A0A3B5PQJ0_BCL2L1-      ttctacattaag--------------tttaaactgtctcagagg------
A0A3P9N9Y4_BCL2L1-      ttctacattaag--------------tttaaactatctcagagg------
A0A3B3WI27_BCL2L1-      ttctacattaag--------------tttaaactgtctcagagg------
A0A087X9B7_BCL2L1-      ttctacattaag--------------tttaaactgtctcagagg------
A0A3B3TUS7_BCL2L1-      ttctacattaag--------------tttaaactgtctcagagg------
A0A3Q2FR43_BCL2L1-      ttctacattaag--------------ttcaaactgtctcagagg------
A0A3Q2QPL9_BCL2L1-      tcctacgtcaag--------------tttaaactgtctcagagg------
A0A3Q3B3X5_BCL2L1-      ttctatattatg--------------tataaactgtcacagaga------
A0A3Q0RTF8_BCL2L1-      ttctacataacg--------------tataaactatcccagaga------
I3IZK7_BCL2L1-01        ttctacataagg--------------tataaactctcccagaga------
A0A3Q4N4B5_BCL2L1-      ttctacataagg--------------tataaactctcccagaga------
A0A3Q2X557_BCL2L1-      ttctacataagg--------------tataaactctcccagaga------
A0A3P8P0F1_BCL2L1-      ttctacataagg--------------tataaactctcccagaga------
A0A3P9D632_BCL2L1-      ttctacataagg--------------tataaactctcccagaga------
A0A3P9D632_BCL2L1-      ttctacataagg--------------tataaactctcccagaga------
A0A3B4FNX1_BCL2L1-      ttctacataagg--------------tataaactctcccagaga------
G3NJY1_BCL2L1-01        ttctacataaac--------------tataaactctcccagagg------
A0A3B3DHA1_BCL2L1-      ttctacgtgaag--------------tataaactgtctcagagg------
A0A3B3IB64_BCL2L1-      ttctacgtgaag--------------tataaactgtctcagagg------
A0A3P9JYH1_BCL2L1-      ttctacgtgaag--------------tataaactgtctcagagg------
C3VIT1_BCL2L1-01        ttctacataaag--------------tataaactctcccagaga------
A0A3B4Z3X2_BCL2L1-      tactacataaag--------------tataaactctcccagaga------
A0A3B4Z3X2_BCL2L1-      tactacataaag--------------tataaactctcccagaga------
A0A3Q1FR00_BCL2L1-      ttctacataaag--------------tataaactgtcccagaga------
A0A3Q1FR00_BCL2L1-      ttctacataaag--------------tataaactgtcccagaga------
A0A3Q1DHJ3_BCL2L1-      ttctacataaag--------------tataaactctcccagaga------
A0A3Q1DHJ3_BCL2L1-      ttctacataaag--------------tataaactctcccagaga------
A0A3Q1DHJ3_BCL2L1-      ttctacataaag--------------tataaactctcccagaga------
A0A3P8TL99_BCL2L1-      ttctacataaag--------------tataaactctcccagaga------
A0A3P8TL99_BCL2L1-      ttctacataaag--------------tataaactctcccagaga------
A0A219P0Y3_BCL2L1-      tgctacataaaa--------------tataaactaacccagaga------
A0A3Q3G2E1_BCL2L1-      ttctacataacc--------------tataaattctctcagaga------
A0A3Q3G2E1_BCL2L1-      ttctacataacc--------------tataaattctctcagaga------
A0A3Q3G2E1_BCL2L1-      ttctacataacc--------------tataaattctctcagaga------
A0A3B4V3T1_BCL2L1-      ttctacataaag--------------cataagctctcccagaga------
A0A3B4XU17_BCL2L1-      ttctacataaag--------------tataagctctcccagaga------
A0A3Q3IVF5_BCL2L1-      ttctacataaca--------------tataaactctcccagaaa------
A0A3Q3MX20_BCL2L1-      ttctacataaaa--------------tataaactctcccagaga------
A0A3Q1GZ93_BCL2L1-      ttctacataaca--------------tataaactatcccagaga------
A0A3Q1GZ93_BCL2L1-      ttctacataaca--------------tataaactatcccagaga------
A0A3Q1GZ93_BCL2L1-      ttctacataaca--------------tataaactatcccagaga------
A0A0D6DR75_BCL2L1-      tactacataaca--------------tataaactgtcggagaaa------
A0A3B3E2W4_BCL2L1-      ttctatttaggc--------------tataagatgtcatccaga------
A0A3P9MKK4_BCL2L1-      ---catctgacc--------------tacaagatgtcatgcagg------
A0A3P9MKK4_BCL2L1-      ttctatttagcc--------------tacaagatgtcatgcagg------
A0A3B3I2Q5_BCL2L1-      ---catctgacc--------------tataagatgtcatgcagg------
A0A3B3I2Q5_BCL2L1-      ttctatttagcc--------------tataagatgtcatgcagg------
A0A3P9I2N4_BCL2L1-      ttctatttagcc--------------tataagatgtcatgcagg------
A0A3P9I2N4_BCL2L1-      ---catctgacc--------------tataagatgtcatgcagg------
A0A3B4BFZ8_BCL2L1-      ttcttcataagc--------------tacaaattatcacagaaa------
A0A3P8VMA1_BCL2L1-      ttctttttaggt--------------tataagctttctcagagg------
A0A0F7L1T6_BCL2L1-      cacttcttaaga--------------tacaagctgtctcagagg------
H2U5I3_BCL2L1-01        cacttcttaaga--------------tacaagctgtctcagagg------
G3P7B4_BCL2L1-01        ttcttcctaagc--------------tacaagctgtctcagaag------
A0A3Q3FUB6_BCL2L1-      ttcttcataagc--------------tacaaactgtctcagagg------
A0A3Q3X5M5_BCL2L1-      ttctttataagc--------------tacaaactgactcaaaag------
A0A2U9BIG9_BCL2L1-      ttcttcatcggc--------------tataagctgtcccagagg------
A0A3Q1JZ46_BCL2L1-      ttcttcataatg--------------tacaaactgtctcaaaga------
A0A3Q1JZ46_BCL2L1-      ttcttcataatg--------------tacaaactgtctcaaaga------
A0A3Q3NFM4_BCL2L1-      ttctttattagc--------------tacaagctgtctcagaag------
A0A3Q3NFM4_BCL2L1-      ttctttattagc--------------tacaagctgtctcagaag------
A0A3Q3J5K3_BCL2L1-      ttctatataagc--------------tacaagttgtctcagaga------
A0A3B4V9K8_BCL2L1-      ttcttcataagc--------------tacaaactgtctcaaagt------
A0A3B4XS24_BCL2L1-      ttcttcataagc--------------tacaaactgtctcaaagt------
A0A3B5B4X7_BCL2L1-      ttctttataagc--------------tacaagctgtctcaaagg------
A0A3Q1EVP6_BCL2L1-      ttctttataagc--------------tacaagctgtctcaaagg------
A0A3Q1BQA0_BCL2L1-      ttctttgtaagc--------------gacaagctgtctcaaagg------
A0A3P8U812_BCL2L1-      ttctttgtaagc--------------tacaagctgtctcaaagg------
E6ZFR0_BCL2L1-01        ttctttataagc--------------tataaactgtctcagagg------
A0A0B4KJI5_BCL2L1-      tcctttttaagc--------------tacaaactgtctcagagg------
A0A3Q3BEB7_BCL2L1-      ttctacataagc--------------tataagttgtctcagagg------
A0A3Q2C6K4_BCL2L1-      ttctatataagc--------------tacaaactgtctcagaca------
A0A3Q2NRP4_BCL2L1-      ttctacataagc--------------tacaaattgtcccagaca------
A0A3B5MGS2_BCL2L1-      ttctacataagc--------------tacaaattgtctcagaga------
M4A558_BCL2L1-01        ttctacataagc--------------tacaaattgtctcagaga------
A0A3P9QFB3_BCL2L1-      ttctacataagc--------------tacaaattgtctcagaga------
A0A3B3XN57_BCL2L1-      ttctacataagc--------------tacaaattgtctcagaga------
A0A087YBW4_BCL2L1-      ttctacataagc--------------tacaaattgtctcagaga------
A0A3B3VWI7_BCL2L1-      ttctacataagc--------------tacaaattgtctcagaga------
                                                                          

R4JQR8_BCL2L1-01        -----------acat-----------------------------------
A0A346RRN1_BCL2L1-      -----------gaat-----------------------------------
Q2TAP5_BCL2L1-01        -----------gaagcct--------------------------gcagga
Q91828_BCL2L1-01        -----------gaagcct--------------------------gcagga
H9GHK7_BCL2L1-01        -----------ggccaca--------------------------gctggc
F6WA14_BCL2L1-01        -----------ggataca--------------------------attgga
G3WKX6_BCL2L1-01        -----------ggataca--------------------------attgga
A0A452FHY1_BCL2L1-      -----------ggattca--------------------------gctgga
A0A452FHY1_BCL2L1-      -----------ggattca--------------------------gctgga
A0A3Q1LRT3_BCL2L1-      -----------ggataca--------------------------gctgga
A0A452E1B1_BCL2L1-      -----------ggataca--------------------------gctgga
W5PSA5_BCL2L1-01        -----------ggataca--------------------------gctgga
G3SPN0_BCL2L1-01        -----------ggataca--------------------------gttgga
H0X6V2_BCL2L1-01        -----------ggataca--------------------------gctgga
O35843_BCL2L1-01        -----------ggataca--------------------------gctgga
P53563_BCL2L1-02        -----------ggataca--------------------------gctgga
P53563_BCL2L1-03        -----------ggataca--------------------------gctgga
Q64373_BCL2L1-01        -----------ggataca--------------------------gctgga
Q64373_BCL2L1-09        -----------ggataca--------------------------gctgga
P53563_BCL2L1-01        -----------ggataca--------------------------gctgga
Q9MYW4_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A1U7QU73_BCL2L1-      -----------ggataca--------------------------gctgga
G3HEA7_BCL2L1-01        -----------ggataca--------------------------gctgga
G3HEA7_BCL2L1-02        -----------ggataca--------------------------gctgga
B2Z3Z4_BCL2L1-01        -----------ggataca--------------------------gctgga
O77737_BCL2L1-01        -----------ggataca--------------------------gctgga
G1P9D2_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A1S3EPX7_BCL2L1-      -----------ggataca--------------------------gctgga
A0A286Y5D6_BCL2L1-      -----------ggataca--------------------------gctgga
M3XA94_BCL2L1-01        -----------ggataca--------------------------gctgga
M3XA94_BCL2L1-03        -----------ggataca--------------------------gctgga
M3XA94_BCL2L1-02        -----------ggataca--------------------------gctgga
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      -----------ggataca--------------------------gctgga
L8J061_BCL2L1-01        -----------ggataca--------------------------gctgga
Q05KJ0_BCL2L1-02        -----------ggataca--------------------------gctgga
Q05KJ0_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A452FWV3_BCL2L1-      -----------ggataca--------------------------gctgga
Q9MZS7_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A1S2ZQT6_BCL2L1-      -----------ggataca--------------------------gctgga
A0A3Q2H0F6_BCL2L1-      -----------ggataca--------------------------actgga
A0A287CZ07_BCL2L1-      -----------ggataca--------------------------gctgga
I3MUP5_BCL2L1-02        -----------ggataca--------------------------gctgga
I3MUP5_BCL2L1-03        -----------ggataca--------------------------gctgga
I3MUP5_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A250YD48_BCL2L1-      -----------ggataca--------------------------gctgga
A0A1L5BWY3_BCL2L1-      -----------ggataca--------------------------gctgga
A0A3Q2H0F6_BCL2L1-      -----------ggataca--------------------------actgga
E2IV76_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -----------ggataca--------------------------gctgga
A0A2J8VIH3_BCL2L1-      -----------ggataca--------------------------gctgga
G1RER8_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      -----------ggataca--------------------------gctgga
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      -----------ggataca--------------------------gctgga
A0A096NV05_BCL2L1-      -----------ggataca--------------------------gctgga
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -----------ggataca--------------------------gctgga
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----------ggataca--------------------------gctgga
A0A2K5VPG2_BCL2L1-      -----------ggataca--------------------------gctgga
A0A0D9RJZ8_BCL2L1-      -----------ggataca--------------------------gctgga
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      -----------ggataca--------------------------gctgga
A0A2K6QFA2_BCL2L1-      -----------ggataca--------------------------gctgga
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      -----------ggataca--------------------------gctgga
E2IV77_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      -----------ggataca--------------------------gctgga
A0A2K5Q6R6_BCL2L1-      -----------ggataca--------------------------gctgga
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -----------ggataca--------------------------gctgga
E2IV75_BCL2L1-01        -----------ggataca--------------------------gctgga
Q76LT7_BCL2L1-01        -----------ggataca--------------------------gctgga
Q8SQ42_BCL2L1-01        -----------ggataca--------------------------gctgga
M3Z2H9_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A452SDS4_BCL2L1-      -----------ggataca--------------------------gctgga
A0A384D3U1_BCL2L1-      -----------ggataca--------------------------gctgga
A0A493TIA6_BCL2L1-      -----------ggctaca--------------------------gctgga
A0A452ILL8_BCL2L1-      -----------ggataca--------------------------gctgga
A0A452ILL8_BCL2L1-      -----------ggataca--------------------------gctgga
K7F655_BCL2L1-01        -----------ggacaca--------------------------gctgga
U3JSL7_BCL2L1-01        -----------ggctaca--------------------------gctgga
H0Z8G3_BCL2L1-01        -----------ggataca--------------------------gctgga
A0A218USB3_BCL2L1-      -----------ggataca--------------------------gctgga
A0A218USB3_BCL2L1-      -----------ggataca--------------------------gctgga
A0A218USB3_BCL2L1-      -----------ggataca--------------------------gctgga
A0A218USB3_BCL2L1-      -----------ggataca--------------------------gctgga
Q4U2V6_BCL2L1-01        -----------ggataca--------------------------gctgga
Q07816_BCL2L1-04        -----------gggcact--------------------------gctgga
Q07816_BCL2L1-03        -----------gggcact--------------------------gctgga
Q07816_BCL2L1-02        -----------gggcact--------------------------gctgga
Q07816_BCL2L1-01        -----------gggcact--------------------------gctgga
G1N5N5_BCL2L1-01        -----------gggcact--------------------------gctgga
H3ANS8_BCL2L1-01        -----------ggataccagtggagggaggttggtgagcaggaccacggt
C1BLI0_BCL2L1-01        -----------aattatc------------ctatttctca----gttggg
A0A3P8XFS0_BCL2L1-      -----------aattatt------------cctgttgtga----attgga
A0A3P8XFS0_BCL2L1-      -----------aattatt------------cctgttgtga----attgga
A0A286MU87_BCL2L1-      -----------aattatt------------catgttgtca----attggg
C0HAD8_BCL2L1-01        -----------aattatt------------catgttgtca----attggg
H3CH49_BCL2L1-01        -----------aactacc------------ctttgagtca----cattgt
A0A345BSW9_BCL2L1-      -----------aactacc------------cctgcaacca----cattgg
Q90Z98_BCL2L1-02        -----------aactacc------------cctgcaacca----cattgg
Q90Z98_BCL2L1-01        -----------aactacc------------cctgcaacca----cattgg
A0A059PJI5_BCL2L1-      -----------aactacc------------cctgcgacca----catcgg
A0A3B3ZMX9_BCL2L1-      -----------gactgtc------------ct-------------ctggg
A0A3B3ZMX9_BCL2L1-      -----------gactgtc------------ctctgcagca----cctggg
D2ITA2_BCL2L1-02        -----------aattaca------------ggcctattcc----cttcca
A0A3P8UWG7_BCL2L1-      -----------aactttc------------ccgtccacca----cctggg
A0A3B3QRZ2_BCL2L1-      -----------aacta---------------caatggcca----ctttgg
A0A3B1JJ42_BCL2L1-      -----------aactatc------------ctactaatca----catcgg
A0A3B4DTL9_BCL2L1-      -----------aactatc------------cctataacca----cattgg
A0A3P8XYL5_BCL2L1-      -----------aactacc------------ccatcaatca----cactgg
B5XAY3_BCL2L1-01        -----------gactacc------------ccttcaacca----catgga
A0A3B3TFR4_BCL2L1-      -----------aattact------------ccattgccca----catcat
A0A3Q3DUT7_BCL2L1-      -----------aactacc------------cgctcaacca----catagg
A0A3Q3DUT7_BCL2L1-      -----------aactacc------------cgctcaacca----catagg
A0A3Q3DUT7_BCL2L1-      -----------aactacc------------cgctcaacca----catagg
W5MG74_BCL2L1-01        -----------aactact------------cctgggacca----gttcag
A0A3Q3WIW8_BCL2L1-      -----------ggctgtc------------ctctcaacca----catggg
A0A2U9BY16_BCL2L1-      -----------aaatatc------------ctctcaacca----tatggg
A0A2U9BY16_BCL2L1-      -----------aaatatc------------ctctcaacca----tatggg
A0A2U9BY16_BCL2L1-      -----------aaatatc------------ctctcaacca----tatggg
A0A2U9BY16_BCL2L1-      -----------aaatatc------------ctctcaacca----tatggg
A0A2U9BY16_BCL2L1-      tttcacccccaaagtctc------------ctctggatat----cagctg
A0A3B5PQJ0_BCL2L1-      -----------aactatc------------cgatccaaca----catatt
A0A3P9N9Y4_BCL2L1-      -----------aactatc------------cgatccaaca----catatt
A0A3B3WI27_BCL2L1-      -----------aactatc------------cgatccaaca----catatt
A0A087X9B7_BCL2L1-      -----------aactatc------------cgatccaaca----catatt
A0A3B3TUS7_BCL2L1-      -----------aactatc------------cgatccaaca----catatt
A0A3Q2FR43_BCL2L1-      -----------aactatc------------ccgtcaacca----cataat
A0A3Q2QPL9_BCL2L1-      -----------aactatc------------ccgtcaacca----cataat
A0A3Q3B3X5_BCL2L1-      -----------aactatc------------ctgtcaatca----cataat
A0A3Q0RTF8_BCL2L1-      -----------aactatc------------ctctcaacca----catagt
I3IZK7_BCL2L1-01        -----------aactatc------------ctctcaacca----catagt
A0A3Q4N4B5_BCL2L1-      -----------aactatc------------ctctcaacca----catagt
A0A3Q2X557_BCL2L1-      -----------aactatc------------ctctcaacca----catagt
A0A3P8P0F1_BCL2L1-      -----------aactatc------------ctctcaacca----catagt
A0A3P9D632_BCL2L1-      -----------aactatc------------ctctcaacca----catagt
A0A3P9D632_BCL2L1-      -----------aactatc------------ctctcaacca----catagt
A0A3B4FNX1_BCL2L1-      -----------aactatc------------ctctcaacca----catagt
G3NJY1_BCL2L1-01        -----------aacttac------------ccctcaacca----catagg
A0A3B3DHA1_BCL2L1-      -----------aactacc------------ccctcaacca----catagt
A0A3B3IB64_BCL2L1-      -----------aactacc------------ccctcaacca----catagt
A0A3P9JYH1_BCL2L1-      -----------aactacc------------ccctcaacca----catagt
C3VIT1_BCL2L1-01        -----------aactatc------------ctctcaacca----catagt
A0A3B4Z3X2_BCL2L1-      -----------aactatc------------ccctcaatca----catggt
A0A3B4Z3X2_BCL2L1-      -----------aactatc------------ccctcaatca----catggt
A0A3Q1FR00_BCL2L1-      -----------aactatc------------ccctcaacca----catggt
A0A3Q1FR00_BCL2L1-      -----------aactatc------------ccctcaacca----catggt
A0A3Q1DHJ3_BCL2L1-      -----------aactatc------------ccctcaacca----catggt
A0A3Q1DHJ3_BCL2L1-      -----------aactatc------------ccctcaacca----catggt
A0A3Q1DHJ3_BCL2L1-      -----------aactatc------------ccctcaacca----catggt
A0A3P8TL99_BCL2L1-      -----------aactatc------------ccctcaacca----catggt
A0A3P8TL99_BCL2L1-      -----------aactatc------------ccctcaacca----catggt
A0A219P0Y3_BCL2L1-      -----------aactatc------------ctctcaacca----catggg
A0A3Q3G2E1_BCL2L1-      -----------aattatc------------ctcttaatca----catgga
A0A3Q3G2E1_BCL2L1-      -----------aattatc------------ctcttaatca----catgga
A0A3Q3G2E1_BCL2L1-      -----------aattatc------------ctcttaatca----catgga
A0A3B4V3T1_BCL2L1-      -----------aactatc------------ctctcaccca----catgga
A0A3B4XU17_BCL2L1-      -----------aactatc------------ctctcaccca----catgga
A0A3Q3IVF5_BCL2L1-      -----------aactatc------------ctctcagcca----cttggg
A0A3Q3MX20_BCL2L1-      -----------aactatc------------ctctcatcta----cataga
A0A3Q1GZ93_BCL2L1-      -----------aactatc------------ctctcaacca----cttggg
A0A3Q1GZ93_BCL2L1-      -----------aactatc------------ctctcaacca----cttggg
A0A3Q1GZ93_BCL2L1-      -----------aactatc------------ctctcaacca----cttggg
A0A0D6DR75_BCL2L1-      -----------aactatc------------ctctcaacca----cttggg
A0A3B3E2W4_BCL2L1-      -----------gactatc------------ctgtgtccct----gctgaa
A0A3P9MKK4_BCL2L1-      -----------gactatc------------ctgtgtccct----gctgaa
A0A3P9MKK4_BCL2L1-      -----------gactatc------------ctgtgtccct----gctgaa
A0A3B3I2Q5_BCL2L1-      -----------gactatc------------ctgtgtccct----gctgaa
A0A3B3I2Q5_BCL2L1-      -----------gactatc------------ctgtgtccct----gctgaa
A0A3P9I2N4_BCL2L1-      -----------gactatc------------ctgtgtccct----gctgaa
A0A3P9I2N4_BCL2L1-      -----------gactatc------------ctgtgtccct----gctgaa
A0A3B4BFZ8_BCL2L1-      -----------aactacc------------caagttcgct----gcttat
A0A3P8VMA1_BCL2L1-      -----------aactacc------------cagaatctct----tctgat
A0A0F7L1T6_BCL2L1-      -----------aactacc------------catcttctct----gctgag
H2U5I3_BCL2L1-01        -----------aactacc------------caacttctct----gctgag
G3P7B4_BCL2L1-01        -----------aaccacc------------caacctctct----gttgag
A0A3Q3FUB6_BCL2L1-      -----------aactatc------------caacctatgt----gctgag
A0A3Q3X5M5_BCL2L1-      -----------aactacc------------caacctctct----gttaag
A0A2U9BIG9_BCL2L1-      -----------aactacc------------cgacctctct----actgag
A0A3Q1JZ46_BCL2L1-      -----------aaccacc------------cagcctctct----tctgag
A0A3Q1JZ46_BCL2L1-      -----------aaccacc------------cagcctctct----tctgag
A0A3Q3NFM4_BCL2L1-      -----------aactacc------------cgacctctct----gctgag
A0A3Q3NFM4_BCL2L1-      -----------aactacc------------cgacctctct----gctgag
A0A3Q3J5K3_BCL2L1-      -----------aactact------------caacctctct----gctgag
A0A3B4V9K8_BCL2L1-      -----------aactgcc------------caacctcact----gctgag
A0A3B4XS24_BCL2L1-      -----------aactgcc------------caacctcact----gctgag
A0A3B5B4X7_BCL2L1-      -----------aactatc------------caacgtctct----gctgag
A0A3Q1EVP6_BCL2L1-      -----------aactatc------------cgatgtctct----gctgag
A0A3Q1BQA0_BCL2L1-      -----------aactatc------------cgacgtctct----gctgag
A0A3P8U812_BCL2L1-      -----------aactatc------------cgacgtctct----gctgag
E6ZFR0_BCL2L1-01        -----------aaccacc------------caacctctct----actgag
A0A0B4KJI5_BCL2L1-      -----------aactatc------------caactgccct----gctgag
A0A3Q3BEB7_BCL2L1-      -----------aactgtt------------cgaagtctct----gctgat
A0A3Q2C6K4_BCL2L1-      -----------aactgcc------------caaactctct----gctgag
A0A3Q2NRP4_BCL2L1-      -----------aactgtc------------caaactctct----gctgag
A0A3B5MGS2_BCL2L1-      -----------aactatt------------caagctctct----gctgag
M4A558_BCL2L1-01        -----------aactatt------------caagctctct----gctgag
A0A3P9QFB3_BCL2L1-      -----------aactatt------------caagctctct----gctgag
A0A3B3XN57_BCL2L1-      -----------aactatt------------caagctctct----gctgag
A0A087YBW4_BCL2L1-      -----------aactatt------------caagctctct----gctgag
A0A3B3VWI7_BCL2L1-      -----------aactatt------------caagctctct----gctgag
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        agttctccaataat------------------------------------
Q91828_BCL2L1-01        agttctccaataat------------------------------------
H9GHK7_BCL2L1-01        atgagattga-gatg-----ga----------------------------
F6WA14_BCL2L1-01        gtcagtttgaagat------ga----------------------------
G3WKX6_BCL2L1-01        gtcagtttgaagat------ga----------------------------
A0A452FHY1_BCL2L1-      g-------------------------------------------------
A0A452FHY1_BCL2L1-      g-------------------------------------------------
A0A3Q1LRT3_BCL2L1-      gtcagtttagtg--------------------------------------
A0A452E1B1_BCL2L1-      gtcagtttagtgatatggaaga----------------------------
W5PSA5_BCL2L1-01        gtcagtttagtgacatggaaga----------------------------
G3SPN0_BCL2L1-01        gtcagtttagtgatgtggagga----------------------------
H0X6V2_BCL2L1-01        gtcagtttagcgatgtggaaga----------------------------
O35843_BCL2L1-01        gtcagtttagtgatgttgaaga----------------------------
P53563_BCL2L1-02        gtcagtttagcgatgtcgaaga----------------------------
P53563_BCL2L1-03        gtcagtttagcgatgtcgaaga----------------------------
Q64373_BCL2L1-01        gtcagtttagtgatgtcgaaga----------------------------
Q64373_BCL2L1-09        gtcagtttagtgatgtcgaaga----------------------------
P53563_BCL2L1-01        gtcagtttagcgatgtcgaaga----------------------------
Q9MYW4_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
A0A1U7QU73_BCL2L1-      gtcagtttagtgatgtcgaaga----------------------------
G3HEA7_BCL2L1-01        gtcagtttagtgatgtcgaaga----------------------------
G3HEA7_BCL2L1-02        gtcagtttagtgatgtcgaaga----------------------------
B2Z3Z4_BCL2L1-01        gtcagtttagtgatgtcgaaga----------------------------
O77737_BCL2L1-01        gtcagtttactgatgtggaaga----------------------------
G1P9D2_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
A0A1S3EPX7_BCL2L1-      gtcagtttagcgatgtggaaga----------------------------
A0A286Y5D6_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
M3XA94_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
M3XA94_BCL2L1-03        gtcagtttagtgatgtggaaga----------------------------
M3XA94_BCL2L1-02        gtcagtttagtgatgtggaaga----------------------------
A0A1U7T4L4_BCL2L1-      ------------atgtggaaga----------------------------
A0A1U7T4L4_BCL2L1-      gtcagtttagcgatgtggaaga----------------------------
L8J061_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
Q05KJ0_BCL2L1-02        gtcagtttagtgatgtggaaga----------------------------
Q05KJ0_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
A0A452FWV3_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
Q9MZS7_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
A0A1S2ZQT6_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A3Q2H0F6_BCL2L1-      gtcagtttagtgacgtggaaga----------------------------
A0A287CZ07_BCL2L1-      gtcagtttagcgatgtggaaga----------------------------
I3MUP5_BCL2L1-02        gtcagtttagcgatgtggaaga----------------------------
I3MUP5_BCL2L1-03        gtcagtttagcgatgtggaaga----------------------------
I3MUP5_BCL2L1-01        gtcagtttagcgatgtggaaga----------------------------
A0A250YD48_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A1L5BWY3_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A3Q2H0F6_BCL2L1-      gtcagtttagtgacgtggaaga----------------------------
E2IV76_BCL2L1-01        gtcagtttatcgatgcagaaga----------------------------
A0A2K6G3C5_BCL2L1-      ------------atgcagaaga----------------------------
A0A2K6G3C5_BCL2L1-      gtcagtttatcgatgcagaaga----------------------------
A0A2J8VIH3_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
G1RER8_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
A0A2R8Z9D7_BCL2L1-      ------------atgtggaaga----------------------------
A0A2R8Z9D7_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A2K5H963_BCL2L1-      ------------atgtggaaga----------------------------
A0A2K5H963_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A096NV05_BCL2L1-      gtcaatttagtgatgtggaaga----------------------------
A0A096NV05_BCL2L1-      ------------atgtggaaga----------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ------------atgtggaaga----------------------------
A0A2K5M8B1_BCL2L1-      gtcaatttagtgatgtggaaga----------------------------
A0A2K5VPG2_BCL2L1-      ------------atgtggaaga----------------------------
A0A2K5YR37_BCL2L1-      ------------atgtggaaga----------------------------
A0A2K5YR37_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A2K5VPG2_BCL2L1-      gtcaatttagtgatgtggaaga----------------------------
A0A0D9RJZ8_BCL2L1-      gtcaatttagtgatgtggaaga----------------------------
I7GKS6_BCL2L1-01        ------------atgtggaaga----------------------------
A0A2K6QFA2_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A2K6QFA2_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A2K6QFA2_BCL2L1-      ------------atgtggaaga----------------------------
A0A2K6UWY8_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
E2IV77_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
A0A2K6UWY8_BCL2L1-      ------------atgtggaaga----------------------------
A0A2K5Q6R6_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A2K5Q6R6_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A2K5Q6R6_BCL2L1-      ------------atgtggaaga----------------------------
F7IT34_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
A0A2K5EBP4_BCL2L1-      ------------atgtggaaga----------------------------
A0A2K5EBP4_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
E2IV75_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
Q76LT7_BCL2L1-01        gtcagtttagtgatgtggaaga----------------------------
Q8SQ42_BCL2L1-01        gtcggtttagtgatgtggaaga----------------------------
M3Z2H9_BCL2L1-01        gtcagtttagtgatgcagaaga----------------------------
A0A452SDS4_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A384D3U1_BCL2L1-      gtcagtttagtgatgtggaaga----------------------------
A0A493TIA6_BCL2L1-      gccagctggaggaagaggatga----------------------------
A0A452ILL8_BCL2L1-      gtcggttcgaaggggaggatga----------------------------
A0A452ILL8_BCL2L1-      gtcggttcgaaggggaggatga----------------------------
K7F655_BCL2L1-01        gctggttcgagggggaggatga----------------------------
U3JSL7_BCL2L1-01        gtcagctggaggaggaggatga----------------------------
H0Z8G3_BCL2L1-01        gtcagctggaagaggaggatga----------------------------
A0A218USB3_BCL2L1-      gtcagctggaagaggaggatga----------------------------
A0A218USB3_BCL2L1-      gtcagctggaagaggaggatga----------------------------
A0A218USB3_BCL2L1-      gtcagctggaagaggaggatga----------------------------
A0A218USB3_BCL2L1-      gtcagctggaagaggaggatga----------------------------
Q4U2V6_BCL2L1-01        gtcagctggaagaggaggatga----------------------------
Q07816_BCL2L1-04        gcgagctggaggaagaggatga----------------------------
Q07816_BCL2L1-03        gcgagctggaggaagaggatga----------------------------
Q07816_BCL2L1-02        gcgagctggaggaagaggatga----------------------------
Q07816_BCL2L1-01        gcgagctggaggaagaggatga----------------------------
G1N5N5_BCL2L1-01        gcgagctggaggaagaggatga----------------------------
H3ANS8_BCL2L1-01        ggtggaggagaccgcgcgaggg----------------------------
C1BLI0_BCL2L1-01        actggaagatgccagtgaacgg----------------------------
A0A3P8XFS0_BCL2L1-      gctggagggtgcaagtggacgg----------------------------
A0A3P8XFS0_BCL2L1-      gctggagggtgcaagtggacgg----------------------------
A0A286MU87_BCL2L1-      gctggagggtgcaagtggacgg----------------------------
C0HAD8_BCL2L1-01        gctggagggtgcaagtggacgg----------------------------
H3CH49_BCL2L1-01        ag-------agccttcaagtag----------------------------
A0A345BSW9_BCL2L1-      gcttacagaagacacaaatcgg----------------------------
Q90Z98_BCL2L1-02        acttacagaagacacaaatcgg----------------------------
Q90Z98_BCL2L1-01        acttacagaagacacaaatcgg----------------------------
A0A059PJI5_BCL2L1-      cctcacgg-aagaggtgaacgg----------------------------
A0A3B3ZMX9_BCL2L1-      gctggagg----------atgg----------------------------
A0A3B3ZMX9_BCL2L1-      gctggggg----------acag----------------------------
D2ITA2_BCL2L1-02        gcccgagggggcaggtgagggg----------------------------
A0A3P8UWG7_BCL2L1-      actcggtg-attctccaaacag----------------------------
A0A3B3QRZ2_BCL2L1-      gcttcctgaagacaggggtcgg----------------------------
A0A3B1JJ42_BCL2L1-      actcatggaagaaacaaatcga----------------------------
A0A3B4DTL9_BCL2L1-      gcttatggaagacacaaatcgg----------------------------
A0A3P8XYL5_BCL2L1-      gctcacaggagcatttgatcgg----------------------------
B5XAY3_BCL2L1-01        gctcacggaagcccagaatcgg----------------------------
A0A3B3TFR4_BCL2L1-      acaggacgaagccgacgagcag----------------------------
A0A3Q3DUT7_BCL2L1-      actcagac-aggcattgaacag----------------------------
A0A3Q3DUT7_BCL2L1-      actcagac-aggcattgaacag----------------------------
A0A3Q3DUT7_BCL2L1-      actcagac-aggcattgaacag----------------------------
W5MG74_BCL2L1-01        cctggagg----------gcag----------------------------
A0A3Q3WIW8_BCL2L1-      actcatag-agcctcccaacag----------------------------
A0A2U9BY16_BCL2L1-      acttaatg-agcctccgaacag----------------------------
A0A2U9BY16_BCL2L1-      acttaatg-agcctccgaacag----------------------------
A0A2U9BY16_BCL2L1-      acttaatg-agcctccgaacag----------------------------
A0A2U9BY16_BCL2L1-      acttaatg-agcctccgaacag----------------------------
A0A2U9BY16_BCL2L1-      acc--atg-gttgtctgaacagaggaaagcagggagacagcctggcacag
A0A3B5PQJ0_BCL2L1-      gcccaacg-agcccccggacgg----------------------------
A0A3P9N9Y4_BCL2L1-      gcccaatg-agcccccggacag----------------------------
A0A3B3WI27_BCL2L1-      gcccaatg-agcccccggacag----------------------------
A0A087X9B7_BCL2L1-      gcccaatg-agcccccggacag----------------------------
A0A3B3TUS7_BCL2L1-      gcccaatg-agcccccggacag----------------------------
A0A3Q2FR43_BCL2L1-      gctcaacg-agccgcccaacgg----------------------------
A0A3Q2QPL9_BCL2L1-      gctcaacg-agccgcccagcga----------------------------
A0A3Q3B3X5_BCL2L1-      actcagtg-atcctccgaatag----------------------------
A0A3Q0RTF8_BCL2L1-      actcaacg-agccttcgaacag----------------------------
I3IZK7_BCL2L1-01        actcaacg-agcctttgaacag----------------------------
A0A3Q4N4B5_BCL2L1-      actcaacg-agccttcgaacag----------------------------
A0A3Q2X557_BCL2L1-      actcaacg-agccttcgaacag----------------------------
A0A3P8P0F1_BCL2L1-      actcaacg-agccttcgaacag----------------------------
A0A3P9D632_BCL2L1-      actcaacg-agccttcgaacag----------------------------
A0A3P9D632_BCL2L1-      actcaacg-agccttcgaacag----------------------------
A0A3B4FNX1_BCL2L1-      actcaacg-agccttcgaacag----------------------------
G3NJY1_BCL2L1-01        gctgtccg-agcctcccaacag----------------------------
A0A3B3DHA1_BCL2L1-      gctcaatg-agtctccgaacag----------------------------
A0A3B3IB64_BCL2L1-      gctcaatg-agtctccgaacag----------------------------
A0A3P9JYH1_BCL2L1-      gctcaatg-agtctccgaacag----------------------------
C3VIT1_BCL2L1-01        gctcaatg-agcctccgaacag----------------------------
A0A3B4Z3X2_BCL2L1-      gctcaatg-aggctcccaacag----------------------------
A0A3B4Z3X2_BCL2L1-      gctcaatg-aggctcccaacag----------------------------
A0A3Q1FR00_BCL2L1-      gctgaacg-aggctcccaacag----------------------------
A0A3Q1FR00_BCL2L1-      gctgaacg-aggctcccaacag----------------------------
A0A3Q1DHJ3_BCL2L1-      gctgaatg-aggctcccagcag----------------------------
A0A3Q1DHJ3_BCL2L1-      gctgaatg-aggctcccagcag----------------------------
A0A3Q1DHJ3_BCL2L1-      gctgaatg-aggctcccagcag----------------------------
A0A3P8TL99_BCL2L1-      gctgaatg-aggctcccagcag----------------------------
A0A3P8TL99_BCL2L1-      gctgaatg-aggctcccagcag----------------------------
A0A219P0Y3_BCL2L1-      actcatag-agcctccaaacag----------------------------
A0A3Q3G2E1_BCL2L1-      actcttag-agcctccaaacag----------------------------
A0A3Q3G2E1_BCL2L1-      actcttag-agcctccaaacag----------------------------
A0A3Q3G2E1_BCL2L1-      actcttag-agcctccaaacag----------------------------
A0A3B4V3T1_BCL2L1-      actcaatg-agtctcccaacag----------------------------
A0A3B4XU17_BCL2L1-      actcaatg-agtctcccaacag----------------------------
A0A3Q3IVF5_BCL2L1-      actaaatg-agtctccaaacag----------------------------
A0A3Q3MX20_BCL2L1-      actcaatg-agcaacagaacag----------------------------
A0A3Q1GZ93_BCL2L1-      actcaatg-agactcccaacag----------------------------
A0A3Q1GZ93_BCL2L1-      actcaatg-agactcccaacag----------------------------
A0A3Q1GZ93_BCL2L1-      actcaatg-agactcccaacag----------------------------
A0A0D6DR75_BCL2L1-      actcagtg-agcctccaaacag----------------------------
A0A3B3E2W4_BCL2L1-      acccacagatgatgggggacaa----------------------------
A0A3P9MKK4_BCL2L1-      gcccacagacgatgggggagaa----------------------------
A0A3P9MKK4_BCL2L1-      gcccacagacgatgggggagaa----------------------------
A0A3B3I2Q5_BCL2L1-      gcccacagacgatgggggagaa----------------------------
A0A3B3I2Q5_BCL2L1-      gcccacagacgatgggggagaa----------------------------
A0A3P9I2N4_BCL2L1-      gcccacagatgatgggggagaa----------------------------
A0A3P9I2N4_BCL2L1-      gcccacagatgatgggggagaa----------------------------
A0A3B4BFZ8_BCL2L1-      gtcagaccccgctagggtccag----------------------------
A0A3P8VMA1_BCL2L1-      gttgaggattgggggagaacag----------------------------
A0A0F7L1T6_BCL2L1-      accagaggatactgatggaagg----------------------------
H2U5I3_BCL2L1-01        accagaggatactgatggaagg----------------------------
G3P7B4_BCL2L1-01        gccggaggatgccggcggaagg----------------------------
A0A3Q3FUB6_BCL2L1-      gtcagaggatgctggtgaaagg----------------------------
A0A3Q3X5M5_BCL2L1-      gccagaagataccggtgggagg----------------------------
A0A2U9BIG9_BCL2L1-      gccggaggatgctggtggaagg----------------------------
A0A3Q1JZ46_BCL2L1-      gccagatgataccggtgga-------------------------------
A0A3Q1JZ46_BCL2L1-      gccagatgataccggtgga-------------------------------
A0A3Q3NFM4_BCL2L1-      gccagaagatgctggtggaagg----------------------------
A0A3Q3NFM4_BCL2L1-      gccagaagatgctggtggaagg----------------------------
A0A3Q3J5K3_BCL2L1-      gccggaaaacgctggtggaagg----------------------------
A0A3B4V9K8_BCL2L1-      gccagaggatgctggtggaagg----------------------------
A0A3B4XS24_BCL2L1-      gccagaggatgctggtggaagg----------------------------
A0A3B5B4X7_BCL2L1-      gccggaggatgctgcaggaagg----------------------------
A0A3Q1EVP6_BCL2L1-      gccagaggatgctggaggaagg----------------------------
A0A3Q1BQA0_BCL2L1-      gccagaggatgctggaggaagg----------------------------
A0A3P8U812_BCL2L1-      gccagaggatgctgaaggaagg----------------------------
E6ZFR0_BCL2L1-01        gccggagaatgccggtgaaagg----------------------------
A0A0B4KJI5_BCL2L1-      gccagatgatgctggtggaagg----------------------------
A0A3Q3BEB7_BCL2L1-      gccggaggttgccggtgaaagg----------------------------
A0A3Q2C6K4_BCL2L1-      gtcggaggtcactggtggccgg----------------------------
A0A3Q2NRP4_BCL2L1-      gtccgaggttgctggcgatagg----------------------------
A0A3B5MGS2_BCL2L1-      gtccgaggttgccgggggcagg----------------------------
M4A558_BCL2L1-01        gtccgaggttgccgggggcagg----------------------------
A0A3P9QFB3_BCL2L1-      gtccgaggccgacggggccagg----------------------------
A0A3B3XN57_BCL2L1-      gtccgaggccgacggggccagg----------------------------
A0A087YBW4_BCL2L1-      gtccgaggccgacggggccagg----------------------------
A0A3B3VWI7_BCL2L1-      gtccgaggccgacggggccagg----------------------------
                                                                          

R4JQR8_BCL2L1-01        ---------------------------------------ggaatg-----
A0A346RRN1_BCL2L1-      ---------------------------------------ggatta-----
Q2TAP5_BCL2L1-01        ----------------------------------------cccca---a-
Q91828_BCL2L1-01        -----------------------------------------ccca---a-
H9GHK7_BCL2L1-01        --------------gagcgggga---------------------g---ga
F6WA14_BCL2L1-01        --------------gaacaggactgag------------gttcta---ga
G3WKX6_BCL2L1-01        --------------gaacaggactgag------------gcctca---ga
A0A452FHY1_BCL2L1-      ----------------------------------------cctca---ga
A0A452FHY1_BCL2L1-      ----------------------------------------cctca---ga
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------gaacagaactgag------------acccta---ga
W5PSA5_BCL2L1-01        --------------gaacagaactgag------------acccta---ga
G3SPN0_BCL2L1-01        --------------gaataggactggg------------gcctcg---ga
H0X6V2_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
O35843_BCL2L1-01        --------------gaataggactgag------------gcccca---ga
P53563_BCL2L1-02        --------------gaacaggactgaa------------gcccca---ga
P53563_BCL2L1-03        --------------gaacaggactgaa------------gcccca---ga
Q64373_BCL2L1-01        --------------gaataggactgag------------gcccca---ga
Q64373_BCL2L1-09        --------------gaataggactgag------------gcccca---ga
P53563_BCL2L1-01        --------------gaacaggactgaa------------gcccca---ga
Q9MYW4_BCL2L1-01        --------------gaacaggactgag------------gccccg---ga
A0A1U7QU73_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
G3HEA7_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
G3HEA7_BCL2L1-02        --------------gaacaggactgag------------gcccca---ga
B2Z3Z4_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
O77737_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
G1P9D2_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
A0A1S3EPX7_BCL2L1-      --------------gagcaggactgag------------gaccca---ga
A0A286Y5D6_BCL2L1-      --------------gaacaggactgaa------------ggccca---ga
M3XA94_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
M3XA94_BCL2L1-03        --------------gaacagaactgag------------gcccca---ga
M3XA94_BCL2L1-02        --------------gaacagaactgag------------gcccca---ga
A0A1U7T4L4_BCL2L1-      --------------gaacaggactgag------------gcctca---ga
A0A1U7T4L4_BCL2L1-      --------------gaacaggactgag------------gcctca---ga
L8J061_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
Q05KJ0_BCL2L1-02        --------------gaacagaactgag------------gcccca---ga
Q05KJ0_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
A0A452FWV3_BCL2L1-      --------------gaacagaactgag------------gcccca---ga
Q9MZS7_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
A0A1S2ZQT6_BCL2L1-      --------------gaacagaactgag------------gcctca---ga
A0A3Q2H0F6_BCL2L1-      --------------gaacagaactgag------------gcccca---ga
A0A287CZ07_BCL2L1-      --------------gaacaggactgaa------------gcccca---ga
I3MUP5_BCL2L1-02        --------------gaacaggactgaa------------gcccca---ga
I3MUP5_BCL2L1-03        --------------gaacaggactgaa------------gcccca---ga
I3MUP5_BCL2L1-01        --------------gaacaggactgaa------------gcccca---ga
A0A250YD48_BCL2L1-      --------------gaataggactgag------------gcccca---ga
A0A1L5BWY3_BCL2L1-      --------------gaataggactgag------------gcccca---ga
A0A3Q2H0F6_BCL2L1-      --------------gaacagaactgag------------gcccca---ga
E2IV76_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
A0A2K6G3C5_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K6G3C5_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2J8VIH3_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
G1RER8_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
A0A2R8Z9D7_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2R8Z9D7_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5H963_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5H963_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A096NV05_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A096NV05_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5M8B1_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5VPG2_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5YR37_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5YR37_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5VPG2_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A0D9RJZ8_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
I7GKS6_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
A0A2K6QFA2_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K6QFA2_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K6QFA2_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K6UWY8_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
E2IV77_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
A0A2K6UWY8_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5Q6R6_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5Q6R6_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5Q6R6_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
F7IT34_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
A0A2K5EBP4_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
A0A2K5EBP4_BCL2L1-      --------------gaacaggactgag------------gcccca---ga
E2IV75_BCL2L1-01        --------------gaacaggactgag------------gcccca---ga
Q76LT7_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
Q8SQ42_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
M3Z2H9_BCL2L1-01        --------------gaacagaactgag------------gcccca---ga
A0A452SDS4_BCL2L1-      --------------gaacagaactgag------------gcccca---ga
A0A384D3U1_BCL2L1-      --------------gaacagaactgag------------gcccca---ga
A0A493TIA6_BCL2L1-      --------------gaacaggactgag------------ttggct---tc
A0A452ILL8_BCL2L1-      --------------gatcaggactgat------------tctgca---ga
A0A452ILL8_BCL2L1-      --------------gatcaggactgat------------tctgca---ga
K7F655_BCL2L1-01        --------------gatcaggactgag------------gctgca---ga
U3JSL7_BCL2L1-01        --------------gaacaggactgac------------tttgca---gg
H0Z8G3_BCL2L1-01        --------------gaacaggactgac------------tttgca---gg
A0A218USB3_BCL2L1-      --------------gaacaggactgac------------tttgca---gg
A0A218USB3_BCL2L1-      --------------gaacaggactgac------------tttgca---gg
A0A218USB3_BCL2L1-      --------------gaacaggactgac------------tttgca---gg
A0A218USB3_BCL2L1-      --------------gaacaggactgac------------tttgca---gg
Q4U2V6_BCL2L1-01        --------------gaacaggactgac------------tttgca---gg
Q07816_BCL2L1-04        --------------gaacaggactgac------------actgca---gc
Q07816_BCL2L1-03        --------------gaacaggactgac------------actgca---gc
Q07816_BCL2L1-02        --------------gaacaggactgac------------actgca---gc
Q07816_BCL2L1-01        --------------gaacaggactgac------------actgca---gc
G1N5N5_BCL2L1-01        --------------gaacaggactgac------------actgca---gc
H3ANS8_BCL2L1-01        -------------aagcacagactccc------------gaggag---gg
C1BLI0_BCL2L1-01        ---------------------actaat------------gttgac-----
A0A3P8XFS0_BCL2L1-      ---------------------actgag------------ggagaa---ga
A0A3P8XFS0_BCL2L1-      ---------------------actgag------------ggagaa---ga
A0A286MU87_BCL2L1-      ---------------------actgac------------ggagat---ga
C0HAD8_BCL2L1-01        ---------------------actgag------------ggagat---ga
H3CH49_BCL2L1-01        --------------------gactgaa-----------------------
A0A345BSW9_BCL2L1-      ---------------------actgat------------ggggccgaaga
Q90Z98_BCL2L1-02        ---------------------actgat------------ggggctgaaga
Q90Z98_BCL2L1-01        ---------------------actgat------------ggggctgaaga
A0A059PJI5_BCL2L1-      ---------------------ccaggt------------ggcgga--aga
A0A3B3ZMX9_BCL2L1-      --------------------tacggag-----attgacacagaga---ga
A0A3B3ZMX9_BCL2L1-      --------------------ga--------------gcacacaga---gt
D2ITA2_BCL2L1-02        ---------------------actgat-----------------------
A0A3P8UWG7_BCL2L1-      --------------------gactgat------------ggggaa---ga
A0A3B3QRZ2_BCL2L1-      ---------------------acagag------------ggctcgggtca
A0A3B1JJ42_BCL2L1-      ---------------------actgaa------------gggggccagga
A0A3B4DTL9_BCL2L1-      ---------------------actgaa------------gggggtcaggc
A0A3P8XYL5_BCL2L1-      ---------------------actgag------------ggggga---ga
B5XAY3_BCL2L1-01        ---------------------actgag------------gtggga---ca
A0A3B3TFR4_BCL2L1-      ---------------------acaggg------------ggaggt---ga
A0A3Q3DUT7_BCL2L1-      --------------------gactgat------------ggcagg---ga
A0A3Q3DUT7_BCL2L1-      --------------------gactgat------------ggcagg---ga
A0A3Q3DUT7_BCL2L1-      --------------------gactgat------------ggcagg---ga
W5MG74_BCL2L1-01        --------------------gaccgga------------ggcgct---ga
A0A3Q3WIW8_BCL2L1-      --------------------gactgag------------gggggg---ca
A0A2U9BY16_BCL2L1-      --------------------gactgat------------cggggg---ga
A0A2U9BY16_BCL2L1-      --------------------gactgat------------cggggg---ga
A0A2U9BY16_BCL2L1-      --------------------gactgat------------cggggg---ga
A0A2U9BY16_BCL2L1-      --------------------gactgat------------cggggg---ga
A0A2U9BY16_BCL2L1-      cgagcattcactctaacacagactgat------------cggggg---ga
A0A3B5PQJ0_BCL2L1-      --------------------caccgct------------gccggg---ga
A0A3P9N9Y4_BCL2L1-      --------------------caccgctgccagggacgcggccggg---ga
A0A3B3WI27_BCL2L1-      --------------------caccgctgctggggacgcggccggg---ga
A0A087X9B7_BCL2L1-      --------------------caccgctgctggggacgcggccggg---ga
A0A3B3TUS7_BCL2L1-      --------------------caccgctgctggggacgcggccggg---ga
A0A3Q2FR43_BCL2L1-      --------------------caccggc------------gcccag---gg
A0A3Q2QPL9_BCL2L1-      --------------------cggcggc------------gccagg---ga
A0A3Q3B3X5_BCL2L1-      --------------------aactgat------------gcaggg---ga
A0A3Q0RTF8_BCL2L1-      --------------------gactgat------------gggggg---gc
I3IZK7_BCL2L1-01        --------------------gactgat------------gggggg---gc
A0A3Q4N4B5_BCL2L1-      --------------------gactgat------------gggggg---gc
A0A3Q2X557_BCL2L1-      --------------------gactgat------------gggggg---gc
A0A3P8P0F1_BCL2L1-      --------------------gactgat------------gggggg---gc
A0A3P9D632_BCL2L1-      --------------------gactgat------------gggggg---gc
A0A3P9D632_BCL2L1-      --------------------gactgat------------gggggg---gc
A0A3B4FNX1_BCL2L1-      --------------------gactgat------------gggggg---gc
G3NJY1_BCL2L1-01        --------------------gactggc------------gggggggtaga
A0A3B3DHA1_BCL2L1-      --------------------gactgct------------gcgggg---ga
A0A3B3IB64_BCL2L1-      --------------------gactgct------------gcgggg---ga
A0A3P9JYH1_BCL2L1-      --------------------gactgct------------gcgggg---ga
C3VIT1_BCL2L1-01        --------------------gactggt------------gccggg---ga
A0A3B4Z3X2_BCL2L1-      --------------------gactgac------------gggggg---ga
A0A3B4Z3X2_BCL2L1-      --------------------gactgac------------gggggg---ga
A0A3Q1FR00_BCL2L1-      --------------------gactgat------------gggggg---ga
A0A3Q1FR00_BCL2L1-      --------------------gactgat------------gggggg---ga
A0A3Q1DHJ3_BCL2L1-      --------------------gactgac------------gggggg---ga
A0A3Q1DHJ3_BCL2L1-      --------------------gactgac------------gggggg---ga
A0A3Q1DHJ3_BCL2L1-      --------------------gactgac------------gggggg---ga
A0A3P8TL99_BCL2L1-      --------------------gactgac------------gggggg---ga
A0A3P8TL99_BCL2L1-      --------------------gactgac------------gggggg---ga
A0A219P0Y3_BCL2L1-      --------------------gactgat------------gggggg---ga
A0A3Q3G2E1_BCL2L1-      --------------------gactgat------------ggggcg---gg
A0A3Q3G2E1_BCL2L1-      --------------------gactgat------------ggggcg---gg
A0A3Q3G2E1_BCL2L1-      --------------------gactgat------------ggggcg---gg
A0A3B4V3T1_BCL2L1-      --------------------gactgat------------ggcggg---ga
A0A3B4XU17_BCL2L1-      --------------------gactgat------------ggcggg---ga
A0A3Q3IVF5_BCL2L1-      --------------------gactgat------------ggagag---ga
A0A3Q3MX20_BCL2L1-      --------------------gactgat------------ggggga---ga
A0A3Q1GZ93_BCL2L1-      --------------------gactgat------------gggggg---ga
A0A3Q1GZ93_BCL2L1-      --------------------gactgat------------gggggg---ga
A0A3Q1GZ93_BCL2L1-      --------------------gactgat------------gggggg---ga
A0A0D6DR75_BCL2L1-      --------------------gactgat------------ggaggg---ga
A0A3B3E2W4_BCL2L1-      ---------------------actgca------------g---------a
A0A3P9MKK4_BCL2L1-      ---------------------actgaa------------g---------a
A0A3P9MKK4_BCL2L1-      ---------------------actgaa------------g---------a
A0A3B3I2Q5_BCL2L1-      ---------------------actgaa------------g---------a
A0A3B3I2Q5_BCL2L1-      ---------------------actgaa------------g---------a
A0A3P9I2N4_BCL2L1-      ---------------------actgaa------------g---------a
A0A3P9I2N4_BCL2L1-      ---------------------actgaa------------g---------a
A0A3B4BFZ8_BCL2L1-      ---------------------tgtgag------------ggcaac---aa
A0A3P8VMA1_BCL2L1-      ---------------------cgtgaa------------ggtgag---ga
A0A0F7L1T6_BCL2L1-      ---------------------acagag------------ggagaa---aa
H2U5I3_BCL2L1-01        ---------------------acagag------------ggagaa---aa
G3P7B4_BCL2L1-01        ---------------------acggag------------ggagac---aa
A0A3Q3FUB6_BCL2L1-      ---------------------actgag------------ggagac---at
A0A3Q3X5M5_BCL2L1-      ---------------------actgaa------------ggagac---aa
A0A2U9BIG9_BCL2L1-      ---------------------actgag------------ggagac---aa
A0A3Q1JZ46_BCL2L1-      ------------------------gtg------------ggagac---ag
A0A3Q1JZ46_BCL2L1-      ------------------------gtg------------ggagac---ag
A0A3Q3NFM4_BCL2L1-      ---------------------acagag------------ggagac---at
A0A3Q3NFM4_BCL2L1-      ---------------------acagag------------ggagac---at
A0A3Q3J5K3_BCL2L1-      ---------------------actgag------------ggagac---ag
A0A3B4V9K8_BCL2L1-      ---------------------actgag------------ggagac---aa
A0A3B4XS24_BCL2L1-      ---------------------actgag------------ggagac---aa
A0A3B5B4X7_BCL2L1-      ---------------------actgag------------ggagac---aa
A0A3Q1EVP6_BCL2L1-      ---------------------actgat------------ggggac---aa
A0A3Q1BQA0_BCL2L1-      ---------------------actgat------------ggggac---aa
A0A3P8U812_BCL2L1-      ---------------------actgat------------ggggac---aa
E6ZFR0_BCL2L1-01        ---------------------actgag------------ggagac---aa
A0A0B4KJI5_BCL2L1-      ---------------------actgag------------gcagac---aa
A0A3Q3BEB7_BCL2L1-      ---------------------accgag---------------------aa
A0A3Q2C6K4_BCL2L1-      ---------------------accgag------------ggagac---aa
A0A3Q2NRP4_BCL2L1-      ---------------------accgag------------ggggac---aa
A0A3B5MGS2_BCL2L1-      ---------------------accaat------------tgggaa---gg
M4A558_BCL2L1-01        ---------------------accaat------------tgggaa---gg
A0A3P9QFB3_BCL2L1-      ---------------------accaat------------tgggac---gg
A0A3B3XN57_BCL2L1-      ---------------------accaat------------tgggac---gg
A0A087YBW4_BCL2L1-      ---------------------accaat------------tgggat---gg
A0A3B3VWI7_BCL2L1-      ---------------------accaat------------tgggat---gg
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        ag-------------------cgatggagccagcaaacgagac-------
F6WA14_BCL2L1-01        ag-------------------gggc------------agagat-------
G3WKX6_BCL2L1-01        ag-------------------ggac------------agagat-------
A0A452FHY1_BCL2L1-      ag-------------------ggacaaaatcagatatggaaac-------
A0A452FHY1_BCL2L1-      ag-------------------ggacaaaatcagatatggaaac-------
A0A3Q1LRT3_BCL2L1-      -----------------------------tcagatatggaaac-------
A0A452E1B1_BCL2L1-      ag-------------------ggacagaatcagatatggaaac-------
W5PSA5_BCL2L1-01        ag-------------------ggacagaatcagatatggaaac-------
G3SPN0_BCL2L1-01        ag-------------------gcactgaatccgagatggagat-------
H0X6V2_BCL2L1-01        ag-------------------ggaatgaatcagagctggagac-------
O35843_BCL2L1-01        ag-------------------aaactgaagcagagagggagac-------
P53563_BCL2L1-02        ag-------------------aaactgaaccagaaagggagac-------
P53563_BCL2L1-03        ag-------------------aaactgaaccagaaagggagac-------
Q64373_BCL2L1-01        ag-------------------aaactgaagcagagagggagac-------
Q64373_BCL2L1-09        ag-------------------aaactgaagcagagagggagac-------
P53563_BCL2L1-01        ag-------------------aaactgaaccagaaagggagac-------
Q9MYW4_BCL2L1-01        ag-------------------ggactggaccagagatggagac-------
A0A1U7QU73_BCL2L1-      ag-------------------gagccgaatcagagagggagac-------
G3HEA7_BCL2L1-01        ag-------------------gaactgaatcagagagggagac-------
G3HEA7_BCL2L1-02        ag-------------------gaactgaatcagagagggagac-------
B2Z3Z4_BCL2L1-01        ag-------------------gaactgaatcagagagggagac-------
O77737_BCL2L1-01        ag-------------------ggactgaatcagaagcggaaac-------
G1P9D2_BCL2L1-01        ag-------------------ggactgaatcagaggtggagac-------
A0A1S3EPX7_BCL2L1-      ag-------------------gaactgaatcggagatggagac-------
A0A286Y5D6_BCL2L1-      ag-------------------ggactgaatcagagatggagac-------
M3XA94_BCL2L1-01        ag-------------------ggactgaatcagagatggagac-------
M3XA94_BCL2L1-03        ag-------------------ggactgaatcagagatggagac-------
M3XA94_BCL2L1-02        ag-------------------ggactgaatcagagatggagac-------
A0A1U7T4L4_BCL2L1-      ag-------------------ggactgagtcggagatggagac-------
A0A1U7T4L4_BCL2L1-      ag-------------------ggactgagtcggagatggagac-------
L8J061_BCL2L1-01        ag-------------------ggacagaatcagatatggaaac-------
Q05KJ0_BCL2L1-02        ag-------------------ggacagaatcagatatggaaac-------
Q05KJ0_BCL2L1-01        ag-------------------ggacagaatcagatatggaaac-------
A0A452FWV3_BCL2L1-      ag-------------------ggacagaatcagatatggaaac-------
Q9MZS7_BCL2L1-01        ag-------------------ggacagaatcagatatggaaac-------
A0A1S2ZQT6_BCL2L1-      ag-------------------gaactgaatcagagatggaaac-------
A0A3Q2H0F6_BCL2L1-      ag-------------------ggactgaatcagagatggagac-------
A0A287CZ07_BCL2L1-      ag-------------------ggactgaatcagaggtggagac-------
I3MUP5_BCL2L1-02        ag-------------------ggactgaatcagaggtggagac-------
I3MUP5_BCL2L1-03        ag-------------------ggactgaatcagaggtggagac-------
I3MUP5_BCL2L1-01        ag-------------------ggactgaatcagaggtggagac-------
A0A250YD48_BCL2L1-      ag-------------------ggattgaatcagaggtggagac-------
A0A1L5BWY3_BCL2L1-      ag-------------------ggattgaatcagaggtggagac-------
A0A3Q2H0F6_BCL2L1-      ag-------------------ggactgaatcagagatggagac-------
E2IV76_BCL2L1-01        ag-------------------ggactgaatcggagatggaaac-------
A0A2K6G3C5_BCL2L1-      ag-------------------cgactgaatcggagatggagac-------
A0A2K6G3C5_BCL2L1-      ag-------------------cgactgaatcggagatggagac-------
A0A2J8VIH3_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
G1RER8_BCL2L1-01        ag-------------------ggactgaatcggagatggagac-------
A0A2R8Z9D7_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2R8Z9D7_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K5H963_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K5H963_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A096NV05_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A096NV05_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
Q2PFS6_BCL2L1-01        -----------------------------------atggagac-------
A0A2K5M8B1_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K5M8B1_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K5VPG2_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K5YR37_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K5YR37_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K5VPG2_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A0D9RJZ8_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
I7GKS6_BCL2L1-01        ag-------------------ggactgaatcggagatggagac-------
A0A2K6QFA2_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K6QFA2_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K6QFA2_BCL2L1-      ag-------------------ggactgaatcggagatggagac-------
A0A2K6UWY8_BCL2L1-      ag-------------------ggactgattcggagatggagac-------
E2IV77_BCL2L1-01        ag-------------------ggactgattcggagatggagac-------
A0A2K6UWY8_BCL2L1-      ag-------------------ggactgattcggagatggagac-------
A0A2K5Q6R6_BCL2L1-      ag-------------------ggactgattcggagatggagac-------
A0A2K5Q6R6_BCL2L1-      ag-------------------ggactgattcggagatggagac-------
A0A2K5Q6R6_BCL2L1-      ag-------------------ggactgattcggagatggagac-------
F7IT34_BCL2L1-01        ag-------------------ggactgattcggagatggagac-------
A0A2K5EBP4_BCL2L1-      ag-------------------ggactgattcggagatggagac-------
A0A2K5EBP4_BCL2L1-      ag-------------------ggactgattcggagatggagac-------
E2IV75_BCL2L1-01        ag-------------------ggactgattcggagatggagac-------
Q76LT7_BCL2L1-01        ag-------------------ggactgaatcagagatggagac-------
Q8SQ42_BCL2L1-01        ag-------------------ggactgaatcagagatggagac-------
M3Z2H9_BCL2L1-01        ag-------------------ggactgaatcagagatggagac-------
A0A452SDS4_BCL2L1-      ag-------------------gaactgaatcagagatggagac-------
A0A384D3U1_BCL2L1-      ag-------------------gaactgaatcagagatggagac-------
A0A493TIA6_BCL2L1-      cg-------------------aggccgc---cgcggtg------------
A0A452ILL8_BCL2L1-      ag-------------------aggct------gagatggc----------
A0A452ILL8_BCL2L1-      ag-------------------aggct------gagatggc----------
K7F655_BCL2L1-01        ag-------------------aggcg------gagatggc----------
U3JSL7_BCL2L1-01        gg-------------------aggagga---cgagatgga----------
H0Z8G3_BCL2L1-01        gg-------------------aggagga---cgagatgga----------
A0A218USB3_BCL2L1-      gg-------------------aggagga---cgagatgga----------
A0A218USB3_BCL2L1-      gg-------------------aggagga---cgagatgga----------
A0A218USB3_BCL2L1-      gg-------------------aggagga---cgagatgga----------
A0A218USB3_BCL2L1-      gg-------------------aggagga---cgagatgga----------
Q4U2V6_BCL2L1-01        gg-------------------aggagga---cgagatgga----------
Q07816_BCL2L1-04        tg-------------------aggca------gagatgga----------
Q07816_BCL2L1-03        tg-------------------aggca------gagatgga----------
Q07816_BCL2L1-02        tg-------------------aggca------gagatgga----------
Q07816_BCL2L1-01        tg-------------------aggca------gagatgga----------
G1N5N5_BCL2L1-01        ag-------------------aggca------gagatgga----------
H3ANS8_BCL2L1-01        ggccattccaggcatggacccacccaacggcagccaccctcat-------
C1BLI0_BCL2L1-01        --------------------------------------aagac-------
A0A3P8XFS0_BCL2L1-      ggctactgcaaatgggtctgtggggaacggcaggaa--------------
A0A3P8XFS0_BCL2L1-      ggctactgcaaatgggtctgtggggaacggcaggaa--------------
A0A286MU87_BCL2L1-      ggccattgcaaatgggtctgtggggaactaccggaa--------------
C0HAD8_BCL2L1-01        cgccattgcaaatgggtctgtgg---------ggaa--------------
H3CH49_BCL2L1-01        ------------------------gggcagtttgga--accac-------
A0A345BSW9_BCL2L1-      gaat-----ggtg--------agggggcggcaggaacgacgac-------
Q90Z98_BCL2L1-02        gaat-----ggcg--------agggggcagcaggagcgacaac-------
Q90Z98_BCL2L1-01        gaat-----ggcg--------agggggcagcaggagcgacaac-------
A0A059PJI5_BCL2L1-      gaac-----gcggtggga---gcgggagagtcg-----gagac-------
A0A3B3ZMX9_BCL2L1-      gaca-----gggaccttc---tgggactgggggaca--ggagc-------
A0A3B3ZMX9_BCL2L1-      gaca-----cggagcatc---ttggacttggggata--ggggc-------
D2ITA2_BCL2L1-02        ---------------------gaggacaagtc------------------
A0A3P8UWG7_BCL2L1-      ggca-----gggttgggc---gcagagcagcggaca--agtac-------
A0A3B3QRZ2_BCL2L1-      ggcc-----gatgggcgcgagggggttatggtaaca--gcaac-------
A0A3B1JJ42_BCL2L1-      agcg-----gaggggaat---gcagaggcggccggg--gtgac-------
A0A3B4DTL9_BCL2L1-      ggca-----gaggagaac---gcagagggggcggcg--gtgac-------
A0A3P8XYL5_BCL2L1-      ggtg-----gaag--------aggtggcagcagtca---ccat-------
B5XAY3_BCL2L1-01        ggtg-----gaag--------ggggtgcggcagtcc---taac-------
A0A3B3TFR4_BCL2L1-      gg-------------------gcgaagcagcaggcgctgtggc-------
A0A3Q3DUT7_BCL2L1-      ggaa-----gcctcaggcgaggaggagcagcgggta--cagac-------
A0A3Q3DUT7_BCL2L1-      ggaa-----gcctcaggcgaggaggagcagcgggta--cagac-------
A0A3Q3DUT7_BCL2L1-      ggaa-----gcctcaggcgaggaggagcagcgggta--cagac-------
W5MG74_BCL2L1-01        ggcg-----gtgggttcg---gggagcccgaacgca--gagga-------
A0A3Q3WIW8_BCL2L1-      ggca-----gtgtcagat---gaggaacagcgggta--gcgac-------
A0A2U9BY16_BCL2L1-      ggca-----ggtttgggg---gaggaacagcagaca--gcgcc-------
A0A2U9BY16_BCL2L1-      ggca-----ggtttgggg---gaggaacagcagaca--gcgcc-------
A0A2U9BY16_BCL2L1-      ggca-----ggtttgggg---gaggaacagcagaca--gcgcc-------
A0A2U9BY16_BCL2L1-      ggca-----ggtttgggg---gaggaacagcagaca--gcgcc-------
A0A2U9BY16_BCL2L1-      ggca-----ggtttgggg---gaggaacagcagaca--gcgcc-------
A0A3B5PQJ0_BCL2L1-      cgtg-----gggatggac---gacgagcagacgtta--gagac-------
A0A3P9N9Y4_BCL2L1-      cggg-----gggatggac---gacgagcagacgttg--gagac-------
A0A3B3WI27_BCL2L1-      cgcg-----gggatggac---gacgagcagacgttg--gagac-------
A0A087X9B7_BCL2L1-      cgcg-----gggatggac---gacgagcagacgttg--gagac-------
A0A3B3TUS7_BCL2L1-      cgcg-----gggatggac---gacgagcagacgttg--gagac-------
A0A3Q2FR43_BCL2L1-      ggcg-----gagcaggac---gacgagcgtacgccg--gagac-------
A0A3Q2QPL9_BCL2L1-      cgca-----gagtctgac---gaggagcagacggcg--gagac-------
A0A3Q3B3X5_BCL2L1-      tgca-----gggttggag---gacgcagagatgaca--gagac-------
A0A3Q0RTF8_BCL2L1-      agca-----gggttggat---gaggaacagcgaata--gatac-------
I3IZK7_BCL2L1-01        ggcg-----gggttggat---gaggaacagcgaata--gacac-------
A0A3Q4N4B5_BCL2L1-      agcg-----gggttggat---gaggaacagcgaata--gacac-------
A0A3Q2X557_BCL2L1-      agcg-----gggttggat---gaggaacagcgaata--gacac-------
A0A3P8P0F1_BCL2L1-      agcg-----gggttggat---gaggaacagcgaata--gacac-------
A0A3P9D632_BCL2L1-      agcg-----gggttggat---gaggaacagcgaata--gacac-------
A0A3P9D632_BCL2L1-      agcg-----gggttggat---gaggaacagcgaata--gacac-------
A0A3B4FNX1_BCL2L1-      agcg-----gggttggat---gaggaacagcgaata--gacac-------
G3NJY1_BCL2L1-01        ggca-----ggggcggct---ggtgggcagcgggga--gcgac-------
A0A3B3DHA1_BCL2L1-      gg-----------tgggc---gaggagcagagcaca--gagac-------
A0A3B3IB64_BCL2L1-      gg-----------tgggc---gaggagcagagcacg--gagac-------
A0A3P9JYH1_BCL2L1-      gg-----------tgggc---gaggagcagagcacg--gagac-------
C3VIT1_BCL2L1-01        cggg-----ggtctgggc---gaggagcagagcaca--gagac-------
A0A3B4Z3X2_BCL2L1-      ggcg-----aggttggct---gaggaacagcggaca--gagac-------
A0A3B4Z3X2_BCL2L1-      ggcg-----aggttggct---gaggaacagcggaca--gagac-------
A0A3Q1FR00_BCL2L1-      ggcc-----cggctggga---gaggaccagcggaca--gagac-------
A0A3Q1FR00_BCL2L1-      ggcc-----cggctggga---gaggaccagcggaca--gagac-------
A0A3Q1DHJ3_BCL2L1-      ggcc-----cggctggga---gaggaacagcggaca--gagac-------
A0A3Q1DHJ3_BCL2L1-      ggcc-----cggctggga---gaggaacagcggaca--gagac-------
A0A3Q1DHJ3_BCL2L1-      ggcc-----cggctggga---gaggaacagcggaca--gagac-------
A0A3P8TL99_BCL2L1-      ggcc-----cggctggga---gaggaacagcggaca--gagac-------
A0A3P8TL99_BCL2L1-      ggcc-----cggctggga---gaggaacagcggaca--gagac-------
A0A219P0Y3_BCL2L1-      ggca-----gggttaggt---gaggagcagcgggta--gcgac-------
A0A3Q3G2E1_BCL2L1-      ggca-----gggtcgggt---gaggaacagcaggta--gcgac-------
A0A3Q3G2E1_BCL2L1-      ggca-----gggtcgggt---gaggaacagcaggta--gcgac-------
A0A3Q3G2E1_BCL2L1-      ggca-----gggtcgggt---gaggaacagcaggta--gcgac-------
A0A3B4V3T1_BCL2L1-      ggca-----gggttggtt---gaggaacagcggata--gcgac-------
A0A3B4XU17_BCL2L1-      ggca-----gggttggtt---gaggaacagcggata--gcgac-------
A0A3Q3IVF5_BCL2L1-      g-------------------------------------gcaac-------
A0A3Q3MX20_BCL2L1-      ggct-----gagtcaggt---gaggaacagcggata--gcaac-------
A0A3Q1GZ93_BCL2L1-      agat-----gggttgagt---gaggaacagcggata--gcaac-------
A0A3Q1GZ93_BCL2L1-      agat-----gggttgagt---gaggaacagcggata--gcaac-------
A0A3Q1GZ93_BCL2L1-      agat-----gggttgagt---gaggaacagcggata--gcaac-------
A0A0D6DR75_BCL2L1-      ggtt-----gagtccgct---gaggaacagcggata--gcgac-------
A0A3B3E2W4_BCL2L1-      ggacc----------------gctctgctacctgcaacggcac-------
A0A3P9MKK4_BCL2L1-      ggacc----------------actccgctgcccggaatggcag-------
A0A3P9MKK4_BCL2L1-      ggacc----------------actccgctgcccggaatggcag-------
A0A3B3I2Q5_BCL2L1-      ggacc----------------actccgatgcccggaatcgcag-------
A0A3B3I2Q5_BCL2L1-      ggacc----------------actccgatgcccggaatcgcag-------
A0A3P9I2N4_BCL2L1-      ggacc----------------actccgctgcccggaacggcag-------
A0A3P9I2N4_BCL2L1-      ggacc----------------actccgctgcccggaacggcag-------
A0A3B4BFZ8_BCL2L1-      gg-ca----------------gctaatgtcccg--aatggtat-------
A0A3P8VMA1_BCL2L1-      ggtca----------------ccacagcgtccagtaatggcgttcctcag
A0A0F7L1T6_BCL2L1-      gagga----------------gccccgctgcttccaatggcct-------
H2U5I3_BCL2L1-01        gagga----------------gccccgctgcttccaatggcct-------
G3P7B4_BCL2L1-01        ggcca----------------actcggcgtccg--------tt-------
A0A3Q3FUB6_BCL2L1-      ggaaa----------------actctgctgccagtaatggctt-------
A0A3Q3X5M5_BCL2L1-      ggcca----------------gctctgctgccagaaatggctt-------
A0A2U9BIG9_BCL2L1-      ggcca----------------actcagctgccagcaatggctt-------
A0A3Q1JZ46_BCL2L1-      accca----------------actcagcagctgctaacggcct-------
A0A3Q1JZ46_BCL2L1-      accca----------------actcagcagctgctaacggcct-------
A0A3Q3NFM4_BCL2L1-      gaccg----------------gtgcagctgccaccaacggctt-------
A0A3Q3NFM4_BCL2L1-      gaccg----------------gtgcagctgccaccaacggctt-------
A0A3Q3J5K3_BCL2L1-      gacca----------------acccagctaccactaacggcct-------
A0A3B4V9K8_BCL2L1-      ggcca----------------actcagctgccagtaatggctt-------
A0A3B4XS24_BCL2L1-      ggcca----------------gctcagctgccagtaatggctt-------
A0A3B5B4X7_BCL2L1-      gacca----------------actctgctgccagtaacggctt-------
A0A3Q1EVP6_BCL2L1-      ggcca----------------gctcagcctccagtaacggctt-------
A0A3Q1BQA0_BCL2L1-      ggcca----------------actcagcttccagtaatggctt-------
A0A3P8U812_BCL2L1-      ggcca----------------actcagcttccagtaacggctt-------
E6ZFR0_BCL2L1-01        ggcca----------------actcagctgccagaaacggctt-------
A0A0B4KJI5_BCL2L1-      agcca----------------actcagctgccacaaatggcct-------
A0A3Q3BEB7_BCL2L1-      ggcca----------------gctcggctcccagtaacggctt-------
A0A3Q2C6K4_BCL2L1-      ggacg----------------cctcggcttccagcaatggccc-------
A0A3Q2NRP4_BCL2L1-      ggact----------------ccccggcttctagcaatggccc-------
A0A3B5MGS2_BCL2L1-      ggaca----------------gccgggtccctcgcaatggccc-------
M4A558_BCL2L1-01        ggaca----------------gccgggtccctagcaatggccg-------
A0A3P9QFB3_BCL2L1-      ggaca----------------gccggggccctagcaatggccc-------
A0A3B3XN57_BCL2L1-      ggaca----------------gccggggccctagcaatggccc-------
A0A087YBW4_BCL2L1-      ggaca----------------gccggggccctagcaatggtcc-------
A0A3B3VWI7_BCL2L1-      ggaca----------------gccggggccctagcaatggtcc-------
                                                                          

R4JQR8_BCL2L1-01        ------------------------cgatgggac-----------------
A0A346RRN1_BCL2L1-      ------------------------caatgggaa-----------------
Q2TAP5_BCL2L1-01        ----------cccaatgccatatctaatggaa------------------
Q91828_BCL2L1-01        ----------cccaatgccatatctaatggaa------------------
H9GHK7_BCL2L1-01        ---------ggggaacaccct---caatggga------------------
F6WA14_BCL2L1-01        ---------acctagtactgt---gaatggca------------------
G3WKX6_BCL2L1-01        ---------acctagtactgt---gaatggca------------------
A0A452FHY1_BCL2L1-      ----------cccaatgccgt---caatgcca------------------
A0A452FHY1_BCL2L1-      ----------cccaatgccgt---caatgcca------------------
A0A3Q1LRT3_BCL2L1-      ---------ccccagtg-gat---cagtggca------------------
A0A452E1B1_BCL2L1-      ---------ccccagcgccat---cagtggca------------------
W5PSA5_BCL2L1-01        ---------ccccagtgccat---cagtggca------------------
G3SPN0_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
H0X6V2_BCL2L1-01        ---------ccccagtgccat---taatggca------------------
O35843_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
P53563_BCL2L1-02        ---------ccccagtgccat---caatggca------------------
P53563_BCL2L1-03        ---------ccccagtgccat---caatggca------------------
Q64373_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
Q64373_BCL2L1-09        ---------ccccagtgccat---caatggca------------------
P53563_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
Q9MYW4_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A1U7QU73_BCL2L1-      ---------ccccagtgccat---caatggca------------------
G3HEA7_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
G3HEA7_BCL2L1-02        ---------ccccagtgccat---caatggca------------------
B2Z3Z4_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
O77737_BCL2L1-01        ---------ccctagtgccat---caatggca------------------
G1P9D2_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A1S3EPX7_BCL2L1-      ---------ccccagtgctat---caatggca------------------
A0A286Y5D6_BCL2L1-      ---------ccccagtgccat---caatggca------------------
M3XA94_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
M3XA94_BCL2L1-03        ---------ccccagtgccat---caatggca------------------
M3XA94_BCL2L1-02        ---------ccccagtgccat---caatggca------------------
A0A1U7T4L4_BCL2L1-      ---------ccccagtgccgt---caatggca------------------
A0A1U7T4L4_BCL2L1-      ---------ccccagtgccgt---caatggca------------------
L8J061_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
Q05KJ0_BCL2L1-02        ---------ccccagtgccat---caatggca------------------
Q05KJ0_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A452FWV3_BCL2L1-      ---------ccccagtgccat---caatggca------------------
Q9MZS7_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A1S2ZQT6_BCL2L1-      ---------acccagtgccat---caatggca------------------
A0A3Q2H0F6_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A287CZ07_BCL2L1-      ---------ccccagtgccat---caatggca------------------
I3MUP5_BCL2L1-02        ---------ccccagtgccat---caatggca------------------
I3MUP5_BCL2L1-03        ---------ccccagtgccat---caatggca------------------
I3MUP5_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A250YD48_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A1L5BWY3_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A3Q2H0F6_BCL2L1-      ---------ccccagtgccat---caatggca------------------
E2IV76_BCL2L1-01        ---------ccccagtgccat---taatggca------------------
A0A2K6G3C5_BCL2L1-      ---------ccccagtgccat---taatggca------------------
A0A2K6G3C5_BCL2L1-      ---------ccccagtgccat---taatggca------------------
A0A2J8VIH3_BCL2L1-      ---------ccccagtgccat---caatggca------------------
G1RER8_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A2R8Z9D7_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2R8Z9D7_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5H963_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5H963_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A096NV05_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A096NV05_BCL2L1-      ---------ccccagtgccat---caatggca------------------
Q2PFS6_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A2K5M8B1_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5M8B1_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5VPG2_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5YR37_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5YR37_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5VPG2_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A0D9RJZ8_BCL2L1-      ---------ccccagtgccat---caatggca------------------
I7GKS6_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A2K6QFA2_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K6QFA2_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K6QFA2_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K6UWY8_BCL2L1-      ---------ccccagtgccat---caatggca------------------
E2IV77_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A2K6UWY8_BCL2L1-      ---------ccccagtgccat---caat----------------------
A0A2K5Q6R6_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5Q6R6_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A2K5Q6R6_BCL2L1-      ---------ccccagtgccat---caat----------------------
F7IT34_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A2K5EBP4_BCL2L1-      ---------ccccagtgccat---caat----------------------
A0A2K5EBP4_BCL2L1-      ---------ccccagtgccat---caatggca------------------
E2IV75_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
Q76LT7_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
Q8SQ42_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
M3Z2H9_BCL2L1-01        ---------ccccagtgccat---caatggca------------------
A0A452SDS4_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A384D3U1_BCL2L1-      ---------ccccagtgccat---caatggca------------------
A0A493TIA6_BCL2L1-      -------------------ct---caacggga------------------
A0A452ILL8_BCL2L1-      ------------aagtgtccc---taatggga------------------
A0A452ILL8_BCL2L1-      ------------aagtgtccc---taatggga------------------
K7F655_BCL2L1-01        ------------aagcgtccc---taatggga------------------
U3JSL7_BCL2L1-01        ------------cggcgtgct---caacggaa------------------
H0Z8G3_BCL2L1-01        ------------cggggtcct---caacggga------------------
A0A218USB3_BCL2L1-      ------------cggggtcct---caacggga------------------
A0A218USB3_BCL2L1-      ------------cggggtcct---caacggga------------------
A0A218USB3_BCL2L1-      ------------cggggtcct---caacggga------------------
A0A218USB3_BCL2L1-      ------------cggggtcct---caacggga------------------
Q4U2V6_BCL2L1-01        ------------cggggtcct---caacggga------------------
Q07816_BCL2L1-04        ------------cagcgtcct---caatggga------------------
Q07816_BCL2L1-03        ------------cagcgtcct---caatggga------------------
Q07816_BCL2L1-02        ------------cagcgtcct---caatggga------------------
Q07816_BCL2L1-01        ------------cagcgtcct---caatggga------------------
G1N5N5_BCL2L1-01        ------------cagcgtcct---caatggga------------------
H3ANS8_BCL2L1-01        ---------gcaggact-------caatggtgcg----------------
C1BLI0_BCL2L1-01        ---------caatgtctccccagttaatggatct----------------
A0A3P8XFS0_BCL2L1-      ------------------------cagcagacgc----------------
A0A3P8XFS0_BCL2L1-      ------------------------cagcagacgc----------------
A0A286MU87_BCL2L1-      ------------------------cagcagaagc----------------
C0HAD8_BCL2L1-01        ------------------------cagcagaagc----------------
H3CH49_BCL2L1-01        ---------ccagtc---------caatggaact----------------
A0A345BSW9_BCL2L1-      ---------cctcgt---------taacggctcc----------------
Q90Z98_BCL2L1-02        ---------tcttgt---------taatggcacc----------------
Q90Z98_BCL2L1-01        ---------tcttgt---------taatggcacc----------------
A0A059PJI5_BCL2L1-      ---------gccgacagcagtcgttaatggcacc----------------
A0A3B3ZMX9_BCL2L1-      ---------gtggac------------aggaactccacccc---------
A0A3B3ZMX9_BCL2L1-      ---------gtagac------------agg-gctcggctgcagagagaaa
D2ITA2_BCL2L1-02        ------------------------caacaggatt----------------
A0A3P8UWG7_BCL2L1-      ---------gcacgc---------caacgggact----------------
A0A3B3QRZ2_BCL2L1-      ---------tcatgt---------caatgggtcg----------------
A0A3B1JJ42_BCL2L1-      ---------tcccaccgcagtcgttaacgggtcc----------------
A0A3B4DTL9_BCL2L1-      ---------gcccacggcagttgtcaacggatcc----------------
A0A3P8XYL5_BCL2L1-      ---------gcaccc---------caatggcaca----------------
B5XAY3_BCL2L1-01        ---------atacgt---------c-------------------------
A0A3B3TFR4_BCL2L1-      ---------tcatgc---------caatggatcg----------------
A0A3Q3DUT7_BCL2L1-      ---------gcctgc---------caatgggacg----------------
A0A3Q3DUT7_BCL2L1-      ---------gcctgc---------caatgggacg----------------
A0A3Q3DUT7_BCL2L1-      ---------gcctgc---------caatgggacg----------------
W5MG74_BCL2L1-01        ---------gcgtac---------gaacggcgcg----------------
A0A3Q3WIW8_BCL2L1-      ---------acacgc---------caatgggact----------------
A0A2U9BY16_BCL2L1-      ---------gcatgc---------caacggaact----------------
A0A2U9BY16_BCL2L1-      ---------gcatgc---------caacggaact----------------
A0A2U9BY16_BCL2L1-      ---------gcatgc---------caacggaact----------------
A0A2U9BY16_BCL2L1-      ---------gcatgc---------caacggaact----------------
A0A2U9BY16_BCL2L1-      ---------gcatgc---------caacggaact----------------
A0A3B5PQJ0_BCL2L1-      ---------acacgc---------taatgggact----------------
A0A3P9N9Y4_BCL2L1-      ---------gcacgc---------taatgggact----------------
A0A3B3WI27_BCL2L1-      ---------gcacgc---------taatgggact----------------
A0A087X9B7_BCL2L1-      ---------gcacgc---------taatgggact----------------
A0A3B3TUS7_BCL2L1-      ---------gcacgc---------taatgggact----------------
A0A3Q2FR43_BCL2L1-      ---------gcacgc---------taacgggact----------------
A0A3Q2QPL9_BCL2L1-      ---------gcacgc---------caacgggacc----------------
A0A3Q3B3X5_BCL2L1-      ---------acacgc---------caatgggact----------------
A0A3Q0RTF8_BCL2L1-      ---------acacgc---------caatgggact----------------
I3IZK7_BCL2L1-01        ---------acacgc---------caatgggact----------------
A0A3Q4N4B5_BCL2L1-      ---------acacgc---------caatgggact----------------
A0A3Q2X557_BCL2L1-      ---------acacgc---------caatgggact----------------
A0A3P8P0F1_BCL2L1-      ---------acacgc---------caatgggact----------------
A0A3P9D632_BCL2L1-      ---------acacgc---------caatgggact----------------
A0A3P9D632_BCL2L1-      ---------acacgc---------caatgggact----------------
A0A3B4FNX1_BCL2L1-      ---------acacgc---------caatgggact----------------
G3NJY1_BCL2L1-01        ---------gcactc---------caacgggact----------------
A0A3B3DHA1_BCL2L1-      ---------gcacgc---------caacgggacg----------------
A0A3B3IB64_BCL2L1-      ---------gcacgc---------caacgggacg----------------
A0A3P9JYH1_BCL2L1-      ---------gcacgc---------caacgggacg----------------
C3VIT1_BCL2L1-01        ---------gcacgc---------caacgggact----------------
A0A3B4Z3X2_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3B4Z3X2_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3Q1FR00_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3Q1FR00_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3Q1DHJ3_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3Q1DHJ3_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3Q1DHJ3_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3P8TL99_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3P8TL99_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A219P0Y3_BCL2L1-      ---------acacgc---------caacgggact----------------
A0A3Q3G2E1_BCL2L1-      ---------gcacgc---------caacgggact----------------
A0A3Q3G2E1_BCL2L1-      ---------gcacgc---------caacgggact----------------
A0A3Q3G2E1_BCL2L1-      ---------gcacgc---------caacgggact----------------
A0A3B4V3T1_BCL2L1-      ---------gcacgc---------caatggaact----------------
A0A3B4XU17_BCL2L1-      ---------gcacgc---------caatggaact----------------
A0A3Q3IVF5_BCL2L1-      ---------gcacgc---------caatgggact----------------
A0A3Q3MX20_BCL2L1-      ---------gcatgc---------caacgggact----------------
A0A3Q1GZ93_BCL2L1-      ---------gcacgc---------caacgggact----------------
A0A3Q1GZ93_BCL2L1-      ---------gcacgc---------caacgggact----------------
A0A3Q1GZ93_BCL2L1-      ---------gcacgc---------caacgggact----------------
A0A0D6DR75_BCL2L1-      ---------gcacgc---------caacggtact----------------
A0A3B3E2W4_BCL2L1-      ---------actggt---------caacagcg------------------
A0A3P9MKK4_BCL2L1-      ---------gccggt---------cagcagtg------------------
A0A3P9MKK4_BCL2L1-      ---------gccggt---------cagcagtg------------------
A0A3B3I2Q5_BCL2L1-      ---------gctggt---------cagcagtg------------------
A0A3B3I2Q5_BCL2L1-      ---------gctggt---------cagcagtg------------------
A0A3P9I2N4_BCL2L1-      ---------gcaggt---------cagcagtg------------------
A0A3P9I2N4_BCL2L1-      ---------gcaggt---------cagcagtg------------------
A0A3B4BFZ8_BCL2L1-      ---------gctaac---------aaaccgga------------------
A0A3P8VMA1_BCL2L1-      actccttcagctgtg---------ctgcagcact----------------
A0A0F7L1T6_BCL2L1-      ---------gctggt---------ccgcagcagg----------------
H2U5I3_BCL2L1-01        ---------gctggt---------ccgcagcagg----------------
G3P7B4_BCL2L1-01        ---------cctgga---------c----gcggg----------------
A0A3Q3FUB6_BCL2L1-      ---------tttggt---------caacagcagg----------------
A0A3Q3X5M5_BCL2L1-      ---------gctggt---------caacagcagt----------------
A0A2U9BIG9_BCL2L1-      ---------gttggt---------cgacggcggc----------------
A0A3Q1JZ46_BCL2L1-      ---------gccggt---------cagcaggagt----------------
A0A3Q1JZ46_BCL2L1-      ---------gccggt---------cagcaggagt----------------
A0A3Q3NFM4_BCL2L1-      ---------gctggt---------caacagcagg----------------
A0A3Q3NFM4_BCL2L1-      ---------gctggt---------caacagcagg----------------
A0A3Q3J5K3_BCL2L1-      ---------t----------------------------------------
A0A3B4V9K8_BCL2L1-      ---------gttggt---------caacagcagt----------------
A0A3B4XS24_BCL2L1-      ---------gttggt---------caacagcagt----------------
A0A3B5B4X7_BCL2L1-      ---------gctggt---------gaacagca------------------
A0A3Q1EVP6_BCL2L1-      ---------gctggt---------gaacaaca------------------
A0A3Q1BQA0_BCL2L1-      ---------gctggt---------gaacagca------------------
A0A3P8U812_BCL2L1-      ---------gctggt---------gaacagca------------------
E6ZFR0_BCL2L1-01        ---------gctggc---------cagcaagaac----------------
A0A0B4KJI5_BCL2L1-      ---------gctggc---------caacagcagc----------------
A0A3Q3BEB7_BCL2L1-      ---------gctggt---------caacagta------------------
A0A3Q2C6K4_BCL2L1-      ---------actttt---------caacagca------------------
A0A3Q2NRP4_BCL2L1-      ---------tctggt---------cagcagct------------------
A0A3B5MGS2_BCL2L1-      ---------gctggt---------caacagct------------------
M4A558_BCL2L1-01        ---------gctggt---------caacagcc------------------
A0A3P9QFB3_BCL2L1-      ---------gctggt---------caacagcc------------------
A0A3B3XN57_BCL2L1-      ---------gctggt---------caacagct------------------
A0A087YBW4_BCL2L1-      ---------gctggt---------caacagct------------------
A0A3B3VWI7_BCL2L1-      ---------gctggt---------caacagct------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------aactgtcctacgttagacttgcca
A0A346RRN1_BCL2L1-      --------------------------aactgtccctcgttggaagtccca
Q2TAP5_BCL2L1-01        ---------------------------cttctact--------tcagagc
Q91828_BCL2L1-01        --------------------------ccttctact--------tcagagc
H9GHK7_BCL2L1-01        --------------------------gcccttcttggcatcccagcccca
F6WA14_BCL2L1-01        --------------------------gtccctcttggcaccctgctgaca
G3WKX6_BCL2L1-01        --------------------------gcccctcttggcaccctgctgaca
A0A452FHY1_BCL2L1-      --------------------------acccatcttggcacctggcgcata
A0A452FHY1_BCL2L1-      --------------------------acccatcttggcacctggcgcata
A0A3Q1LRT3_BCL2L1-      --------------------------acccatcctggcacctggcagata
A0A452E1B1_BCL2L1-      --------------------------acccatcctggcacctggcagata
W5PSA5_BCL2L1-01        --------------------------acccatcctggcacctggcagata
G3SPN0_BCL2L1-01        --------------------------acccatcccggcacctggcagaca
H0X6V2_BCL2L1-01        --------------------------acccatcctggcacctggctgaca
O35843_BCL2L1-01        --------------------------acccatcctggcacctggcggata
P53563_BCL2L1-02        --------------------------acccatcctggcacctggcggata
P53563_BCL2L1-03        --------------------------acccatcctggcacctggcggata
Q64373_BCL2L1-01        --------------------------acccatcctggcacctggcggata
Q64373_BCL2L1-09        --------------------------acccatcctggcacctggcggata
P53563_BCL2L1-01        --------------------------acccatcctggcacctggcggata
Q9MYW4_BCL2L1-01        --------------------------acccagcctggcacccggcggaca
A0A1U7QU73_BCL2L1-      --------------------------acccatcctggcacctggcggaca
G3HEA7_BCL2L1-01        --------------------------acccatcctggcacctggcggaca
G3HEA7_BCL2L1-02        --------------------------acccatcctggcacctggcggaca
B2Z3Z4_BCL2L1-01        --------------------------acccatcctggcacctggcggaca
O77737_BCL2L1-01        --------------------------acccatcctggcacctggcggaca
G1P9D2_BCL2L1-01        --------------------------acccatcctggcacctggtggaca
A0A1S3EPX7_BCL2L1-      --------------------------acccatcctggcacctggcggaca
A0A286Y5D6_BCL2L1-      --------------------------acccatcctggcacctaactgata
M3XA94_BCL2L1-01        --------------------------acccatcctggcacttggcggaca
M3XA94_BCL2L1-03        --------------------------acccatcctggcacttggcggaca
M3XA94_BCL2L1-02        --------------------------acccatcctggcacttggcggaca
A0A1U7T4L4_BCL2L1-      --------------------------acccatcct---------------
A0A1U7T4L4_BCL2L1-      --------------------------acccatcctggcacctggtggaca
L8J061_BCL2L1-01        --------------------------acgcatcctggcacctggcggata
Q05KJ0_BCL2L1-02        --------------------------acgcatcctggcacctggcggata
Q05KJ0_BCL2L1-01        --------------------------acgcatcctggcacctggcggata
A0A452FWV3_BCL2L1-      --------------------------acccatcttggcacctggcggata
Q9MZS7_BCL2L1-01        --------------------------acccatcttggcacctggcggata
A0A1S2ZQT6_BCL2L1-      --------------------------acccatcctggcacctggcggaca
A0A3Q2H0F6_BCL2L1-      --------------------------acccatcctggcacctggcggaca
A0A287CZ07_BCL2L1-      --------------------------acccatcctggcatctggccgaca
I3MUP5_BCL2L1-02        --------------------------acccatcctggcatctggccgaca
I3MUP5_BCL2L1-03        --------------------------acccatcctggcatctggccgaca
I3MUP5_BCL2L1-01        --------------------------acccatcctggcatctggccgaca
A0A250YD48_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A1L5BWY3_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A3Q2H0F6_BCL2L1-      --------------------------acccatcctggcacctggcggaca
E2IV76_BCL2L1-01        --------------------------acccatcctggcacctggcagaca
A0A2K6G3C5_BCL2L1-      --------------------------acccatcct---------------
A0A2K6G3C5_BCL2L1-      --------------------------acccatcctggcacctggcggaca
A0A2J8VIH3_BCL2L1-      --------------------------acccatcctggcacctggcggaca
G1RER8_BCL2L1-01        --------------------------acccatcctggcacctggcggaca
A0A2R8Z9D7_BCL2L1-      --------------------------acccatcct---------------
A0A2R8Z9D7_BCL2L1-      --------------------------acccatcctggcacctggcggaca
A0A2K5H963_BCL2L1-      --------------------------acccatcct---------------
A0A2K5H963_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A096NV05_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A096NV05_BCL2L1-      --------------------------acccatcct---------------
Q2PFS6_BCL2L1-01        --------------------------acccatcctggcacctggtggaca
A0A2K5M8B1_BCL2L1-      --------------------------acccatcct---------------
A0A2K5M8B1_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A2K5VPG2_BCL2L1-      --------------------------acccatcctgg-------------
A0A2K5YR37_BCL2L1-      --------------------------acccatcctgg-------------
A0A2K5YR37_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A2K5VPG2_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A0D9RJZ8_BCL2L1-      --------------------------acccatcctggcacctggtggaca
I7GKS6_BCL2L1-01        --------------------------acccatcctgg-------------
A0A2K6QFA2_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A2K6QFA2_BCL2L1-      --------------------------acccatcctggcacctggtggaca
A0A2K6QFA2_BCL2L1-      --------------------------acccatcct---------------
A0A2K6UWY8_BCL2L1-      --------------------------acccagcctggcacctggcggaca
E2IV77_BCL2L1-01        --------------------------acccagcctggcacctggcggaca
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------acccatcctggcacctggcggaca
A0A2K5Q6R6_BCL2L1-      --------------------------acccatcctggcacctggcggaca
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------acccatcctggcacctggcggaca
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------acccatcctggcacctggcggaca
E2IV75_BCL2L1-01        --------------------------acccatcctggcacctggcggaca
Q76LT7_BCL2L1-01        --------------------------acccatcctggcacttggcagaca
Q8SQ42_BCL2L1-01        --------------------------acccatcctggcacttggcagaca
M3Z2H9_BCL2L1-01        --------------------------acccatcctggcacctggcggaca
A0A452SDS4_BCL2L1-      --------------------------acccatcctggcacttggcggaca
A0A384D3U1_BCL2L1-      --------------------------acccatcctggcacttggcggaca
A0A493TIA6_BCL2L1-      --------------------------gcccctcctggcaccccccagccg
A0A452ILL8_BCL2L1-      --------------------------gtccatcctggcatccgggtgcca
A0A452ILL8_BCL2L1-      --------------------------gtccatcctggcatccgggtgcca
K7F655_BCL2L1-01        --------------------------gtccatcctggcatccaggtgcca
U3JSL7_BCL2L1-01        --------------------------gcccctcctggcacgcacccacca
H0Z8G3_BCL2L1-01        --------------------------gcccctcctggcacgcggccacca
A0A218USB3_BCL2L1-      --------------------------gcccctcctggcacgcggccacca
A0A218USB3_BCL2L1-      --------------------------gcccctcctggcacgcggccacca
A0A218USB3_BCL2L1-      --------------------------gcccctcctggcacgcggccacca
A0A218USB3_BCL2L1-      --------------------------gcccctcctggcacgcggccacca
Q4U2V6_BCL2L1-01        --------------------------gcccctcctggcacgcggccacca
Q07816_BCL2L1-04        --------------------------gcccatcctggcacccccctgccg
Q07816_BCL2L1-03        --------------------------gcccatcctggcacccccctgccg
Q07816_BCL2L1-02        --------------------------gcccatcctggcacccccctgccg
Q07816_BCL2L1-01        --------------------------gcccatcctggcacccccctgccg
G1N5N5_BCL2L1-01        --------------------------gcccatcctggcacccgcctgccg
H3ANS8_BCL2L1-01        -----gtt---aacgggttg-------------ccgg-------------
C1BLI0_BCL2L1-01        -----gttgaaaatgaccga------aattgcataggcagtctggggata
A0A3P8XFS0_BCL2L1-      --------------------------aatt---tgggaa---------ag
A0A3P8XFS0_BCL2L1-      --------------------------aatt---tgggaa---------ag
A0A286MU87_BCL2L1-      --------------------------aatt---tggcga---------ag
C0HAD8_BCL2L1-01        --------------------------aatt---tggcga---------ag
H3CH49_BCL2L1-01        -----ttt---aatggggca------agtc---ctggaaccc------cc
A0A345BSW9_BCL2L1-      -----atg---aacaga---------------------accc------ca
Q90Z98_BCL2L1-02        -----atg---aatagaacgaacgctagttccactgggaccc------ca
Q90Z98_BCL2L1-01        -----atg---aatagaacgaacgctagttccactgggaccc------ca
A0A059PJI5_BCL2L1-      -----cta---aacgggacc------ggatcggcaggcactc------ca
A0A3B3ZMX9_BCL2L1-      ctcactta---g----------------ac---tcagacttgactccgcc
A0A3B3ZMX9_BCL2L1-      cagaggtg---gacagtacg------gaac---tcagacttgactccgcc
D2ITA2_BCL2L1-02        -----ggt---aata--atg------ggtt---acgg-------------
A0A3P8UWG7_BCL2L1-      -----gta---aacggcaca------agtt---ctgggacgc------cg
A0A3B3QRZ2_BCL2L1-      -----gtc---attgctggc------ggca---ccagcagccaggtgtcc
A0A3B1JJ42_BCL2L1-      -----gta---aatgggacg------agtc---acggtgcggcagggtcg
A0A3B4DTL9_BCL2L1-      -----gta---aatgggaca------agtc---acggtccagcggggtcg
A0A3P8XYL5_BCL2L1-      -----atg---aatgggacg------agtc---ctgggactccaacacaa
B5XAY3_BCL2L1-01        -----------aacgggacg------agtc---ccgggactccaccacca
A0A3B3TFR4_BCL2L1-      -----gtc---agtagcggg------aact---ctgtgggccagggtgc-
A0A3Q3DUT7_BCL2L1-      -----acc---aacggcacc------agtc------------------cc
A0A3Q3DUT7_BCL2L1-      -----acc---aacggcacc------agtc------------------cc
A0A3Q3DUT7_BCL2L1-      -----acc---aacggcacc------agtc------------------cc
W5MG74_BCL2L1-01        -----gcc---aatggcggg------gg-------ggggcccgtgtcgcg
A0A3Q3WIW8_BCL2L1-      -----ttt---aacggtacg------agtc---ccgggaccc------ct
A0A2U9BY16_BCL2L1-      -----cta---aacggcgtg------aatc---ccgggaccc------cc
A0A2U9BY16_BCL2L1-      -----cta---aacggcgtg------aatc---ccgggaccc------cc
A0A2U9BY16_BCL2L1-      -----cta---aacggcgtg------aatc---ccgggaccc------cc
A0A2U9BY16_BCL2L1-      -----cta---aacggcgtg------aatc---ccgggaccc------cc
A0A2U9BY16_BCL2L1-      -----cta---aacggcgtg------aatc---ccgggaccc------cc
A0A3B5PQJ0_BCL2L1-      -----ttt---aacgggacg------agtc---cagg-------------
A0A3P9N9Y4_BCL2L1-      -----ttt---aacgggaca------agtc---cagg-------------
A0A3B3WI27_BCL2L1-      -----ttt---aacgggaca------agtc---cagg-------------
A0A087X9B7_BCL2L1-      -----ttt---aacgggaca------agtc---cagg-------------
A0A3B3TUS7_BCL2L1-      -----ttt---aacgggaca------agtc---cagg-------------
A0A3Q2FR43_BCL2L1-      -----ttt---aacgggacc------agtc---cagg-------------
A0A3Q2QPL9_BCL2L1-      -----gtc---aacgggacc------agct---cggg-------------
A0A3Q3B3X5_BCL2L1-      -----ttt---aacgggact------agtc---ctgggaccc------cg
A0A3Q0RTF8_BCL2L1-      -----ttt---aatggcaca------agtc---ccggtaccc------cg
I3IZK7_BCL2L1-01        -----ttt---aatggcacg------agtc---ccgggaccc------ct
A0A3Q4N4B5_BCL2L1-      -----ttt---aatggcacg------agtc---ccgggaccc------ca
A0A3Q2X557_BCL2L1-      -----ttt---aatggcacg------agtc---ccgggaccc------ca
A0A3P8P0F1_BCL2L1-      -----ttt---aatggcacg------agtc---ccgggaccc------ca
A0A3P9D632_BCL2L1-      -----ttt---aatggcacg------agtc---ccgggaccc------ca
A0A3P9D632_BCL2L1-      -----ttt---aatggcacg------agtc---ccgggaccc------ca
A0A3B4FNX1_BCL2L1-      -----ttt---aatggcacc------agtc---ccgggaccc------ca
G3NJY1_BCL2L1-01        -----ttc---aacggcacg------agtc---ccgggaccc------cg
A0A3B3DHA1_BCL2L1-      -----ttt---aacgggacg------agtc---ccgggaccc------cg
A0A3B3IB64_BCL2L1-      -----ttt---aacgggaca------actc---ccgggaccc------cg
A0A3P9JYH1_BCL2L1-      -----ttt---aacgggaca------actc---ccgggaccc------cg
C3VIT1_BCL2L1-01        -----ttt---accgggacc------agtc---ccgggaccc------cg
A0A3B4Z3X2_BCL2L1-      -----ttt---aatggcacg------agtc---ccgggaccc------cg
A0A3B4Z3X2_BCL2L1-      -----ttt---aatggcacg------agtc---ccgggaccc------cg
A0A3Q1FR00_BCL2L1-      -----ttt---aacggcacg------agtc---ccgggaccc------cc
A0A3Q1FR00_BCL2L1-      -----ttt---aacggcacg------agtc---ccgggaccc------cc
A0A3Q1DHJ3_BCL2L1-      -----ttt---aacggcacg------agtc---ccgggaccc------cc
A0A3Q1DHJ3_BCL2L1-      -----ttt---aacggcacg------agtc---ccgggaccc------cc
A0A3Q1DHJ3_BCL2L1-      -----ttt---aacggcacg------agtc---ccgggaccc------cc
A0A3P8TL99_BCL2L1-      -----ttt---aacggcacg------agtc---ccgggaccc------cc
A0A3P8TL99_BCL2L1-      -----ttt---aacggcacg------agtc---ccgggaccc------cc
A0A219P0Y3_BCL2L1-      -----ttt---aatggcatg------agtc---ccgggaccc------cg
A0A3Q3G2E1_BCL2L1-      -----ttt---aacggcacg------agtc---ctggaaccc------cc
A0A3Q3G2E1_BCL2L1-      -----ttt---aacggcacg------agtc---ctggaaccc------cc
A0A3Q3G2E1_BCL2L1-      -----ttt---aacggcacg------agtc---ctggaaccc------cc
A0A3B4V3T1_BCL2L1-      -----ttt---aatggcaca------agtc---ctgggaccc------gt
A0A3B4XU17_BCL2L1-      -----ttt---aatggcacg------agtc---ctgggaccc------gt
A0A3Q3IVF5_BCL2L1-      -----ttt---aacggcacc------agtc---ccgggaccc------cc
A0A3Q3MX20_BCL2L1-      -----ttt---aatggcaca------agtc---ctgggaccc------cc
A0A3Q1GZ93_BCL2L1-      -----ttt---aatggtaga------agtc---ccgggaccc------cc
A0A3Q1GZ93_BCL2L1-      -----ttt---aatggtaga------agtc---ccgggaccc------cc
A0A3Q1GZ93_BCL2L1-      -----ttt---aatggtaga------agtc---ccgggaccc------cc
A0A0D6DR75_BCL2L1-      -----ttt---aacggaaga------agtc---ctggaaccc------cc
A0A3B3E2W4_BCL2L1-      ---------------aggac------ggccagctgaagaa---------g
A0A3P9MKK4_BCL2L1-      ---------------aggac------tgccagctgaggag---------g
A0A3P9MKK4_BCL2L1-      ---------------aggac------tgccagctgaggag---------g
A0A3B3I2Q5_BCL2L1-      ---------------aggac------ggccggctgaggag---------g
A0A3B3I2Q5_BCL2L1-      ---------------aggac------ggccggctgaggag---------g
A0A3P9I2N4_BCL2L1-      ---------------aggac------ggccagctgaggag---------g
A0A3P9I2N4_BCL2L1-      ---------------aggac------ggccagctgaggag---------g
A0A3B4BFZ8_BCL2L1-      ---------------atggc------aacagacaaacactgg------cc
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      -----------aacaggggt------ggagc------------------g
H2U5I3_BCL2L1-01        -----------aacaggggt------ggagc------------------g
G3P7B4_BCL2L1-01        -----------agcagcgcc------ggccagccggggatgt------cg
A0A3Q3FUB6_BCL2L1-      -----------aaccgggcc------ggccagtcagtgat---------g
A0A3Q3X5M5_BCL2L1-      -----------agtaggggt------ggact------------------g
A0A2U9BIG9_BCL2L1-      -----------aacaggtgc------ggtcagctggggactg------ac
A0A3Q1JZ46_BCL2L1-      --------------------------ggcgagctggggaa---------c
A0A3Q1JZ46_BCL2L1-      --------------------------ggcgagctggggaa---------c
A0A3Q3NFM4_BCL2L1-      -----------tatgtcagc------ggccggccggggat---------g
A0A3Q3NFM4_BCL2L1-      -----------tatgtcagc------ggccggccggggat---------g
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      -----------gacaggtgt------ggtcagcccgggac---------g
A0A3B4XS24_BCL2L1-      -----------gacaggtgt------ggtcagcccgggac---------g
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        -----------acaagt---------ggccagccggggac---------g
A0A0B4KJI5_BCL2L1-      -----------aacggg---------ggc-------ggac---------a
A0A3Q3BEB7_BCL2L1-      ---------------gggac------ggccagtcggggaaga------ag
A0A3Q2C6K4_BCL2L1-      ---------------ggccc------agcccccccgg---ga------ag
A0A3Q2NRP4_BCL2L1-      ---------------gggcc------ggctccccgtg---gc------ag
A0A3B5MGS2_BCL2L1-      ---------------gggcc------gggcacccggg---ga------aa
M4A558_BCL2L1-01        ---------------gggcc------gggcccccggg---ga------ag
A0A3P9QFB3_BCL2L1-      ---------------gggct------ggctcccgggg---ga------ag
A0A3B3XN57_BCL2L1-      ---------------gggcc------ggctccccagg---ga------ag
A0A087YBW4_BCL2L1-      ---------------gggcc------ggctccccagg---ga------ag
A0A3B3VWI7_BCL2L1-      ---------------gggcc------ggctccccagg---ga------ag
                                                                          

R4JQR8_BCL2L1-01        ccatcac-------------------------------------------
A0A346RRN1_BCL2L1-      ccttcac-------------------------------------------
Q2TAP5_BCL2L1-01        gccccgg------ggaaggggcca------------cgcag-ggcattgt
Q91828_BCL2L1-01        gccccgg------ggaaggggcca------------cgcag-ggcattgt
H9GHK7_BCL2L1-01        gccatgt---catcaatggggcctc-------agaacaccccgaactcct
F6WA14_BCL2L1-01        gccgtgc---tgtgagtggggccac-------agggcacagcagcagcct
G3WKX6_BCL2L1-01        gccgtgc---agtgagtggggccac-------aggacacagcagcagcct
A0A452FHY1_BCL2L1-      gccctgc---ggtgaatggagccac-------tggccaca-cagaa----
A0A452FHY1_BCL2L1-      gccctgc---ggtgaatggagccac-------tggccaca-cagaa----
A0A3Q1LRT3_BCL2L1-      gccccac---agtgaatggagccac-------tggccacagcagaagctt
A0A452E1B1_BCL2L1-      gctctgt---ggtgaatggagccac-------tggtcacagcagaagctt
W5PSA5_BCL2L1-01        gccctgt---ggtgaatggagccac-------tggtcacagcagaagctt
G3SPN0_BCL2L1-01        gccctgc---ggtgaatggagctac-------tggccacagcagcagctt
H0X6V2_BCL2L1-01        gccccac---ggtgaatggagccac-------tggccacagcagcagttt
O35843_BCL2L1-01        gcccggc---cgtgaatggagccac-------tggccacagcagcagttt
P53563_BCL2L1-02        gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
P53563_BCL2L1-03        gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
Q64373_BCL2L1-01        gcccggc---cgtgaatggagccac-------tggccacagcagcagttt
Q64373_BCL2L1-09        gcccggc---cgtgaatggagccac-------tggccacagcagcagttt
P53563_BCL2L1-01        gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
Q9MYW4_BCL2L1-01        gccccgc---ggtgaacggagccac-------tggccacagcagcagttt
A0A1U7QU73_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
G3HEA7_BCL2L1-01        gccccgc---ggtaaatggagccac-------tggccacagcagcagttt
G3HEA7_BCL2L1-02        gccccgc---ggtaaatggagccac-------tggccacagcagcagttt
B2Z3Z4_BCL2L1-01        gccccgc---ggtaaatggagccac-------tggccacagcagcagttt
O77737_BCL2L1-01        gccccgc---ggtgaatggagccac-------tggccacagcagcagctt
G1P9D2_BCL2L1-01        gccctgc---ggtgaatggagccac-------tggccacagcagtagctt
A0A1S3EPX7_BCL2L1-      gccccgcggtggtgaatggagccac-------gggtcacagcagcagttc
A0A286Y5D6_BCL2L1-      gtcccac---ggtgaatggggccac-------tggccacagcagtagttt
M3XA94_BCL2L1-01        gccctgc---ggtgaatggagccac-------tggccacagcagcagctt
M3XA94_BCL2L1-03        gccctgc---ggtgaatggagccac-------tggccacagcagcagctt
M3XA94_BCL2L1-02        gccctgc---ggtgaatggagccac-------tggccacagcagcagctt
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
L8J061_BCL2L1-01        gccctgc---tgtgaatggagccac-------tggccacagcagaagctc
Q05KJ0_BCL2L1-02        gccctgc---tgtgaatggagccac-------tggccacagcagaagctc
Q05KJ0_BCL2L1-01        gccctgc---tgtgaatggagccac-------tggccacagcagaagctc
A0A452FWV3_BCL2L1-      gccctgc---ggtgaatggagccac-------cggccacagcagaagctt
Q9MZS7_BCL2L1-01        gccctgc---ggtgaatggagccac-------cggccacagcagaagctt
A0A1S2ZQT6_BCL2L1-      gccctgc---attgaatggagctac-------tggccacagcagcagcct
A0A3Q2H0F6_BCL2L1-      gccccac---ggggaatggagccac-------tggccacagcagcagctt
A0A287CZ07_BCL2L1-      gccccgc---gataaatggagccac-------tggtcacagcagcagttt
I3MUP5_BCL2L1-02        gccccgc---ggtaaatggagccac-------tggtcacagcagcagttt
I3MUP5_BCL2L1-03        gccccgc---ggtaaatggagccac-------tggtcacagcagcagttt
I3MUP5_BCL2L1-01        gccccgc---ggtaaatggagccac-------tggtcacagcagcagttt
A0A250YD48_BCL2L1-      gccccgc---agtgaatggagccac-------tggccacagcagcagttt
A0A1L5BWY3_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A3Q2H0F6_BCL2L1-      gccccac---ggggaatggagccac-------tggccacagcagcagctt
E2IV76_BCL2L1-01        gccctcc---agcgaatggagccac-------tggccacagcagcagttt
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      gcccccc---agcgaatggagccac-------tggccacagcagcagttt
A0A2J8VIH3_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
G1RER8_BCL2L1-01        gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A096NV05_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A2K5VPG2_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A0D9RJZ8_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A2K6QFA2_BCL2L1-      gccccgc---ggtgaatggagccac-------tggccacagcagcagttt
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      gccccgc---ggtgaatggagccac-------gggccacagcagcagttt
E2IV77_BCL2L1-01        gccccgc---ggtgaatggagccac-------gggccacagcagcagttt
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      gccccgc---ggtgaatggagccac-------gggccacagcagcagttt
A0A2K5Q6R6_BCL2L1-      gccccgc---ggtgaatggagccac-------gggccacagcagcagttt
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        gcccagt---ggtgaatggagccac-------gggccacagcagcagttt
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      gccccgc---ggtgaatggagccac-------gggccacagcagcagttt
E2IV75_BCL2L1-01        gccccgc---ggtgaatggagccac-------gggccacagcagcagttt
Q76LT7_BCL2L1-01        gccctgc---ggtgaatggagccac-------tggccacagcagcagctt
Q8SQ42_BCL2L1-01        gccctgc---ggtgaatggagccac-------tggccacagcagcagctt
M3Z2H9_BCL2L1-01        gccctgc---ggtgaatggagccac-------tggccacagcagcagctt
A0A452SDS4_BCL2L1-      gccctgc---ggtgaatggagccac-------tggccacagcagcagctt
A0A384D3U1_BCL2L1-      gccctgc---ggtgaatggagccac-------tggccacagcagcagctt
A0A493TIA6_BCL2L1-      gccaggt---agtgaacggcgccgc-------cgtgcaccggagcagcct
A0A452ILL8_BCL2L1-      gccacat---agtgaatggggctgc-------tgggcacagtaacagcct
A0A452ILL8_BCL2L1-      gccacat---agtgaatggggctgc-------tgggcacagtaacagcct
K7F655_BCL2L1-01        gccacgt---agtgaacggggctgc-------cgggcacagtaacagcct
U3JSL7_BCL2L1-01        gccacat---agtgaacggagcctc-------cgtgcaccagagcagcct
H0Z8G3_BCL2L1-01        gccacat---agtgaatggagccac-------cgtgcaccagaacagcct
A0A218USB3_BCL2L1-      gccacat---agtgaatggagccac-------tgtgcaccagagcagcct
A0A218USB3_BCL2L1-      gccacat---agtgaatggagccac-------tgtgcaccagagcagcct
A0A218USB3_BCL2L1-      gccacat---agtgaatggagccac-------tgtgcaccagagcagcct
A0A218USB3_BCL2L1-      gccacat---agtgaatggagccac-------tgtgcaccagagcagcct
Q4U2V6_BCL2L1-01        gccacat---agtgaatggagccac-------cgtgcaccagagcagcct
Q07816_BCL2L1-04        gccacgt---agtgaacggagccac-------cgtgcaccggagcagcct
Q07816_BCL2L1-03        gccacgt---agtgaacggagccac-------cgtgcaccggagcagcct
Q07816_BCL2L1-02        gccacgt---agtgaacggagccac-------cgtgcaccggagcagcct
Q07816_BCL2L1-01        gccacgt---agtgaacggagccac-------cgtgcaccggagcagcct
G1N5N5_BCL2L1-01        gccacgt---agtgaatggagccgc-------cgtgcacaggagcagcct
H3ANS8_BCL2L1-01        -------------------------------ctggcagcagcagccgcct
C1BLI0_BCL2L1-01        tcttcat--------------ctcc-------------------------
A0A3P8XFS0_BCL2L1-      ccctcaa--------------ctcc-------------------------
A0A3P8XFS0_BCL2L1-      ccctcaa--------------ctcc-------------------------
A0A286MU87_BCL2L1-      ccctcat--------------ctcc-------------------------
C0HAD8_BCL2L1-01        ccctcat--------------ctcc-------------------------
H3CH49_BCL2L1-01        ccagcac--------------cctc------------ccagcaccag---
A0A345BSW9_BCL2L1-      ccacaat--------------cccccgctacatccccccagcatcag---
Q90Z98_BCL2L1-02        ccacaat--------------cccctgcttcatccccccagcgtcaa---
Q90Z98_BCL2L1-01        ccacaat--------------cccctgcttcatccccccagcgtcaa---
A0A059PJI5_BCL2L1-      ccgcgat--------------cgccgactttgtcccctcagaggcag---
A0A3B3ZMX9_BCL2L1-      tctgatt--------------ctgc----------------cccc-----
A0A3B3ZMX9_BCL2L1-      tctgatt--------------ctgc----------------ccccgtcca
D2ITA2_BCL2L1-02        ---------------------------ttgaacgacggtaacggcaatgg
A0A3P8UWG7_BCL2L1-      cctgcat--------------ctcc------act---gcggcagcag---
A0A3B3QRZ2_BCL2L1-      ccagtgc--------------ctga------gcagccgctccattcc---
A0A3B1JJ42_BCL2L1-      cccacct--------------cgtc----cccccagagaagggccaa---
A0A3B4DTL9_BCL2L1-      cccacct--------------cttc----cccccaaagaaggtccaa---
A0A3P8XYL5_BCL2L1-      ---cagt--------------cccccccctcatctcctcggcgg------
B5XAY3_BCL2L1-01        cggcagt--------------cgcccccctcctcccctcggcgg------
A0A3B3TFR4_BCL2L1-      ------t--------------cccc-------------------tgg---
A0A3Q3DUT7_BCL2L1-      ccggcgt--------------cgcc-------------------------
A0A3Q3DUT7_BCL2L1-      ccggcgt--------------cgcc-------------------------
A0A3Q3DUT7_BCL2L1-      ccggcgt--------------cgcc-------------------------
W5MG74_BCL2L1-01        ccagccc--------------cccc------------aggg---------
A0A3Q3WIW8_BCL2L1-      ccaaggt--------------cccc------gct---gcggctgcaa---
A0A2U9BY16_BCL2L1-      ccagagt--------------cccc------act---gcggctgcaa---
A0A2U9BY16_BCL2L1-      ccagagt--------------cccc------act---gcggctgcaa---
A0A2U9BY16_BCL2L1-      ccagagt--------------cccc------act---gcggctgcaa---
A0A2U9BY16_BCL2L1-      ccagagt--------------cccc------act---gcggctgcaa---
A0A2U9BY16_BCL2L1-      ccagagt--------------cccc------act---gcggctgcaa---
A0A3B5PQJ0_BCL2L1-      -----at--------------cccc------------taggcggcac---
A0A3P9N9Y4_BCL2L1-      -----at--------------cccc------------gaggcggcaa---
A0A3B3WI27_BCL2L1-      -----at--------------cccc------------gaggcggcaa---
A0A087X9B7_BCL2L1-      -----at--------------cccc------------gaggcggcaa---
A0A3B3TUS7_BCL2L1-      -----at--------------cccc------------gaggcggcaa---
A0A3Q2FR43_BCL2L1-      -----ct--------------cccc------gcggcgacagca-------
A0A3Q2QPL9_BCL2L1-      -----ct--------------cccc------gcggcggcggcagcag---
A0A3Q3B3X5_BCL2L1-      ccggcgt--------------cccc------act---gaggcagcaa---
A0A3Q0RTF8_BCL2L1-      ccagcgt--------------cccc------gca---gcggcagcaa---
I3IZK7_BCL2L1-01        ccggcat--------------cccc------gca---gcggcagcag---
A0A3Q4N4B5_BCL2L1-      ccggcat--------------cccc------gcagcggcggcagcag---
A0A3Q2X557_BCL2L1-      ccggcat--------------cccc------gcagcggcggcagcag---
A0A3P8P0F1_BCL2L1-      ccggcat--------------cccc------gcagcggcggcagcag---
A0A3P9D632_BCL2L1-      ccggcat--------------cccc------gcagcggcggcagcag---
A0A3P9D632_BCL2L1-      ccggcat--------------cccc------gcagcggcggcagcag---
A0A3B4FNX1_BCL2L1-      ccggcat--------------cccc------gcagcggcggcagcag---
G3NJY1_BCL2L1-01        ccggcgt--------------cccc------gct---gctccagcaa---
A0A3B3DHA1_BCL2L1-      ccgctat--------------cccc------gct---gcgtcagcag---
A0A3B3IB64_BCL2L1-      ccgctct--------------cccc------gct---gcgagagcaa---
A0A3P9JYH1_BCL2L1-      ccgctct--------------cccc------gct---gcgagagcaa---
C3VIT1_BCL2L1-01        ccggtgt--------------cccc------tct---gaggcagcaa---
A0A3B4Z3X2_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A3B4Z3X2_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A3Q1FR00_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A3Q1FR00_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A3Q1DHJ3_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A3Q1DHJ3_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A3Q1DHJ3_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A3P8TL99_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A3P8TL99_BCL2L1-      ccgccgt--------------cccc------------------gcgg---
A0A219P0Y3_BCL2L1-      ccagcat--------------cccc------gct---gcggcagcaa---
A0A3Q3G2E1_BCL2L1-      ccagcgt--------------ccccacaccggca---gcagcaacaa---
A0A3Q3G2E1_BCL2L1-      ccagcgt--------------ccccacaccggca---gcagcaacaa---
A0A3Q3G2E1_BCL2L1-      ccagcgt--------------ccccacaccggca---gcagcaacaa---
A0A3B4V3T1_BCL2L1-      gcagagt--------------cccc------gca---gcggcagcaa---
A0A3B4XU17_BCL2L1-      ccagagt--------------cccc------gca---gcggcagcaa---
A0A3Q3IVF5_BCL2L1-      ccagcat--------------cccc------gct---aaggcaacaa---
A0A3Q3MX20_BCL2L1-      ccagcgt--------------cccc------gct---gcgacaagaa---
A0A3Q1GZ93_BCL2L1-      ccagcgt--------------cccc------gct---gcggcaacaa---
A0A3Q1GZ93_BCL2L1-      ccagcgt--------------cccc------gct---gcggcaacaa---
A0A3Q1GZ93_BCL2L1-      ccagcgt--------------cccc------gct---gcggcaacaa---
A0A0D6DR75_BCL2L1-      ccagcat--------------cccc------gct---caggcaacaa---
A0A3B3E2W4_BCL2L1-      tcctgcc--------------cctg-------tt------gtgctag---
A0A3P9MKK4_BCL2L1-      tcctgtc--------------cctg-------tt------gtgctag---
A0A3P9MKK4_BCL2L1-      tcctgtc--------------cctg-------tt------gtgctag---
A0A3B3I2Q5_BCL2L1-      tcctgtc--------------cctg-------tt------gtgctag---
A0A3B3I2Q5_BCL2L1-      tcctgtc--------------cctg-------tt------gtgctag---
A0A3P9I2N4_BCL2L1-      tcctgtc--------------cctg-------tt------gtgctag---
A0A3P9I2N4_BCL2L1-      tcctgtc--------------cctg-------tt------gtgctag---
A0A3B4BFZ8_BCL2L1-      tcactgc--------------ctcc-------tg------atgatca---
A0A3P8VMA1_BCL2L1-      ----------------------------------------gcagtgg---
A0A0F7L1T6_BCL2L1-      tctccat--------------ccgc-------ag------gtgctgg---
H2U5I3_BCL2L1-01        tctccat--------------ccgc-------ag------gtgctgg---
G3P7B4_BCL2L1-01        tcgccac--------------cgcc-------gccaccgtccggtga---
A0A3Q3FUB6_BCL2L1-      tcatcat--------------cccc-------ac------acaccga---
A0A3Q3X5M5_BCL2L1-      tctcctt--------------ccac-------ag------gtgctga---
A0A2U9BIG9_BCL2L1-      ccgttgc--------------cccc-------gg------acggtgg---
A0A3Q1JZ46_BCL2L1-      tcgtcac--------------ctcc-------gt------gtaagag---
A0A3Q1JZ46_BCL2L1-      tcgtcac--------------ctcc-------gt------gtaagag---
A0A3Q3NFM4_BCL2L1-      tcatcat--------------cccc-------ac------atggagg---
A0A3Q3NFM4_BCL2L1-      tcatcat--------------cccc-------ac------atggagg---
A0A3Q3J5K3_BCL2L1-      ---------------------------------------------gg---
A0A3B4V9K8_BCL2L1-      tcctcgc--------------cccc-------gc------atggtgg---
A0A3B4XS24_BCL2L1-      tcctcgc--------------cccc-------gc------atggtgg---
A0A3B5B4X7_BCL2L1-      ----------------------------------------gaggcgg---
A0A3Q1EVP6_BCL2L1-      ----------------------------------------gagacgg---
A0A3Q1BQA0_BCL2L1-      ----------------------------------------gaggtgg---
A0A3P8U812_BCL2L1-      ----------------------------------------gaggtgg---
E6ZFR0_BCL2L1-01        tcttcgt--------------cctc-------ag------gcgctga---
A0A0B4KJI5_BCL2L1-      gc----------------------c-------ag------gtgctga---
A0A3Q3BEB7_BCL2L1-      atctggc--------------cccg-------cc------gcagcga---
A0A3Q2C6K4_BCL2L1-      cctcggg--------------cccc-------cc------atggaag---
A0A3Q2NRP4_BCL2L1-      ccttggg--------------cccc-------tc------atggccg---
A0A3B5MGS2_BCL2L1-      cccaggg--------------gccc-------tc------cggccgg---
M4A558_BCL2L1-01        cccaggg--------------gccc-------aa------tggccgg---
A0A3P9QFB3_BCL2L1-      tcccagg--------------gccc-------tc------c---------
A0A3B3XN57_BCL2L1-      tcccagg--------------accc-------tc------ccaccgg---
A0A087YBW4_BCL2L1-      tcccggg--------------accc-------tc------ccaccgg---
A0A3B3VWI7_BCL2L1-      tcccggg--------------accc-------tc------ccaccgg---
                                                                          

R4JQR8_BCL2L1-01        -----------------------------------------aaattcagc
A0A346RRN1_BCL2L1-      -----------------------------------------aagttcagc
Q2TAP5_BCL2L1-01        gga------ggag---gaagtcct---------t---------------c
Q91828_BCL2L1-01        gga------ggag---gaagtcct---------t---------------c
H9GHK7_BCL2L1-01        tgaagaggaggaggaagaaaaccc---------gagggtggatgtcagcc
F6WA14_BCL2L1-01        ggatgcccatgag---acaatacc---------agtggctgctgtgaagc
G3WKX6_BCL2L1-01        ggatgcccatgag---acaattcc---------tgtagctgctgtgaagc
A0A452FHY1_BCL2L1-      ---------gaaa---gtggt-cc---------tgtggcaacagcacagc
A0A452FHY1_BCL2L1-      ---------gaaa---gtggt-cc---------tgtggcaacagcacagc
A0A3Q1LRT3_BCL2L1-      ggatgcccggaaa---atgatccc---------catgacaacagtaaagc
A0A452E1B1_BCL2L1-      ggacgctgggaaa---atgatccc---------cacggcagtggtgaagc
W5PSA5_BCL2L1-01        ggacaccgggaaa---atgatccc---------catggcagtggtgaagc
G3SPN0_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
H0X6V2_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
O35843_BCL2L1-01        ggatgcgcgggag---gtgattcc---------catggcagcagtgaagc
P53563_BCL2L1-02        ggatgcgcgggag---gtaatccc---------catggcagcagtgaagc
P53563_BCL2L1-03        ggatgcgcgggag---gtaatccc---------catggcagcagtgaagc
Q64373_BCL2L1-01        ggatgcgcgggag---gtgattcc---------catggcagcagtgaagc
Q64373_BCL2L1-09        ggatgcgcgggag---gtgattcc---------catggcagcagtgaagc
P53563_BCL2L1-01        ggatgcgcgggag---gtaatccc---------catggcagcagtgaagc
Q9MYW4_BCL2L1-01        ggatgcccgggag---gtgatccc---------catgacagcagtgaagc
A0A1U7QU73_BCL2L1-      ggatgcacgggag---gtgatccc---------catggcagccgtgaagc
G3HEA7_BCL2L1-01        ggatgcacgggag---gtgatccc---------catggcagccgtaaagc
G3HEA7_BCL2L1-02        ggatgcacgggag---gtgatccc---------catggcagccgtaaagc
B2Z3Z4_BCL2L1-01        ggatgcacgggag---gtgatccc---------catggcagccgtaaagc
O77737_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggctgcagtgaagc
G1P9D2_BCL2L1-01        ggatgcccgggag---gtgattcc---------catggcagcggtgaagc
A0A1S3EPX7_BCL2L1-      ggaagcccgggaa---gtgattcc---------catggcagctgtgaagc
A0A286Y5D6_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
M3XA94_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcggtgaagc
M3XA94_BCL2L1-03        ggatgcccgggag---gtgatccc---------catggcagcggtgaagc
M3XA94_BCL2L1-02        ggatgcccgggag---gtgatccc---------catggcagcggtgaagc
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagctgtgaagc
L8J061_BCL2L1-01        ggatgcccgggaa---gtgatccc---------catggcagcggtgaagc
Q05KJ0_BCL2L1-02        ggatgcccgggaa---gtgatccc---------catggcagcggtgaagc
Q05KJ0_BCL2L1-01        ggatgcccgggaa---gtgatccc---------catggcagcggtgaagc
A0A452FWV3_BCL2L1-      ggatgcccgggaa---gtgatccc---------catggcagcggtgaagc
Q9MZS7_BCL2L1-01        ggatgcccgggaa---gtgatccc---------catggcagcggtgaagc
A0A1S2ZQT6_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagccgtgaagc
A0A3Q2H0F6_BCL2L1-      ggatgcccgggaa---gtgatccc---------catggcagcagtgaagc
A0A287CZ07_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
I3MUP5_BCL2L1-02        ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
I3MUP5_BCL2L1-03        ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
I3MUP5_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
A0A250YD48_BCL2L1-      ggatgcccgggag---gtgatccc---------catgacagcagtgaagc
A0A1L5BWY3_BCL2L1-      ggatgcccgggag---gtgatccc---------catgacagcagtgaagc
A0A3Q2H0F6_BCL2L1-      ggatgcccgggaa---gtgatccc---------catggcagcagtgaagc
E2IV76_BCL2L1-01        ggatgcccgggag---gtgatccc---------tatggcagcagtgaagc
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
A0A2J8VIH3_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
G1RER8_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A096NV05_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K5VPG2_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A0D9RJZ8_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K6QFA2_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcaataaagc
E2IV77_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcaataaagc
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K5Q6R6_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
E2IV75_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcagtaaagc
Q76LT7_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcggtgaaac
Q8SQ42_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcggtcaaac
M3Z2H9_BCL2L1-01        ggatgcccgggag---gtgatccc---------catggcagcggtaaagc
A0A452SDS4_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
A0A384D3U1_BCL2L1-      ggatgcccgggag---gtgatccc---------catggcagcagtgaagc
A0A493TIA6_BCL2L1-      ggaggtccacgag---ctcgttca---------atcagccgccgtccggc
A0A452ILL8_BCL2L1-      tgaagcccatgaa---agggttcc---------agcaactggagtgaggc
A0A452ILL8_BCL2L1-      tgaagcccatgaa---agggttcc---------agcaactggagtgaggc
K7F655_BCL2L1-01        tgaagcccatgaa---agggttcc---------ggcagccgaagtgaggc
U3JSL7_BCL2L1-01        cgaagtccatgag---atccgtcg---------agcagccgacgtgaggc
H0Z8G3_BCL2L1-01        cgaagtccatgag---atccgtcg---------agcagctgatgtgaggc
A0A218USB3_BCL2L1-      cgaagtccatgag---atccgtcg---------agcagccgatgtgaggc
A0A218USB3_BCL2L1-      cgaagtccatgag---atccgtcg---------agcagccgatgtgaggc
A0A218USB3_BCL2L1-      cgaagtccatgag---atccgtcg---------agcagccgatgtgaggc
A0A218USB3_BCL2L1-      cgaagtccatgag---atccgtcg---------agcagccgatgtgaggc
Q4U2V6_BCL2L1-01        cgaagtccatgag---atccgtcg---------agcagccgatgtgaggc
Q07816_BCL2L1-04        ggaagttcatgaa---attgttcg---------agcatccgacgtgaggc
Q07816_BCL2L1-03        ggaagttcatgaa---attgttcg---------agcatccgacgtgaggc
Q07816_BCL2L1-02        ggaagttcatgaa---attgttcg---------agcatccgacgtgaggc
Q07816_BCL2L1-01        ggaagttcatgaa---attgttcg---------agcatccgacgtgaggc
G1N5N5_BCL2L1-01        ggaagttcatgaa---attgttcg---------agcatctgacgtgaggc
H3ANS8_BCL2L1-01        ggaagcccaggcg---gtgtcggg---------gcccgaagccgtgaaac
C1BLI0_BCL2L1-01        ----------------acagggggg--------tatagaggcggttaaag
A0A3P8XFS0_BCL2L1-      ----------------acaggggtg--------catggaggcagtgaaag
A0A3P8XFS0_BCL2L1-      ----------------acaggggtg--------catggaggcagtgaaag
A0A286MU87_BCL2L1-      ----------------acagggggg--------catggagccagtgaaag
C0HAD8_BCL2L1-01        ----------------acagggggg--------catggagccagtgaaag
H3CH49_BCL2L1-01        -------cagtca---ttgacaag---------tctggacgcagtcaagg
A0A345BSW9_BCL2L1-      ----------------acaaacgggagtgggggtctggacgcggtgaagg
Q90Z98_BCL2L1-02        ----------------acaaatgggtctgggggtctagacgcagtgaagg
Q90Z98_BCL2L1-01        ----------------acaaatgggtctgggggtctagacgcagtgaagg
A0A059PJI5_BCL2L1-      ---gtgaatggca---gcg-caag---------cctggaggcagtaaagg
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      cagccccgccccc---ttgttgga---------cctggacgccgttaaag
D2ITA2_BCL2L1-02        ccagttggcgcca---tcacctactccacaaggcacggaggctgtgaggg
A0A3P8UWG7_BCL2L1-      -cattcggcgtcg---gatacaag---------tctggactccattaaag
A0A3B3QRZ2_BCL2L1-      -ccatcgccctct---ccacaagg---------cctggaggcggtgaagg
A0A3B1JJ42_BCL2L1-      -cgg--------g---gctcgggg---------gctggatgcagtgaaag
A0A3B4DTL9_BCL2L1-      -cgg--------g---gccggagg---------gctggacgccgtgaagg
A0A3P8XYL5_BCL2L1-      ----------------actgttgg---------cctggatgcagtgaaag
B5XAY3_BCL2L1-01        ----------------acagcggg---------cctggacgcagtgaaag
A0A3B3TFR4_BCL2L1-      -aaggcgccaccc---cccaggg----------cctggaggcggtgaagg
A0A3Q3DUT7_BCL2L1-      ---gctacgagag---gcggcgag---------cctggacgcggtgaagg
A0A3Q3DUT7_BCL2L1-      ---gctacgagag---gcggcgag---------cctggacgcggtgaagg
A0A3Q3DUT7_BCL2L1-      ---gctacgagag---gcggcgag---------cctggacgcggtgaagg
W5MG74_BCL2L1-01        ---------------------------------gatcgaggcggtgcagg
A0A3Q3WIW8_BCL2L1-      -c------cgtcg---acaacaag---------tctggacgcagtaaaag
A0A2U9BY16_BCL2L1-      -cggttgccttca---tcgccgag---------cctggatgcagtaaaag
A0A2U9BY16_BCL2L1-      -cggttgccttca---tcgccgag---------cctggatgcagtaaaag
A0A2U9BY16_BCL2L1-      -cggttgccttca---tcgccgag---------cctggatgcagtaaaag
A0A2U9BY16_BCL2L1-      -cggttgccttca---tcgccgag---------cctggatgcagtaaaag
A0A2U9BY16_BCL2L1-      -cggttgccttca---tcgccgag---------cctggatgcagtaaaag
A0A3B5PQJ0_BCL2L1-      -caggcggcgtcg---gcgtcaac---------gatggacgcggtgaaag
A0A3P9N9Y4_BCL2L1-      -caggcggcgtcg---gcgtcaac---------gatggacgcggtgaaag
A0A3B3WI27_BCL2L1-      -caggcggcgtcg---gcggcaac---------gatggacgcggtgaaag
A0A087X9B7_BCL2L1-      -caggcggcgtcg---gcggcaac---------gatggacgcggtgaaag
A0A3B3TUS7_BCL2L1-      -caggcggcgtcg---gcggcaac---------gatggacgcggtgaaag
A0A3Q2FR43_BCL2L1-      ------ggcgtcc---acagccgc---------catggaggcggtgaagg
A0A3Q2QPL9_BCL2L1-      -cagccggcgtcc---acggcggc---------gatggaggcggtgaagg
A0A3Q3B3X5_BCL2L1-      -ccgctgccgacg---acggcgaa---------catggacaaggtgaagg
A0A3Q0RTF8_BCL2L1-      -cagccgccatca---acaacgaa---------cctcgacgcagtgaagg
I3IZK7_BCL2L1-01        -cagccgccatca---acgacgga---------cctcgacgcagtgaagg
A0A3Q4N4B5_BCL2L1-      -cagccgccatca---acgacgga---------cctcgacgcagtgaagg
A0A3Q2X557_BCL2L1-      -cagccgccatca---acgacgga---------cctcgacgcagtgaagg
A0A3P8P0F1_BCL2L1-      -cagccgccatca---acgacgga---------cctcgacgcagtgaagg
A0A3P9D632_BCL2L1-      -cagccgccatca---acgacgga---------cctcgacgcagtgaagg
A0A3P9D632_BCL2L1-      -cagccgccatca---acgacgga---------cctcgacgcagtgaagg
A0A3B4FNX1_BCL2L1-      -cagccgccatca---acgacgga---------cctcgacgcagtgaagg
G3NJY1_BCL2L1-01        -cggtcgccgtcg---acggcgag---------cctggatgcggtgaagg
A0A3B3DHA1_BCL2L1-      -cagttgccgtcg---acgacgaa---------catggacgcagtgaagg
A0A3B3IB64_BCL2L1-      -cagttgccgtcg---acgacaaa---------catggacgcagtgaagg
A0A3P9JYH1_BCL2L1-      -cagttgccgtcg---acgacaaa---------catggacgcagtgaagg
C3VIT1_BCL2L1-01        -ccgttgccgtcg---acgacgacgacgacgcgcctggacgcggtgaaag
A0A3B4Z3X2_BCL2L1-      -cggttggcgtcg---acggcgac---------catggacgcggtgaagg
A0A3B4Z3X2_BCL2L1-      -cggttggcgtcg---acggcgac---------catggacgcggtgaagg
A0A3Q1FR00_BCL2L1-      -cggctggcgtcg---acggcgac---------catggacgcagtgaagg
A0A3Q1FR00_BCL2L1-      -cggctggcgtcg---acggcgac---------catggacgcagtgaagg
A0A3Q1DHJ3_BCL2L1-      -cggctggcgtcg---acggcgac---------catggacgcggtgaagg
A0A3Q1DHJ3_BCL2L1-      -cggctggcgtcg---acggcgac---------catggacgcggtgaagg
A0A3Q1DHJ3_BCL2L1-      -cggctggcgtcg---acggcgac---------catggacgcggtgaagg
A0A3P8TL99_BCL2L1-      -cggctggcgtcg---acggcgac---------catggacgcggtgaagg
A0A3P8TL99_BCL2L1-      -cggctggcgtcg---acggcgac---------catggacgcggtgaagg
A0A219P0Y3_BCL2L1-      -cagttgccatca---acaacgag---------cctggacgcggtgaaag
A0A3Q3G2E1_BCL2L1-      -cggttaccagca---acgacgaa---------tctggacgcggtgaagg
A0A3Q3G2E1_BCL2L1-      -cggttaccagca---acgacgaa---------tctggacgcggtgaagg
A0A3Q3G2E1_BCL2L1-      -cggttaccagca---acgacgaa---------tctggacgcggtgaagg
A0A3B4V3T1_BCL2L1-      -cggctgccgtca---acaacgag---------cctggacgcagtgaaag
A0A3B4XU17_BCL2L1-      -cggctgccgtca---acaacgag---------cctggacgcagtgaaag
A0A3Q3IVF5_BCL2L1-      -cagttgccatca---acggcaaa---------cctggatgcggtgaaag
A0A3Q3MX20_BCL2L1-      -catttgcagtcc---acggcaag---------cctggatgcagtgaaag
A0A3Q1GZ93_BCL2L1-      -cggttgccatca---acgacgag---------cctggatgcggtgaaag
A0A3Q1GZ93_BCL2L1-      -cggttgccatca---acgacgag---------cctggatgcggtgaaag
A0A3Q1GZ93_BCL2L1-      -cggttgccatca---acgacgag---------cctggatgcggtgaaag
A0A0D6DR75_BCL2L1-      -cggttgccatca---ccgacgag---------cctggatgcggtgaaag
A0A3B3E2W4_BCL2L1-      ---------------------------------catggatgccatcaaat
A0A3P9MKK4_BCL2L1-      ---------------------------------catggacgccatcaaat
A0A3P9MKK4_BCL2L1-      ---------------------------------catggacgccatcaaat
A0A3B3I2Q5_BCL2L1-      ---------------------------------catggacgccatcaaat
A0A3B3I2Q5_BCL2L1-      ---------------------------------catggacgccatcaaat
A0A3P9I2N4_BCL2L1-      ---------------------------------catggacgccatcaaat
A0A3P9I2N4_BCL2L1-      ---------------------------------catggacgccatcaaat
A0A3B4BFZ8_BCL2L1-      ---------------------------------cttagacgctattaaga
A0A3P8VMA1_BCL2L1-      ---------------------------------tgcagaggctgtaaagg
A0A0F7L1T6_BCL2L1-      ---------------------------------cattgaggctgtgaacg
H2U5I3_BCL2L1-01        ---------------------------------catagaggctgtgaacg
G3P7B4_BCL2L1-01        ---------------------------------caccgaggccgtaaagg
A0A3Q3FUB6_BCL2L1-      ---------------------------------catagaggctgtaaagg
A0A3Q3X5M5_BCL2L1-      ---------------------------------catggaggctgttaagt
A0A2U9BIG9_BCL2L1-      ---------------------------------cgtgggggctgtgaagg
A0A3Q1JZ46_BCL2L1-      ---------------------------------catggaggccgtaaaaa
A0A3Q1JZ46_BCL2L1-      ---------------------------------catggaggccgtaaaaa
A0A3Q3NFM4_BCL2L1-      ---------------------------------cgtagaggctgtaaagg
A0A3Q3NFM4_BCL2L1-      ---------------------------------cgtagaggctgtaaagg
A0A3Q3J5K3_BCL2L1-      ---------------------------------catagaggctgtaaagg
A0A3B4V9K8_BCL2L1-      ---------------------------------catagaggccgtaaagt
A0A3B4XS24_BCL2L1-      ---------------------------------catagaggccgtaaagt
A0A3B5B4X7_BCL2L1-      ---------------------------------catagaggctgtaaaag
A0A3Q1EVP6_BCL2L1-      ---------------------------------catagaggctgtaaaat
A0A3Q1BQA0_BCL2L1-      ---------------------------------catagaggctgtaaaat
A0A3P8U812_BCL2L1-      ---------------------------------catagaggctgtaaaat
E6ZFR0_BCL2L1-01        ---------------------------------catagaggctgtaaagg
A0A0B4KJI5_BCL2L1-      ---------------------------------catagaggctgttaaag
A0A3Q3BEB7_BCL2L1-      ---------------------------------catagaggccgtaaaat
A0A3Q2C6K4_BCL2L1-      ---------------------------------catagaggctgtaaaat
A0A3Q2NRP4_BCL2L1-      ---------------------------------cgcggaggctgtgaagt
A0A3B5MGS2_BCL2L1-      ---------------------------------cgtcgaggtcgtcaaat
M4A558_BCL2L1-01        ---------------------------------tgttgaggtcgtcaaat
A0A3P9QFB3_BCL2L1-      ---------------------------------cgtcgaggtcgtcaaat
A0A3B3XN57_BCL2L1-      ---------------------------------cgtcgaggttgtcaaat
A0A087YBW4_BCL2L1-      ---------------------------------cgtcaaggttgtcaaat
A0A3B3VWI7_BCL2L1-      ---------------------------------cgtcaaggttgtcaaat
                                                                          

R4JQR8_BCL2L1-01        ttaaattacgttcacttggagatgaattccaagaaagatttcagactcag
A0A346RRN1_BCL2L1-      tcacattacggacgattggggacgaatttcaggaacgatttcgcacacaa
Q2TAP5_BCL2L1-01        aagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgcc
Q91828_BCL2L1-01        aagcccttttggaagcaacggaggagtttgagttgagatatcagcgtgcc
H9GHK7_BCL2L1-01        agacacttagggaggctggcgatgagtttgaactaaggtaccggcgggct
F6WA14_BCL2L1-01        aagctttgagggaggcaggagatgaatttgaacttcggtacaggcgggca
G3WKX6_BCL2L1-01        aagctttgagggaggcaggagatgaatttgaactccggtaccggcgggca
A0A452FHY1_BCL2L1-      aagccccgagggaggcaggcagcgagtttgaactgaggcaccaacagacg
A0A452FHY1_BCL2L1-      aagccccgagggaggcaggcagcgagtttgaactgaggcaccaacagacg
A0A3Q1LRT3_BCL2L1-      aagccctgagggaggcaagcaatgagtttaaactgaggtaccaacagaca
A0A452E1B1_BCL2L1-      aagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagaca
W5PSA5_BCL2L1-01        aagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagaca
G3SPN0_BCL2L1-01        aagctctgagggaggcaggcgatgagttcgaactgcggtaccggcgggca
H0X6V2_BCL2L1-01        aagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
O35843_BCL2L1-01        aagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcg
P53563_BCL2L1-02        aagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagca
P53563_BCL2L1-03        aagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagca
Q64373_BCL2L1-01        aagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcg
Q64373_BCL2L1-09        aagcgctgagagaggcaggcgatgagtttgaactgcggtaccggagagcg
P53563_BCL2L1-01        aagcgctgagagaggctggcgatgagtttgaactgcggtaccggagagca
Q9MYW4_BCL2L1-01        aggctctgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
A0A1U7QU73_BCL2L1-      aagcgctgagagaggccggcgatgagtttgaactgcggtaccggcgggca
G3HEA7_BCL2L1-01        aagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcg
G3HEA7_BCL2L1-02        aagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcg
B2Z3Z4_BCL2L1-01        aagcgctgagagaggccggcgatgagtttgagctgcggtaccggcgggcg
O77737_BCL2L1-01        aagcgctgagggaggcgggcgatgagtttgaactgaggtaccggagggca
G1P9D2_BCL2L1-01        aagcgctgagggaggcaggcgacgagtttgaactgaggtaccggcgggcg
A0A1S3EPX7_BCL2L1-      aagcgctgagggaggcaggcgatgagtttgaactgcggtatcgacgggca
A0A286Y5D6_BCL2L1-      aagctcttagggaggcgggcgatgagtttgaacttcggtaccggcgagca
M3XA94_BCL2L1-01        aggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggca
M3XA94_BCL2L1-03        aggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggca
M3XA94_BCL2L1-02        aggcgctgagggaggccggggatgagtttgaactgaggtaccggcgggca
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      aagcgctgagggaggcaggcgatgagtttgaactgcggtaccggcgggca
L8J061_BCL2L1-01        aagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggca
Q05KJ0_BCL2L1-02        aagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggca
Q05KJ0_BCL2L1-01        aagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggca
A0A452FWV3_BCL2L1-      aagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggca
Q9MZS7_BCL2L1-01        aagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggca
A0A1S2ZQT6_BCL2L1-      aagcgctgagggaggcgggtgatgagtttgaactaaggtatcggcgggca
A0A3Q2H0F6_BCL2L1-      aagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggca
A0A287CZ07_BCL2L1-      aagcattgagggaggcaggcgacgagtttgaactgtggtactggcgggca
I3MUP5_BCL2L1-02        aagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
I3MUP5_BCL2L1-03        aagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
I3MUP5_BCL2L1-01        aagcattgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
A0A250YD48_BCL2L1-      aagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggca
A0A1L5BWY3_BCL2L1-      aagcgctgagggaggcaggtgacgagtttgaactgcggtaccggcgggca
A0A3Q2H0F6_BCL2L1-      aagcgctgagggaggcaggcgatgagtttgaactgaggtaccggcgggca
E2IV76_BCL2L1-01        aagcactgaaggaggcgggcgatgagtttgaacttcggtaccggcgggca
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      aagcactgaaggaggcgggcgatgaatttgaactgcggtaccggcgggca
A0A2J8VIH3_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
G1RER8_BCL2L1-01        aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
A0A096NV05_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
A0A2K5VPG2_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
A0A0D9RJZ8_BCL2L1-      aaacgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
A0A2K6QFA2_BCL2L1-      aagcgctgagggaggcaggcgacgagtttgaactgcggtaccggcgggcg
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      aagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
E2IV77_BCL2L1-01        aagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      aagcactgagggaggcgggcgacgagtttgaactgcggtaccggcgggca
A0A2K5Q6R6_BCL2L1-      aagcactgagggaggcgggcgacgagtttgaactgcggtaccggcgggca
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        aagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggca
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      aagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggca
E2IV75_BCL2L1-01        aagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggca
Q76LT7_BCL2L1-01        aagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggca
Q8SQ42_BCL2L1-01        aagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggca
M3Z2H9_BCL2L1-01        aagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggca
A0A452SDS4_BCL2L1-      aagcgctgagggaggccggggatgagttcgaactgaggtaccggcgggca
A0A384D3U1_BCL2L1-      aagcgctgagggaggccggggatgagttcgaactgaggtaccggcgggca
A0A493TIA6_BCL2L1-      aggctctgcgcgaagccggggacgaattcgagctgaggtaccgccgggct
A0A452ILL8_BCL2L1-      aggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggct
A0A452ILL8_BCL2L1-      aggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggct
K7F655_BCL2L1-01        aggcgctgagagaggcaggagatgagtttgaattgaggtatcggagggct
U3JSL7_BCL2L1-01        aggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcg
H0Z8G3_BCL2L1-01        aggcgctgagagaggcgggggatgagtttgagctgaggtaccggcgggcg
A0A218USB3_BCL2L1-      aggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcg
A0A218USB3_BCL2L1-      aggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcg
A0A218USB3_BCL2L1-      aggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcg
A0A218USB3_BCL2L1-      aggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcg
Q4U2V6_BCL2L1-01        aggcgctgagagaggcaggggatgagtttgagctgaggtaccggcgggcg
Q07816_BCL2L1-04        aggcgctgagagatgcgggggatgagtttgagct----------------
Q07816_BCL2L1-03        aggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggct
Q07816_BCL2L1-02        aggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggct
Q07816_BCL2L1-01        aggcgctgagagatgcgggggatgagtttgagctgaggtaccggagggct
G1N5N5_BCL2L1-01        agacgctgagagatgcaggggatgagtttgagctgaggtaccggagggct
H3ANS8_BCL2L1-01        ggacattgcgagaggccggggaagagtttgagctgaggtatagccgagca
C1BLI0_BCL2L1-01        cagctcttagagactctgcagatgagtttgaattgcgttacaccagagcc
A0A3P8XFS0_BCL2L1-      cagcactacgggactctgcagatgagtttgagctgcgctacacccgtgcc
A0A3P8XFS0_BCL2L1-      cagcactacgggactctgcagatgagtttgagctgcgctacacccgtgcc
A0A286MU87_BCL2L1-      cagcactacgggactcagtggatgagtttgagctacgctacacccgtgcc
C0HAD8_BCL2L1-01        cagcactacgggactcagtggatgagtttgagctgcgctacacccgcgcc
H3CH49_BCL2L1-01        aagccctccgggacaccggcaatgaatttgagctgcggtacacctgcgcg
A0A345BSW9_BCL2L1-      aagcactacgcgattctgccaatgagtttgagctgcgttattcccgagcg
Q90Z98_BCL2L1-02        aggcgctccgtgattctgccaacgagtttgagctgcgctattccagagca
Q90Z98_BCL2L1-01        aggcgctccgtgattctgccaacgagtttgagctgcgctattccagagca
A0A059PJI5_BCL2L1-      aggcgctacgtgactctggcaatgagttcgagctgcgctattcacgcgcc
A0A3B3ZMX9_BCL2L1-      --gctcttcgtgactccgctaatgagttcgagctccgttttagccgcgct
A0A3B3ZMX9_BCL2L1-      aggctcttcgtgactccgctaatgagttcgagctccgttttagccgcgct
D2ITA2_BCL2L1-02        cagcgcttctagaatcggtggaagagtttgagttgcgctacacgctggcc
A0A3P8UWG7_BCL2L1-      aggctctgcgggactcggccaacgagtttgaactgcgatacgcgcgggcc
A0A3B3QRZ2_BCL2L1-      aggcattgcgggattctgccaacgagtttgagctacgctacagccgcgcc
A0A3B1JJ42_BCL2L1-      aggcactgcgggactcagccaacgagtttgagctgcgatactctcgcgcc
A0A3B4DTL9_BCL2L1-      aagcactgcgggactcagccaacgagtttgagctgcgatattcacgcgcc
A0A3P8XYL5_BCL2L1-      aggcactgcgggactctgccaacgagtttgagctgcgttacgccctagca
B5XAY3_BCL2L1-01        aggcattgcgggactctgccaacgagtttgagctgcgttatgccagagcg
A0A3B3TFR4_BCL2L1-      aggcgctgcgactctcagccaacgaatttgagttccggtaccagcgtgcc
A0A3Q3DUT7_BCL2L1-      aggccctgcgggactcggccaatgagtttgagttgcgctactcccacgcc
A0A3Q3DUT7_BCL2L1-      aggccctgcgggactcggccaatgagtttgagttgcgctactcccacgcc
A0A3Q3DUT7_BCL2L1-      aggccctgcgggactcggccaatgagtttgagttgcgctactcccacgcc
W5MG74_BCL2L1-01        gggcgctgcgcgactccgccaacgagtttgagctccgctacggccgggcg
A0A3Q3WIW8_BCL2L1-      atgccctgcgggactctgccaacgagttcgagctgcggtatgcccgcgcc
A0A2U9BY16_BCL2L1-      aggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgcc
A0A2U9BY16_BCL2L1-      aggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgcc
A0A2U9BY16_BCL2L1-      aggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgcc
A0A2U9BY16_BCL2L1-      aggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgcc
A0A2U9BY16_BCL2L1-      aggcccttcgggactcggccaacgagtttgagctgcggtacgcgcgcgcc
A0A3B5PQJ0_BCL2L1-      tggccctgcgcgacacggcccgtgagtttgagctgcgctactcccgcgcc
A0A3P9N9Y4_BCL2L1-      tgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgcc
A0A3B3WI27_BCL2L1-      tgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgcc
A0A087X9B7_BCL2L1-      tgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgcc
A0A3B3TUS7_BCL2L1-      tgaccctgcgagacacggcccgtgagttcgagctgcgctactcccgcgcc
A0A3Q2FR43_BCL2L1-      cggcgctgagagacacggcctgcgagttcgagctgcgctacgcccgcgcc
A0A3Q2QPL9_BCL2L1-      tggcgctgcgggagacggcctgcgagttcgagctgcgctacgcccgcgcc
A0A3Q3B3X5_BCL2L1-      aagctctccgggacacggcaaacgagttcgagctgcggtacgcccgcgct
A0A3Q0RTF8_BCL2L1-      aggcgctccgggacacagccaacgagttcgagctgcgatacgctcgtgcc
I3IZK7_BCL2L1-01        aggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgcc
A0A3Q4N4B5_BCL2L1-      aggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgcc
A0A3Q2X557_BCL2L1-      aggcgctccgggacacggctaacgagttcgagctgcgatacgctcgtgcc
A0A3P8P0F1_BCL2L1-      aggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgcc
A0A3P9D632_BCL2L1-      aggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgcc
A0A3P9D632_BCL2L1-      aggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgcc
A0A3B4FNX1_BCL2L1-      aggcgctccgggacacggccaatgagttcgagctgcgatacgctcgtgcc
G3NJY1_BCL2L1-01        aggccctgcgggactcggccaacgagttcgagctgcgatacgctcgggcc
A0A3B3DHA1_BCL2L1-      aggcgctccgggacacggccaacgagttcgagctgcggtacgccctggcc
A0A3B3IB64_BCL2L1-      aggcgctccgggacacggccaacgagttcgagctccggtacgcccttgcc
A0A3P9JYH1_BCL2L1-      aggcgctccgggacacggccaacgagttcgagctccggtacgccctggcc
C3VIT1_BCL2L1-01        aggccctccgagacacggccaacgagttcgagctgcggtacgcccgcgcc
A0A3B4Z3X2_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgcc
A0A3B4Z3X2_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgcc
A0A3Q1FR00_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgcc
A0A3Q1FR00_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgcc
A0A3Q1DHJ3_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgcc
A0A3Q1DHJ3_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgcc
A0A3Q1DHJ3_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgcgcc
A0A3P8TL99_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgtgcc
A0A3P8TL99_BCL2L1-      aggccctccgggacacggccaacgagttcgagctgcggtacgcccgtgcc
A0A219P0Y3_BCL2L1-      aggccctccgggactccgccaacgagtttgagctgcgatacgctcgcgcc
A0A3Q3G2E1_BCL2L1-      aggccctccgggactcggccaacgagtttgagctgcgatatgccagcgcc
A0A3Q3G2E1_BCL2L1-      aggccctccgggactcggccaacgagtttgagctgcgatatgccagcgcc
A0A3Q3G2E1_BCL2L1-      aggccctccgggactcggccaacgagtttgagctgcgatatgccagcgcc
A0A3B4V3T1_BCL2L1-      aggccctccgggattccgccaacgagtttgagttgcgatactcccgcgcc
A0A3B4XU17_BCL2L1-      aggccctccgggattccgccaacgagtttgagttgcgatactcccgcgcc
A0A3Q3IVF5_BCL2L1-      aggccctccgggactcagccaatgagtttgagctgcgatatgcccgtgct
A0A3Q3MX20_BCL2L1-      aggccctccgggactcagccaacgagtttgagctacgatacgcccgtgct
A0A3Q1GZ93_BCL2L1-      aggccctccgggactcggccaacgagtttgagttacgatacgctcgagcc
A0A3Q1GZ93_BCL2L1-      aggccctccgggactcggccaacgagtttgagttacgatacgctcgagcc
A0A3Q1GZ93_BCL2L1-      aggccctccgggactcggccaacgagtttgagttacgatacgctcgagcc
A0A0D6DR75_BCL2L1-      aggccctccgggactcagccaatgagtttgagctgcgatatgcccgcgcc
A0A3B3E2W4_BCL2L1-      ccacccttaaagattcggccaatgagtttgagcgtcgcttcagtcaaggt
A0A3P9MKK4_BCL2L1-      caactctcaaagattcggccgatgagtttgaacgtcgtttccatcaaggt
A0A3P9MKK4_BCL2L1-      caactctcaaagattcggccgatgagtttgaacgtcgtttccatcaaggt
A0A3B3I2Q5_BCL2L1-      caactctcaaagattcggccgatgagtttgaacgtcgtttccatcaaggt
A0A3B3I2Q5_BCL2L1-      caactctcaaagattcggccgatgagtttgaacgtcgtttccatcaaggt
A0A3P9I2N4_BCL2L1-      caactctcaaagattcggccgatgagtttgaacgtcgtttccatcaaggt
A0A3P9I2N4_BCL2L1-      caactctcaaagattcggccgatgagtttgaacgtcgtttccatcaaggt
A0A3B4BFZ8_BCL2L1-      ctgctctgacggactctgcagatgaatttgaagagttgttcacacaagca
A0A3P8VMA1_BCL2L1-      ctgctctcaaggactcagctgacgagtttgaacttcgcttcacacaagcc
A0A0F7L1T6_BCL2L1-      cagctcttcgggactcggcagaagagtttgagaagctctttgctcaagca
H2U5I3_BCL2L1-01        cagctcttcgggactcggcagaagagtttgagaagctctttgctcaagca
G3P7B4_BCL2L1-01        cagctcttcaggactctgcgaatgagtttgagctgctcttcacgcaagcg
A0A3Q3FUB6_BCL2L1-      cagctcttctggactctgcagatgagtttgagcttctctttacgcaggcc
A0A3Q3X5M5_BCL2L1-      cggcgcttagggactcagccaatgagtttgagcagctcttcacacaagcg
A0A2U9BIG9_BCL2L1-      aggcgctcagggactccgctcatgagtttgaacagctcttcaaccaagcg
A0A3Q1JZ46_BCL2L1-      cagctcttagggactctgctgacgagtttgaactgctcttcacacaagcg
A0A3Q1JZ46_BCL2L1-      cagctcttagggactctgctgacgagtttgaactgctcttcacacaagcg
A0A3Q3NFM4_BCL2L1-      cagctcttagggactccgctgaagagtttgaactgctcttcactcaggcg
A0A3Q3NFM4_BCL2L1-      cagctcttagggactccgctgaagagtttgaactgctcttcactcaggcg
A0A3Q3J5K3_BCL2L1-      ctgctcttagggactctgctgatgagtttgaactgcgcttcacacaagca
A0A3B4V9K8_BCL2L1-      cagcccttaaggactctgctgacgaatttgaattgctcttcaaccaagcg
A0A3B4XS24_BCL2L1-      cagcccttaaggactctgctgacgaatttgaattgctcttcaaccaagca
A0A3B5B4X7_BCL2L1-      cagcgcttaaggactcggcagatgagtttgaacttctcttcacgcaagct
A0A3Q1EVP6_BCL2L1-      ccacccttaaggatgcggcagatgaatttgaacttctcttcacgcaaact
A0A3Q1BQA0_BCL2L1-      ccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggct
A0A3P8U812_BCL2L1-      ccgcacttaaggacgcggcagatgagtttgaacttctcttcacgcaggct
E6ZFR0_BCL2L1-01        cagctcttcgggactcggcagatgagtttgaactgctcttcacgcaagcg
A0A0B4KJI5_BCL2L1-      cagctcttcgggactcatctgaagagtttgaactgctcttcacacaagcg
A0A3Q3BEB7_BCL2L1-      cagctctgaaggactctgcggatgagtttgagcgtctctacacgcaaagt
A0A3Q2C6K4_BCL2L1-      ccgctctgaaggactcagcaaatgagtttgaacttctcttctctcaaagt
A0A3Q2NRP4_BCL2L1-      cggctctgagggactcggcggatgagtttgaacatctcttcacccaaagt
A0A3B5MGS2_BCL2L1-      cggttctgaaggacgcggcggaggagtttgagcgcctctacacccaaagc
M4A558_BCL2L1-01        cagttctgaaggacgcggcggaggagtttgagcgcctctacacccaaagc
A0A3P9QFB3_BCL2L1-      cggttctgaaggacgcggcagaggagtttgaacgcctctacacccaaagc
A0A3B3XN57_BCL2L1-      cggttctgaaggacgcggcagaggagtttgaacgcctctacacccaaagc
A0A087YBW4_BCL2L1-      tggttctgaaggacgcggcagaggagtttgaacgcctctacacccaaagc
A0A3B3VWI7_BCL2L1-      tggttctgaaggacgcggcagaggagtttgaacgcctctacacccaaagc
                                                                          

R4JQR8_BCL2L1-01        tttgacgatatggtcaatcagttacacataactgaggctactgcatatcc
A0A346RRN1_BCL2L1-      tttgacgatatggtcgatcagttacatataacggaagcaacagcatatcc
Q2TAP5_BCL2L1-01        ttcagtgacctgacctcacagctgcacatcacccaggacacggcccagca
Q91828_BCL2L1-01        ttcagtgacctgacctcacagctgcacatcacccaggacacggcccagca
H9GHK7_BCL2L1-01        tttagtgacctgacctcccagctccacatcaccttgggcacggcatacca
F6WA14_BCL2L1-01        ttcagtgacctgacatcccagctccacatcacgccaggaacagcttatca
G3WKX6_BCL2L1-01        ttcagtgatctgacatcccagctccacatcactccagggacggcttatca
A0A452FHY1_BCL2L1-      gtcagcgacctgacgtcccagctccacaccaccccagggacagcatatca
A0A452FHY1_BCL2L1-      gtcagcgacctgacgtcccagctccacaccaccccagggacagcatatca
A0A3Q1LRT3_BCL2L1-      ttcagcgacctgatgtcccagctccgcatcaccccagggacagcatgtca
A0A452E1B1_BCL2L1-      ttcagcgacctgacgtcccagctccacatcaccccagggacaacatatca
W5PSA5_BCL2L1-01        ttcagcgacctgacgtcccagctccacatcaccccagggaaagcatatca
G3SPN0_BCL2L1-01        ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
H0X6V2_BCL2L1-01        ttcagtgacctgacatctcagctgcacatcaccccagggacagcatatca
O35843_BCL2L1-01        ttcagtgatctaacatcccagcttcacataaccccagggaccgcgtatca
P53563_BCL2L1-02        ttcagtgatctaacatcccagcttcatataaccccagggacagcatatca
P53563_BCL2L1-03        ttcagtgatctaacatcccagcttcatataaccccagggacagcatatca
Q64373_BCL2L1-01        ttcagtgatctaacatcccagcttcacataaccccagggaccgcgtatca
Q64373_BCL2L1-09        ttcagtgatctaacatcccagcttcacataaccccagggaccgcgtatca
P53563_BCL2L1-01        ttcagtgatctaacatcccagcttcatataaccccagggacagcatatca
Q9MYW4_BCL2L1-01        ttcagcgacctgacatcccagctccacatcaccccagggacagcatatca
A0A1U7QU73_BCL2L1-      ttcagtgatctgacatcccagcttcatataaccccgggaactgcatatca
G3HEA7_BCL2L1-01        ttcagtgatctaacatcccagcttcatataaccccagggactgcatatca
G3HEA7_BCL2L1-02        ttcagtgatctaacatcccagcttcatataaccccagggactgcatatca
B2Z3Z4_BCL2L1-01        ttcagtgatctaacatcccagcttcatataaccccagggactgcatatca
O77737_BCL2L1-01        ttcagtgacctgacgtcccagctccacatcaccccagggacagcgtatca
G1P9D2_BCL2L1-01        ttcagcgacctgacatcccagctccacatcaccccagggacagcatatca
A0A1S3EPX7_BCL2L1-      ttcagtgacctgacatcccagctccatattaccccggggacagcatatca
A0A286Y5D6_BCL2L1-      ttcagcgacttaacatctcagctccacatcaccccggggacagcatatca
M3XA94_BCL2L1-01        ttcagcgacctgacatcccagcttcacatcaccccagggacagcatatca
M3XA94_BCL2L1-03        ttcagcgacctgacatcccagcttcacatcaccccagggacagcatatca
M3XA94_BCL2L1-02        ttcagcgacctgacatcccagcttcacatcaccccagggacagcatatca
A0A1U7T4L4_BCL2L1-      ------------------------------------gggacagcgtatca
A0A1U7T4L4_BCL2L1-      ttcagtgacctgacgtcccagctccacatcaccccagggacagcgtatca
L8J061_BCL2L1-01        ttcagcgacctgacgtcccagctccacatcaccccagggacagcatatca
Q05KJ0_BCL2L1-02        ttcagcgacctgacgtcccagctccacatcaccccagggacagcatatca
Q05KJ0_BCL2L1-01        ttcagcgacctgacgtcccagctccacatcaccccagggacagcatatca
A0A452FWV3_BCL2L1-      ttcagcgacctgacgtcccagctccacattaccccagggacagcatatca
Q9MZS7_BCL2L1-01        ttcagcgacctgacgtcccagctccacatcaccccagggacagcatatca
A0A1S2ZQT6_BCL2L1-      ttcagtgacctgacttcccagctccacatcaccccagcaacagcatatca
A0A3Q2H0F6_BCL2L1-      ttcagcgacctgacatcccagctccacatcaccccagggacagcatatca
A0A287CZ07_BCL2L1-      ttcagtgacctgacgtcccagctccacatcaccctggggacagcatatca
I3MUP5_BCL2L1-02        ttcagtgacctgacgtcccagctccacatcaccccggggacagcatatca
I3MUP5_BCL2L1-03        ttcagtgacctgacgtcccagctccacatcaccccggggacagcatatca
I3MUP5_BCL2L1-01        ttcagtgacctgacgtcccagctccacatcaccccggggacagcatatca
A0A250YD48_BCL2L1-      ttcagtgacctgacatcccagctccacataaccccggggacagcatatca
A0A1L5BWY3_BCL2L1-      ttcagtgacctgacatcccagctccacataaccccggggacagcatatca
A0A3Q2H0F6_BCL2L1-      ttcagcgacctgacatcccagctccacatcaccccagggacagcatatca
E2IV76_BCL2L1-01        ttcagtgacctgacatcccagctccacatcaccctagggacagcatatca
A0A2K6G3C5_BCL2L1-      ------------------------------------gggacagcatatca
A0A2K6G3C5_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccctagggacagcatatca
A0A2J8VIH3_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
G1RER8_BCL2L1-01        ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A2R8Z9D7_BCL2L1-      ------------------------------------gggacagcatatca
A0A2R8Z9D7_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A2K5H963_BCL2L1-      ------------------------------------gggacagcatatca
A0A2K5H963_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A096NV05_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A096NV05_BCL2L1-      ------------------------------------gggacagcatatca
Q2PFS6_BCL2L1-01        ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A2K5M8B1_BCL2L1-      ------------------------------------gggacagcatatca
A0A2K5M8B1_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A2K5VPG2_BCL2L1-      --------------------------------------gacagcatatca
A0A2K5YR37_BCL2L1-      --------------------------------------gacagcatatca
A0A2K5YR37_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A2K5VPG2_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A0D9RJZ8_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
I7GKS6_BCL2L1-01        -----------------------------caccccagggacagcatatca
A0A2K6QFA2_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A2K6QFA2_BCL2L1-      ttcagtgacctgacatcccagctccacatcaccccagggacagcatatca
A0A2K6QFA2_BCL2L1-      ------------------------------------gggacagcatatca
A0A2K6UWY8_BCL2L1-      tttagtgacctgacatcccagctccacatcacccccgggacagcgtatca
E2IV77_BCL2L1-01        tttagtgacctgacatcccagctccacatcacccccgggacagcgtatca
A0A2K6UWY8_BCL2L1-      --------------------gctccacatcacccccgggacagcgtatca
A0A2K5Q6R6_BCL2L1-      tttagtgacctgacatcccagctccacatcacccccgggacagcatatca
A0A2K5Q6R6_BCL2L1-      tttagtgacctgacatcccagctccacatcacccccgggacagcatatca
A0A2K5Q6R6_BCL2L1-      --------------------gctccacatcacccccgggacagcatatca
F7IT34_BCL2L1-01        tttagtgacctgacatcccagctccacatcacccccgggacagcgtatca
A0A2K5EBP4_BCL2L1-      --------------------gctccacatcacccccgggacagcgtatca
A0A2K5EBP4_BCL2L1-      tttagtgacctgacatcccagctccacatcacccccgggacagcgtatca
E2IV75_BCL2L1-01        tttagtgacctgacatcccagctccacatcacccccgggacagcgtatca
Q76LT7_BCL2L1-01        ttcagtgacctgacatcccagcttcacatcaccccagggacagcatatca
Q8SQ42_BCL2L1-01        ttcagtgacctgacatcccagcttcacatcaccccagggacagcatatca
M3Z2H9_BCL2L1-01        ttcagcgacctgacatctcagcttcacatcaccccagggacagcgtatca
A0A452SDS4_BCL2L1-      ttcagcgacctgacatcccagcttcacatcaccccagggacagcgtatca
A0A384D3U1_BCL2L1-      ttcagcgacctgacatcccagcttcacatcaccccagggacagcgtatca
A0A493TIA6_BCL2L1-      ttcagcgacctcacctcccagctccacatcacccccggcacggcttacca
A0A452ILL8_BCL2L1-      ttcagtgacctcacttcccaactccacatcactcctggcacggcatacca
A0A452ILL8_BCL2L1-      ttcagtgacctcacttcccaactccacatcactcctggcacggcatacca
K7F655_BCL2L1-01        ttcagtgacctcacttcccagctccacatcaccctgggcacggcttacca
U3JSL7_BCL2L1-01        ttcagcgacctcacttcccagctccacatcactcccagcacagcgtatca
H0Z8G3_BCL2L1-01        ttcagcgacctcacttcccagctccacatcactcccagcacagcgtatca
A0A218USB3_BCL2L1-      ttcagcgacctcacttcccagctccacatcactcccagcacagcgtatca
A0A218USB3_BCL2L1-      ttcagcgacctcacttcccagctccacatcactcccagcacagcgtatca
A0A218USB3_BCL2L1-      ttcagcgacctcacttcccagctccacatcactcccagcacagcgtatca
A0A218USB3_BCL2L1-      ttcagcgacctcacttcccagctccacatcactcccagcacagcgtatca
Q4U2V6_BCL2L1-01        ttcagcgacctcacttcccagctccacatcactcccagcacagcgtatca
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        ttcagcgacctcacctcccagctccacatcacccctggcacggcgtacca
Q07816_BCL2L1-02        ttcagcgacctcacctcccagctccacatcacccctggcacggcgtacca
Q07816_BCL2L1-01        ttcagcgacctcacctcccagctccacatcacccctggcacggcgtacca
G1N5N5_BCL2L1-01        ttcagcgatctcacctcccagctccacatcacccctggcacggcgtacca
H3ANS8_BCL2L1-01        ttcagtgacctctcttcccagctccacatcacccccggcacagcctacca
C1BLI0_BCL2L1-01        ttcaatgatccctcttctcaactgcatatcacccctgctacagcatacca
A0A3P8XFS0_BCL2L1-      ttcagtgatctctcctcccagctccacatcacccccgccacagcctacca
A0A3P8XFS0_BCL2L1-      ttcagtgatctctcctcccagctccacatcacccccgccacagcctacca
A0A286MU87_BCL2L1-      ttcagtgacctctcctcccagctccacatcacccctgccacagcctacca
C0HAD8_BCL2L1-01        ttcagtgacctctcctcccagctccacatcacccctgccacagcctacca
H3CH49_BCL2L1-01        ttcagtgacctgcacaaccagctccacatcacgccagccacggcttacca
A0A345BSW9_BCL2L1-      ttcaacgacctttcctcacagctccacatcacacctgccacggcatacca
Q90Z98_BCL2L1-02        ttcaacgatctttcctcacagctccacatcacacccgccacagcgtacca
Q90Z98_BCL2L1-01        ttcaacgatctttcctcacagctccacatcacacccgccacagcgtacca
A0A059PJI5_BCL2L1-      tttagcgacctgtcatcacagttgcatataactccagtcacggtgtacca
A0A3B3ZMX9_BCL2L1-      ttcagcgacctgcaccgccagctgcacatcacgcccgccacagcctatca
A0A3B3ZMX9_BCL2L1-      ttcagcgacctgcaccgccagctgcacatcacgcccgccacagcctatca
D2ITA2_BCL2L1-02        ttcagcgacctgtcgtcccagctgcccatcacccccgccacggcctacgg
A0A3P8UWG7_BCL2L1-      ttcagcgatctgcaccagcagctgcacatcacaccagccactgcctacca
A0A3B3QRZ2_BCL2L1-      ttcagcgacctctcctcccagcttcacatcacacccgtcacggcctacca
A0A3B1JJ42_BCL2L1-      ttcagcgacctgtcctcccagctgcacatcacgcctgctactgcgtacca
A0A3B4DTL9_BCL2L1-      tttagcgacctctcctcccagctccatatcacgccagccacggcgtatca
A0A3P8XYL5_BCL2L1-      ttcagtgacctgtcatcccagctgcacctcacaccggctacagcctacca
B5XAY3_BCL2L1-01        ttcagtgacctgtcctcccagctacacatcacgccgtccacagcctacca
A0A3B3TFR4_BCL2L1-      ttcagcgacctgtcgtcacagctgcatatcacgccggccacagcctacca
A0A3Q3DUT7_BCL2L1-      ttcagcgacctggacaaacagctgcacattacaccggccactgcctacca
A0A3Q3DUT7_BCL2L1-      ttcagcgacctggacaaacagctgcacattacaccggccactgcctacca
A0A3Q3DUT7_BCL2L1-      ttcagcgacctggacaaacagctgcacattacaccggccactgcctacca
W5MG74_BCL2L1-01        ttcagcgacctgtcctcccagctccacatcacgcccgccaccgcctacca
A0A3Q3WIW8_BCL2L1-      ttcagtgacctgcacaaccagctccacatcacaccggccaccgcctacca
A0A2U9BY16_BCL2L1-      ttcagcgatctgcacaaccagctgcacatcacgccggccacggcctacca
A0A2U9BY16_BCL2L1-      ttcagcgatctgcacaaccagctgcacatcacgccggccacggcctacca
A0A2U9BY16_BCL2L1-      ttcagcgatctgcacaaccagctgcacatcacgccggccacggcctacca
A0A2U9BY16_BCL2L1-      ttcagcgatctgcacaaccagctgcacatcacgccggccacggcctacca
A0A2U9BY16_BCL2L1-      ttcagcgatctgcacaaccagctgcacatcacgccggccacggcctacca
A0A3B5PQJ0_BCL2L1-      ttcaacgaccttcacagcacgctgcacatcacaccggccaccgcctacca
A0A3P9N9Y4_BCL2L1-      ttcaacgaccttcacagcacgctgcacatcacaccggccaccgcctacca
A0A3B3WI27_BCL2L1-      ttcaacgaccttcacagcacgctgcacatcacaccggccaccgcgtacca
A0A087X9B7_BCL2L1-      ttcaacgaccttcacagcacgctgcacatcacaccggccaccgcctacca
A0A3B3TUS7_BCL2L1-      ttcaacgaccttcacagcacgctgcacatcacaccggccaccgcctacca
A0A3Q2FR43_BCL2L1-      ttcaacgaccttcacagcacgctgcacatcacgccggccaccgcctacca
A0A3Q2QPL9_BCL2L1-      ttcaacgacctgcacagcacgctgcacatcacgccggccaccgcctacca
A0A3Q3B3X5_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgcccggcaccgtctacca
A0A3Q0RTF8_BCL2L1-      ttcaacgatctgcacagccagctgcacatcacgccggccacggcctacca
I3IZK7_BCL2L1-01        ttcagcgaccttcacagccagctgcacatcacgccggccacggcctacca
A0A3Q4N4B5_BCL2L1-      ttcagcgaccttcacagccagctgcacatcacgccggccacggcctacca
A0A3Q2X557_BCL2L1-      ttcagcgaccttcacagccaactgcacatcacgccggccacggcctacca
A0A3P8P0F1_BCL2L1-      ttcagcgaccttcacagccagctgcacatcacgccggccacggcctacca
A0A3P9D632_BCL2L1-      ttcagcgaccttcacagccagctgcacatcacgccggccacggcctacca
A0A3P9D632_BCL2L1-      ttcagcgaccttcacagccagctgcacatcacgccggccacggcctacca
A0A3B4FNX1_BCL2L1-      ttcagcgaccttcacagccagctgcacatcacgccggccacggcctacca
G3NJY1_BCL2L1-01        ttcagcgatctgcacaaccagctgcacatcacgccggccacggcctacca
A0A3B3DHA1_BCL2L1-      ttcaacaacctgcacagccagctgcacatcacgcccgccacggcctacca
A0A3B3IB64_BCL2L1-      ttcaacaacctgcacagccagctgcacatcacgcccgccacggcctacca
A0A3P9JYH1_BCL2L1-      ttcaacaacctgcacagccagctgcacatcacgcccgccacggcctacca
C3VIT1_BCL2L1-01        ttcagcgacctccacagccagctgcacatcacgccggccacggcctacca
A0A3B4Z3X2_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgccggccaccgcctacca
A0A3B4Z3X2_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgccggccaccgcctacca
A0A3Q1FR00_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacca
A0A3Q1FR00_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacca
A0A3Q1DHJ3_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacca
A0A3Q1DHJ3_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacca
A0A3Q1DHJ3_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacca
A0A3P8TL99_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacca
A0A3P8TL99_BCL2L1-      ttcagcgacctgcacagccagctgcacatcacgcccgccaccgcctacca
A0A219P0Y3_BCL2L1-      ttcagcgatctgcaccaccagctgcacatcacgccggccacagcctacca
A0A3Q3G2E1_BCL2L1-      ttcagcgatctgcacaaccagctgcacatcacgccggccacaacccacca
A0A3Q3G2E1_BCL2L1-      ttcagcgatctgcacaaccagctgcacatcacgccggccacaacccacca
A0A3Q3G2E1_BCL2L1-      ttcagcgatctgcacaaccagctgcacatcacgccggccacaacccacca
A0A3B4V3T1_BCL2L1-      ttcagcgatctgcacaaccagctgcatatcacgccggccacagcttacca
A0A3B4XU17_BCL2L1-      ttcagcgatctgcacaaccagctgcatatcacgccggccacagcttacca
A0A3Q3IVF5_BCL2L1-      ttcagtgatctgcaccaccagctgcatatcacaccagccacggcctacca
A0A3Q3MX20_BCL2L1-      ttcagcgatctgcacaaccagctgcatatcacgccagccacggcctacca
A0A3Q1GZ93_BCL2L1-      ttcagcgatctgcacaaccagctgcatatcacgcctgccacagcctacca
A0A3Q1GZ93_BCL2L1-      ttcagcgatctgcacaaccagctgcatatcacgcctgccacagcctacca
A0A3Q1GZ93_BCL2L1-      ttcagcgatctgcacaaccagctgcatatcacgcctgccacagcctacca
A0A0D6DR75_BCL2L1-      ttcagcgatctgcacaaccagctgcatatcacgcccgccacggcctacca
A0A3B3E2W4_BCL2L1-      tttagtgatctctctctgcagtttcacatcactcctgacacggcctacca
A0A3P9MKK4_BCL2L1-      tttagtgatctctccgtgcagcttcatatcactccggacacggcctacca
A0A3P9MKK4_BCL2L1-      tttagtgatctctccgtgcagcttcatatcactccggacacggcctacca
A0A3B3I2Q5_BCL2L1-      tttagtgatctctccgtgcagcttcatatcactccagacacggcctacca
A0A3B3I2Q5_BCL2L1-      tttagtgatctctccgtgcagcttcatatcactccagacacggcctacca
A0A3P9I2N4_BCL2L1-      tttagtgatctctccgtgcagcttcatatcactccggacacggcctacca
A0A3P9I2N4_BCL2L1-      tttagtgatctctccgtgcagcttcatatcactccggacacggcctacca
A0A3B4BFZ8_BCL2L1-      ttcagcaacctttcctctcagctcgacatcacacctgatacagcttataa
A0A3P8VMA1_BCL2L1-      tttcgtaaccttttcttaaagctggacctcactccggacacagtctacca
A0A0F7L1T6_BCL2L1-      ttcagcgacctctcctcacagctcgacatcactcctgacacggcttacca
H2U5I3_BCL2L1-01        ttcagcgacctctcctcacagctcgacatcactcctgacacagcttacca
G3P7B4_BCL2L1-01        ttcagtgacctctccttgcagctagacgtcacccccgacacggcctacca
A0A3Q3FUB6_BCL2L1-      tttagtgacctttcctcgcagcttgacattactcccaacacagcctatca
A0A3Q3X5M5_BCL2L1-      ttcagtgacctctcctcgcagcttgacatcacccctgacacagcctatca
A0A2U9BIG9_BCL2L1-      ttcagtgacctctccctgcagctcgacatcacccctgacacggcctacca
A0A3Q1JZ46_BCL2L1-      tttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatca
A0A3Q1JZ46_BCL2L1-      tttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatca
A0A3Q3NFM4_BCL2L1-      tttagtgacctttcctcacagcttgacatcactcctgacacagcttacca
A0A3Q3NFM4_BCL2L1-      tttagtgacctttcctcacagcttgacatcactcctgacacagcttacca
A0A3Q3J5K3_BCL2L1-      tttagtgacctttcctcgcagcttgtcatcactcctgacacagcctacaa
A0A3B4V9K8_BCL2L1-      tttagtgacctttccacgcagcttgacatcactcctgacactgcatacca
A0A3B4XS24_BCL2L1-      tttagtgacctttccacgcagcttgacatcactcctgacactgcatacca
A0A3B5B4X7_BCL2L1-      tttagtgacctgtcttcacagcttgacatcactcctgacacggcctacca
A0A3Q1EVP6_BCL2L1-      ttcagtgacctgtcttcgcagattgacatcacccctgaaacggcctacca
A0A3Q1BQA0_BCL2L1-      tttagtgatctgtcttcacagcttgacatcacccctgaaacggcctacca
A0A3P8U812_BCL2L1-      tttagtgatctgtcttcacagcttgacatcacccctgaaacagcctacca
E6ZFR0_BCL2L1-01        tttagtgacctttcctcgcagattgacatcactcctgacacggcctacca
A0A0B4KJI5_BCL2L1-      tttagtgacctctccacgcagctcgacatcactcctgacacagcctacca
A0A3Q3BEB7_BCL2L1-      ttcagccacctgtccctgcagctcgacatcagccccgacacggtctacca
A0A3Q2C6K4_BCL2L1-      ttcagtgacctctccatgcagctagacatcacccctgacacggcctacca
A0A3Q2NRP4_BCL2L1-      ttcagtcacctctccctgcagctggacatcacccccgacacggcctacca
A0A3B5MGS2_BCL2L1-      tttaaacacctctccttgcagctggacatcacccccgacacggcctacca
M4A558_BCL2L1-01        tttaaacacctctccttgcagctggacatcacccccgacacggcctacca
A0A3P9QFB3_BCL2L1-      tttaaacacctttccttgcagctggacatcacccccgacacggcctacca
A0A3B3XN57_BCL2L1-      tttaaacacctttccttgcagctggacatcacccccgacacggcctacca
A0A087YBW4_BCL2L1-      tttaaacacctttccttgcagctggacatcacccccgacacggcctacca
A0A3B3VWI7_BCL2L1-      tttaaacacctttccttgcagctggacatcacccccgacacggcctacca
                                                                          

R4JQR8_BCL2L1-01        aacgtttcaaagagttgttcaggaattatttattgatggaaatattaact
A0A346RRN1_BCL2L1-      tactttccaaagagttgttcaagagttattcattgatgggaatataaact
Q2TAP5_BCL2L1-01        gagcttccagcaagttatgggagagttgttcagggatggg---acaaact
Q91828_BCL2L1-01        gagcttccagcaagttatgggagagttgttcagggatggg---acaaact
H9GHK7_BCL2L1-01        gagcttcgagcaggtggtgaatgaactcttccacgatggg---gtaaact
F6WA14_BCL2L1-01        gagctttgagcaggtagtgaatgaactcttccgggatggg---gtgaact
G3WKX6_BCL2L1-01        gagttttgagcaggtagtgaatgaactcttccgggatggg---gtgaact
A0A452FHY1_BCL2L1-      gagctttgaacaggtaatgtatgagctcttctgggacggg---gtgaact
A0A452FHY1_BCL2L1-      gagctttgaacaggtaatgtatgagctcttctgggacggg---gtgaact
A0A3Q1LRT3_BCL2L1-      gagctttgaacaggtaataaatgaactcttccgggacagg---gtgaaat
A0A452E1B1_BCL2L1-      gagctttgaacaggtaataaatgaactcttccaggatggg---gtgaact
W5PSA5_BCL2L1-01        gagctttgaacaggtaataaatgaactcttccaggatggg---gtgaact
G3SPN0_BCL2L1-01        gagctttgagcaggtagtgaacgaactcttccgggatggg---gtgaact
H0X6V2_BCL2L1-01        gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
O35843_BCL2L1-01        gagctttgagcaggtagtgaatgaactctttcgggatgga---gtaaact
P53563_BCL2L1-02        gagctttgaacaggtagtgaatgaactctttcgggatggg---gtaaact
P53563_BCL2L1-03        gagctttgaacaggtagtgaatgaactctttcgggatggg---gtaaact
Q64373_BCL2L1-01        gagctttgagcaggtagtgaatgaactctttcgggatgga---gtaaact
Q64373_BCL2L1-09        gagctttgagcaggtagtgaatgaactctttcgggatgga---gtaaact
P53563_BCL2L1-01        gagctttgaacaggtagtgaatgaactctttcgggatggg---gtaaact
Q9MYW4_BCL2L1-01        gagctttgaacaagtagtgaacgaactcttccgggatggg---gtgaact
A0A1U7QU73_BCL2L1-      aagctttgagcaggtagtgaatgaactcttccgggatggg---gtaaact
G3HEA7_BCL2L1-01        aagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
G3HEA7_BCL2L1-02        aagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
B2Z3Z4_BCL2L1-01        aagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
O77737_BCL2L1-01        gagctttgagcaggtattgaacgaactcttccgggatggg---gtgaact
G1P9D2_BCL2L1-01        gagctttgagcaagtagtgaatgaactcttccgggatggg---gtgaact
A0A1S3EPX7_BCL2L1-      gagctttgagcaggtagtgaacgaactcttccgggatggg---gtaaact
A0A286Y5D6_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
M3XA94_BCL2L1-01        gagctttgagcaggtagtgaacgaactcttccgggatggg---gtgaact
M3XA94_BCL2L1-03        gagctttgagcaggtagtgaacgaactcttccgggatggg---gtgaact
M3XA94_BCL2L1-02        gagctttgagcaggtagtgaacgaactcttccgggatggg---gtgaact
A0A1U7T4L4_BCL2L1-      gagttttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
A0A1U7T4L4_BCL2L1-      gagttttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
L8J061_BCL2L1-01        gagctttgaacaggtagtgaatgaactcttccgggacggg---gtgaact
Q05KJ0_BCL2L1-02        gagctttgaacaggtagtgaatgaactcttccgggacggg---gtgaact
Q05KJ0_BCL2L1-01        gagctttgaacaggtagtgaatgaactcttccgggacggg---gtgaact
A0A452FWV3_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggacggg---gtgaact
Q9MZS7_BCL2L1-01        gagctttgaacaggtagtgaatgaactcttccgggacggg---gtgaact
A0A1S2ZQT6_BCL2L1-      gagctttgagcaggtagtgaacgaactcttccgggatggg---gtgaact
A0A3Q2H0F6_BCL2L1-      gagctttgagcaggtagtgaatgaactcttccgggatggg---gtgaact
A0A287CZ07_BCL2L1-      gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
I3MUP5_BCL2L1-02        gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
I3MUP5_BCL2L1-03        gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
I3MUP5_BCL2L1-01        gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
A0A250YD48_BCL2L1-      gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
A0A1L5BWY3_BCL2L1-      gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
A0A3Q2H0F6_BCL2L1-      gagctttgagcaggtagtgaatgaactcttccgggatggg---gtgaact
E2IV76_BCL2L1-01        aagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K6G3C5_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgagatggg---gtaaact
A0A2K6G3C5_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgagatggg---gtaaact
A0A2J8VIH3_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
G1RER8_BCL2L1-01        gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2R8Z9D7_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2R8Z9D7_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K5H963_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K5H963_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A096NV05_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A096NV05_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
Q2PFS6_BCL2L1-01        gagctttgaacaagtagtgaatgaactcttccgggatggg---gtaaact
A0A2K5M8B1_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtgaact
A0A2K5M8B1_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtgaact
A0A2K5VPG2_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K5YR37_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K5YR37_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K5VPG2_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A0D9RJZ8_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
I7GKS6_BCL2L1-01        gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K6QFA2_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K6QFA2_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K6QFA2_BCL2L1-      gagctttgaacaggtagtgaatgaactcttccgggatggg---gtaaact
A0A2K6UWY8_BCL2L1-      aagctttgaacaggtagtgaacgaactcttccgggatggg---gtgaact
E2IV77_BCL2L1-01        aagctttgaacaggtagtgaacgaactcttccgggatggg---gtgaact
A0A2K6UWY8_BCL2L1-      aagctttgaacaggtagtgaacgaactcttccgggatggg---gtgaact
A0A2K5Q6R6_BCL2L1-      aagctttgaacaagtagtgaacgaactcttccgggatggg---gtaaact
A0A2K5Q6R6_BCL2L1-      aagctttgaacaagtagtgaacgaactcttccgggatggg---gtaaact
A0A2K5Q6R6_BCL2L1-      aagctttgaacaagtagtgaacgaactcttccgggatggg---gtaaact
F7IT34_BCL2L1-01        gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
A0A2K5EBP4_BCL2L1-      gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
A0A2K5EBP4_BCL2L1-      gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
E2IV75_BCL2L1-01        gagctttgaacaggtagtgaacgaactcttccgggatggg---gtaaact
Q76LT7_BCL2L1-01        gagctttgagcaggtagtgaatgaactcttccgggatggg---gtgaact
Q8SQ42_BCL2L1-01        gagctttgagcaggtagtgaatgaactcttccgggatggg---gtgaact
M3Z2H9_BCL2L1-01        gagctttgagcaggtggtgaacgaactcttccgggatggg---gtgaact
A0A452SDS4_BCL2L1-      gagctttgagcaggtagtgaatgaactcttccgggatggg---gtgaact
A0A384D3U1_BCL2L1-      gagctttgagcaggtagtgaatgaactcttccgggatggg---gtgaact
A0A493TIA6_BCL2L1-      gagcttcgagcaggtggtgaacgaacttttccgcgatggg---gtgaact
A0A452ILL8_BCL2L1-      gagctttgagcaggtagtgaatgaactcttccgggacgga---gtgaact
A0A452ILL8_BCL2L1-      gagctttgagcaggtagtgaatgaactcttccgggacgga---gtgaact
K7F655_BCL2L1-01        gagcttcgagcaggtggtgaatgaactcttccgggacgga---gtgaact
U3JSL7_BCL2L1-01        gagctttgagcaggtagtgaacgaactgttccgcgatgga---gtgaact
H0Z8G3_BCL2L1-01        gagctttgagcaggtagtgaacgaactgttccgcgatgga---gtgaact
A0A218USB3_BCL2L1-      gagctttgagcaggtagtgaacgaactgttccgcgatgga---gtgaact
A0A218USB3_BCL2L1-      gagctttgagcaggtagtgaacgaactgttccgcgatgga---gtgaact
A0A218USB3_BCL2L1-      gagctttgagcaggtagtgaacgaactgttccgcgatgga---gtgaact
A0A218USB3_BCL2L1-      gagctttgagcaggtagtgaacgaactgttccgcgatgga---gtgaact
Q4U2V6_BCL2L1-01        gagctttgagcaggtagtgaacgaactgttccgcgatgga---gtgaact
Q07816_BCL2L1-04        --------------------------------------------------
Q07816_BCL2L1-03        gagctttgagcaggtagtgaatgaactcttccatgatggt---gtgaact
Q07816_BCL2L1-02        gagctttgagcaggtagtgaatgaactcttccatgatggt---gtgaact
Q07816_BCL2L1-01        gagctttgagcaggtagtgaatgaactcttccatgatggt---gtgaact
G1N5N5_BCL2L1-01        gagctttgagcaggtagtgaacgaactcttccatgatggt---gtgaact
H3ANS8_BCL2L1-01        gagctttgaacaggtggtgaacgaactcttccgggacgga---gtgaact
C1BLI0_BCL2L1-01        tagctttgaaagtgtaatgaacgaggtgttcagggacggc---gtcaact
A0A3P8XFS0_BCL2L1-      cagttttgaaagtgtgatggacgaggtgttcagggatggg---gttaact
A0A3P8XFS0_BCL2L1-      cagttttgaaagtgtgatggacgaggtgttcagggatggg---gttaact
A0A286MU87_BCL2L1-      cagctttgagagtgtgatggacgaagtgttcagggacggg---gtcaact
C0HAD8_BCL2L1-01        cagctttgagagtgtgatggacgaagtgttcagggacggg---gtcaact
H3CH49_BCL2L1-01        aagttttgagaacgttatggatgaggtgtttcgggatgga---gtcaact
A0A345BSW9_BCL2L1-      gagctttgagagcgtgatggatgaggtgttccgcgacggc---gtcaact
Q90Z98_BCL2L1-02        gagcttcgagagcgtgatggatgaggtgtttcgcgacggc---gtcaact
Q90Z98_BCL2L1-01        gagcttcgagagcgtgatggatgaggtgtttcgcgacggc---gtcaact
A0A059PJI5_BCL2L1-      gagctttgagagcgtgatggacgaggtgttccgcgacggc---gtcaact
A0A3B3ZMX9_BCL2L1-      gagcttcgagagtgtcatggacgaagtgttccgcgatggc---gttaact
A0A3B3ZMX9_BCL2L1-      gagcttcgagagtgtcatggacgaagtgttccgcgatggc---gttaact
D2ITA2_BCL2L1-02        tagcttcgaaagcgtgatggacgaggtgttcagggacagc---atcaact
A0A3P8UWG7_BCL2L1-      aagtttcgagaatgtgatggacgaagtgttccgggacggt---gtcaatt
A0A3B3QRZ2_BCL2L1-      gagctttgagagtgtaatgaacgaggtgttccgcgatgga---atcaact
A0A3B1JJ42_BCL2L1-      gagctttgagagcgtgatggacgaggtgtttcgcgatggc---gtcaact
A0A3B4DTL9_BCL2L1-      gagcttcgaaagcgtgatggacgaggtgttccgagacggc---gtcaact
A0A3P8XYL5_BCL2L1-      gagctttgcaagtgtgatggatgaggtgttccgggatggg---gtgaact
B5XAY3_BCL2L1-01        gagctttgagaacgtgatggacgaggtgttccgggacggt---gtcaact
A0A3B3TFR4_BCL2L1-      gagcttcgagagcgtcatgaacgaggtgttccgggacggt---gtcaact
A0A3Q3DUT7_BCL2L1-      aagctttgagaacgttgtggatgaggtgttccaggacgac---gtcaact
A0A3Q3DUT7_BCL2L1-      aagctttgagaacgttgtggatgaggtgttccaggacgac---gtcaact
A0A3Q3DUT7_BCL2L1-      aagctttgagaacgttgtggatgaggtgttccaggacgac---gtcaact
W5MG74_BCL2L1-01        gagcttcgagcacgtcatggacgaggtcttccgggacggg---gtgaact
A0A3Q3WIW8_BCL2L1-      aagctttgagaacgtgatggacgaggtgttcagggacggt---gtcaact
A0A2U9BY16_BCL2L1-      aagcttcgagagtgtgatgaacgaggtgttccgggacggc---gtcaact
A0A2U9BY16_BCL2L1-      aagcttcgagagtgtgatgaacgaggtgttccgggacggc---gtcaact
A0A2U9BY16_BCL2L1-      aagcttcgagagtgtgatgaacgaggtgttccgggacggc---gtcaact
A0A2U9BY16_BCL2L1-      aagcttcgagagtgtgatgaacgaggtgttccgggacggc---gtcaact
A0A2U9BY16_BCL2L1-      aagcttcgagagtgtgatgaacgaggtgttccgggacggc---gtcaact
A0A3B5PQJ0_BCL2L1-      gagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3P9N9Y4_BCL2L1-      gagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3B3WI27_BCL2L1-      gagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A087X9B7_BCL2L1-      gagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3B3TUS7_BCL2L1-      gagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3Q2FR43_BCL2L1-      gagcttcgagaacgtgatgaacgaggtgttccgggacggc---gtcaact
A0A3Q2QPL9_BCL2L1-      gagcttcgagaacgtgatgaacgaggtgttccgggacggc---gtcaact
A0A3Q3B3X5_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3Q0RTF8_BCL2L1-      aagcttcgagaatgtgatggacgaggtgttccgggatggc---gtcaact
I3IZK7_BCL2L1-01        aagctttgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3Q4N4B5_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gttaact
A0A3Q2X557_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gttaact
A0A3P8P0F1_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gttaact
A0A3P9D632_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gttaact
A0A3P9D632_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gttaact
A0A3B4FNX1_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gttaact
G3NJY1_BCL2L1-01        gagcttcgaggacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3B3DHA1_BCL2L1-      gagcttcgagaacgtgatgaacgagctgttccgcgacaac---atcaact
A0A3B3IB64_BCL2L1-      gagcttcgagaacgtgatgaacgagctgttccgcgacaac---atcaact
A0A3P9JYH1_BCL2L1-      gagcttcgagaacgtgatgaacgagctgttccgcgacaac---atcaact
C3VIT1_BCL2L1-01        aagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3B4Z3X2_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3B4Z3X2_BCL2L1-      aagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3Q1FR00_BCL2L1-      gagcttcgagaacgtcatggacgaggtgttccgggacggc---gtcaact
A0A3Q1FR00_BCL2L1-      gagcttcgagaacgtcatggacgaggtgttccgggacggc---gtcaact
A0A3Q1DHJ3_BCL2L1-      gagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3Q1DHJ3_BCL2L1-      gagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3Q1DHJ3_BCL2L1-      gagcttcgagaacgtgatggacgaggtgttccgggacggc---gtcaact
A0A3P8TL99_BCL2L1-      gagcttcgagaacgtgatggatgaggtgttccgggacggc---gtcaact
A0A3P8TL99_BCL2L1-      gagcttcgagaacgtgatggatgaggtgttccgggacggc---gtcaact
A0A219P0Y3_BCL2L1-      aagcttcgagaacgtgatggatgaggtgttccgggacgga---gtcaact
A0A3Q3G2E1_BCL2L1-      gagctttgagaacgtgatggacgaggtgttccgggacgga---gtcaact
A0A3Q3G2E1_BCL2L1-      gagctttgagaacgtgatggacgaggtgttccgggacgga---gtcaact
A0A3Q3G2E1_BCL2L1-      gagctttgagaacgtgatggacgaggtgttccgggacgga---gtcaact
A0A3B4V3T1_BCL2L1-      aagctttgcgaacgtgatggatgaagtgttccgggacggc---ttcaact
A0A3B4XU17_BCL2L1-      aagctttgcgaacgtgatggatgaagtgttccgggatggc---ttcaact
A0A3Q3IVF5_BCL2L1-      aagctttgagagcgtgatggatgaagtgttccgggacggc---gtcaact
A0A3Q3MX20_BCL2L1-      aagcttcgagagtgtgatggatgaagtgttccgggacggt---gtcaact
A0A3Q1GZ93_BCL2L1-      aagcttcgagaacgtcatggatgaagtgttccgggacggt---gtcaact
A0A3Q1GZ93_BCL2L1-      aagcttcgagaacgtcatggatgaagtgttccgggacggt---gtcaact
A0A3Q1GZ93_BCL2L1-      aagcttcgagaacgtcatggatgaagtgttccgggacggt---gtcaact
A0A0D6DR75_BCL2L1-      aagctttgcgaacgtcatggatgaagtgttccgggacggc---gtcaact
A0A3B3E2W4_BCL2L1-      aaacttcaaaagtgtgttggatgagctgttcaaggatggg---ataaact
A0A3P9MKK4_BCL2L1-      aaacttcaaaagggtgttggatgagctgttcaaggatggg---atcaact
A0A3P9MKK4_BCL2L1-      aaacttcaaaagggtgttggatgagctgttcaaggatggg---atcaact
A0A3B3I2Q5_BCL2L1-      aaacttcaaaagggtgttggatgagctgttcaaggatggg---atcaact
A0A3B3I2Q5_BCL2L1-      aaacttcaaaagggtgttggatgagctgttcaaggatggg---atcaact
A0A3P9I2N4_BCL2L1-      aaacttcaaaagggtgttggatgagctgttcaaggatggg---atcaact
A0A3P9I2N4_BCL2L1-      aaacttcaaaagggtgttggatgagctgttcaaggatggg---atcaact
A0A3B4BFZ8_BCL2L1-      cagctttaaaagtgtcatggacgaggtgttcaaagatggg---gttaatt
A0A3P8VMA1_BCL2L1-      cagttttaagagcgtgatggatgaggtcttcagagacgga---gtcaact
A0A0F7L1T6_BCL2L1-      gagctttaagaatgtgatggacgaggtgttcaaggacgga---gacaact
H2U5I3_BCL2L1-01        gagctttaagaatgtgatggacgaggtgttcaaggacgga---gtcaact
G3P7B4_BCL2L1-01        cagcttcaagagcgtgatggacgaggtgttcaaggatggc---gtcaact
A0A3Q3FUB6_BCL2L1-      cagctttaagagtgtgatggacgaggttttcaaggatgga---gtcaact
A0A3Q3X5M5_BCL2L1-      cagttttaagagcgtgatggacgaggtgttcaaggacggg---gtcaact
A0A2U9BIG9_BCL2L1-      aagctttaagagtgtgatggacgaggtgttcaaggacgga---gtcaact
A0A3Q1JZ46_BCL2L1-      aagctttaagagtgtgatggacgagttgttcaaggatgga---gtcaact
A0A3Q1JZ46_BCL2L1-      aagctttaagagtgtgatggacgagttgttcaaggatgga---gtcaact
A0A3Q3NFM4_BCL2L1-      cagctttaaaagcgtgatggatgaggtgttcaaggatgga---gtcaact
A0A3Q3NFM4_BCL2L1-      cagctttaaaagcgtgatggatgaggtgttcaaggatgga---gtcaact
A0A3Q3J5K3_BCL2L1-      cagctttaaaagcgtgatggatgaagtgttcaaagatgga---gtcaact
A0A3B4V9K8_BCL2L1-      cagctttaagagtgtgatggatgagttgttcaaagatgga---gtcaact
A0A3B4XS24_BCL2L1-      cagctttaagagtgtgatggatgagttgttcaaggatgga---gtcaact
A0A3B5B4X7_BCL2L1-      cagcttcaagagtgtgatggacgaggtgttcaaggatggg---gtcaact
A0A3Q1EVP6_BCL2L1-      cagctttaagagtgtgatggatgaggtgttcaaggatggg---gtcaact
A0A3Q1BQA0_BCL2L1-      cagctttaagagtgtgatggacgaggtgttcaaggatggg---gtcaact
A0A3P8U812_BCL2L1-      cagctttaagagtgtgatggacgaggtgttcaaggatggg---gtcaact
E6ZFR0_BCL2L1-01        cagctttaaaagcgtgatggacgaggtgttcaaggatgga---gtgaact
A0A0B4KJI5_BCL2L1-      cagctttaagagcgtgatggacgaggtgttcaaggacgga---gtcaact
A0A3Q3BEB7_BCL2L1-      cagcttcaagagcgtgctggacgagctgttcaaggacggg---gtgaact
A0A3Q2C6K4_BCL2L1-      cagctttaaggccgtgttggacgagttgttcaaggatggg---atcaact
A0A3Q2NRP4_BCL2L1-      cagcttcaaggccgtgctggacgagttgttcaaggacggg---gtcaact
A0A3B5MGS2_BCL2L1-      cagcttcaagaccgtgctggacgagttgttcaagggcggg---gtcaact
M4A558_BCL2L1-01        cagcttcaagaccgtgctggacgagttgttcaagggcggg---gtcaact
A0A3P9QFB3_BCL2L1-      cagcttcaagaccgtgctggatgagttgttcaagggcgag---gtcaact
A0A3B3XN57_BCL2L1-      gagcttcaagactgtgctggatgagttattcaagggtgag---gtcaact
A0A087YBW4_BCL2L1-      gagcttcaagaccgtgctggatgagttgttcaagggtgag---gtcaact
A0A3B3VWI7_BCL2L1-      gagcttcaagaccgtgctggatgagttgttcaagggtgag---gtcaact
                                                                          

R4JQR8_BCL2L1-01        ggggaaggattgtggctcttttcggttttggtgggtctttgtcagtgaaa
A0A346RRN1_BCL2L1-      gggggagggtcgttgccttgttcggttttggaggggccctctcagtagaa
Q2TAP5_BCL2L1-01        gggggagaattgtggctttcttctcatttgggcgggccctatgtgtggag
Q91828_BCL2L1-01        gggggagaattgtggctttcttctcatttgggcgggccctatgtgtggag
H9GHK7_BCL2L1-01        gggggcggatagtggcattcttctcctttgggggagccctgtgcgtggag
F6WA14_BCL2L1-01        ggggccgaattgtggcattcttctccttcggaggggcattgtgtgtggaa
G3WKX6_BCL2L1-01        ggggccgaattgtggcattcttctccttcggaggggcattgtgtgtggaa
A0A452FHY1_BCL2L1-      gggatcacactgtggcctttttctccttcaggggggcactatgcatggaa
A0A452FHY1_BCL2L1-      gggatcacactgtggcctttttctccttcaggggggcactatgcatggaa
A0A3Q1LRT3_BCL2L1-      ggggtcacgttgtggcctttttctccttcagtgggacactatgcatgaaa
A0A452E1B1_BCL2L1-      ggtgtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaa
W5PSA5_BCL2L1-01        ggggtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaa
G3SPN0_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
H0X6V2_BCL2L1-01        ggggtcgaattgtggcctttttctccttcggcggggctctgtgcgtggaa
O35843_BCL2L1-01        ggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaa
P53563_BCL2L1-02        ggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaa
P53563_BCL2L1-03        ggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaa
Q64373_BCL2L1-01        ggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaa
Q64373_BCL2L1-09        ggggtcgcatcgtggcctttttctcctttggcggggcactgtgcgtggaa
P53563_BCL2L1-01        ggggtcgcattgtggccttcttctcctttggcggggcactgtgcgtggaa
Q9MYW4_BCL2L1-01        ggggccgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A1U7QU73_BCL2L1-      ggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaa
G3HEA7_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaa
G3HEA7_BCL2L1-02        ggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaa
B2Z3Z4_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggagccctctgtgtggaa
O77737_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggag
G1P9D2_BCL2L1-01        ggggtcgcattgtggcctttttctcgttcggtggggcattgtgcgtggaa
A0A1S3EPX7_BCL2L1-      ggggtcgaattgtggcctttttctccttcggcggggcactgtgtgtggaa
A0A286Y5D6_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggag
M3XA94_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
M3XA94_BCL2L1-03        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
M3XA94_BCL2L1-02        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
A0A1U7T4L4_BCL2L1-      ggggtcgcatcgtggcctttttctccttcggcggggcactgtgtgtggag
A0A1U7T4L4_BCL2L1-      ggggtcgcatcgtggcctttttctccttcggcggggcactgtgtgtggag
L8J061_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
Q05KJ0_BCL2L1-02        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
Q05KJ0_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
A0A452FWV3_BCL2L1-      ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
Q9MZS7_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
A0A1S2ZQT6_BCL2L1-      ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
A0A3Q2H0F6_BCL2L1-      ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
A0A287CZ07_BCL2L1-      ggggtcacattgtggcctttctctcctttggcggggcactgtgcatggaa
I3MUP5_BCL2L1-02        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
I3MUP5_BCL2L1-03        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
I3MUP5_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A250YD48_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A1L5BWY3_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A3Q2H0F6_BCL2L1-      ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaa
E2IV76_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggcggggccctatgcgtggaa
A0A2K6G3C5_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggccctctgcgtcgaa
A0A2K6G3C5_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggccctctgcgtcgaa
A0A2J8VIH3_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
G1RER8_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2R8Z9D7_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2R8Z9D7_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5H963_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5H963_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A096NV05_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A096NV05_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
Q2PFS6_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5M8B1_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5M8B1_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5VPG2_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5YR37_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5YR37_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5VPG2_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A0D9RJZ8_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
I7GKS6_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K6QFA2_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K6QFA2_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K6QFA2_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K6UWY8_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
E2IV77_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K6UWY8_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5Q6R6_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5Q6R6_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5Q6R6_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
F7IT34_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5EBP4_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
A0A2K5EBP4_BCL2L1-      ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
E2IV75_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaa
Q76LT7_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggag
Q8SQ42_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggag
M3Z2H9_BCL2L1-01        ggggtcgcattgtggcctttttctccttcggtggggctctgtgtgtggag
A0A452SDS4_BCL2L1-      ggggtcgcattgtggcctttttctccttcggtggggcattgtgcgtggag
A0A384D3U1_BCL2L1-      ggggtcgcattgtggcctttttctccttcggtggggcattgtgcgtggag
A0A493TIA6_BCL2L1-      gggggcgcatcgtggccttcttctccttcggaggggcgctgtgcgtggag
A0A452ILL8_BCL2L1-      gggggcgcattgtggcttttttctcctttggaggagccctgtgtgtggag
A0A452ILL8_BCL2L1-      gggggcgcattgtggcttttttctcctttggaggagccctgtgtgtggag
K7F655_BCL2L1-01        gggggcgcattgtggcttttttctcctttggaggagccctgtgcgtggag
U3JSL7_BCL2L1-01        ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
H0Z8G3_BCL2L1-01        ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
A0A218USB3_BCL2L1-      ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
A0A218USB3_BCL2L1-      ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
A0A218USB3_BCL2L1-      ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
A0A218USB3_BCL2L1-      ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
Q4U2V6_BCL2L1-01        ggggccgcatcgtggctttcttctccttcggaggagccttgtgcgtggag
Q07816_BCL2L1-04        ------------------------------gaggggctttgtgcgtggag
Q07816_BCL2L1-03        gggggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggag
Q07816_BCL2L1-02        gggggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggag
Q07816_BCL2L1-01        gggggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggag
G1N5N5_BCL2L1-01        gggggcgcatcgtggctttcttctccttcggaggggctttgtgcgtggag
H3ANS8_BCL2L1-01        gggggcgcgtggtggctttctttgcctttggaggggcgttgtgtgtggag
C1BLI0_BCL2L1-01        ggggacgtgtagtaggcctgtttgcttttggtggtgctctttgtgctgag
A0A3P8XFS0_BCL2L1-      ggggtcgtgtggtgggcctgtttgctttcggcggggccctatgtgttgag
A0A3P8XFS0_BCL2L1-      ggggtcgtgtggtgggcctgtttgctttcggcggggccctatgtgttgag
A0A286MU87_BCL2L1-      ggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttgag
C0HAD8_BCL2L1-01        ggggtcgcgtggtgggtctgtttgctttcggcggggccttgtgtgttgag
H3CH49_BCL2L1-01        gggggcggatagtgggcctttttgccttcggtggtgccctgtgtgtggag
A0A345BSW9_BCL2L1-      ggggccgcatcgtgggactgtttgccttcggaggggctctgtgcgtcgag
Q90Z98_BCL2L1-02        ggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgag
Q90Z98_BCL2L1-01        ggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgag
A0A059PJI5_BCL2L1-      ggggccgtatcgtgggcttgttcgcttttggaggtgccctctgtgtcgag
A0A3B3ZMX9_BCL2L1-      gggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggag
A0A3B3ZMX9_BCL2L1-      gggggcgtgtcgttggcctgtttgccttcgggggcgctctcgctgtggag
D2ITA2_BCL2L1-02        ggggacgcatagtgggcctgtttgccttcgggggggccctctgcgtggag
A0A3P8UWG7_BCL2L1-      ggggtcgcatcatagggctcttcgccttcggcggggcgctgagtgtcgag
A0A3B3QRZ2_BCL2L1-      ggggccgcatcgtgggcctctttgcctttggcggggccctgtgcgtggag
A0A3B1JJ42_BCL2L1-      ggggccgcgtcgtaggtttgttcgctttcggcggggctctgtgtgtggag
A0A3B4DTL9_BCL2L1-      ggggccgtgttgtgggcctgttcgcgttcggtggggccctgtgcgtggag
A0A3P8XYL5_BCL2L1-      ggggaagggttgtgggcctgtttgcgttcggaggggccctctgtgtagag
B5XAY3_BCL2L1-01        ggggacgggtggtgggcctgttttccttcggaggggccctctgtgtagaa
A0A3B3TFR4_BCL2L1-      ggggccgagtggtgggcctcttcgcctttggtggcgcgttgtgcgtggag
A0A3Q3DUT7_BCL2L1-      ggggccgcatcgtggggctcttcgcgttcggcggcgcgctgtgcgtcgaa
A0A3Q3DUT7_BCL2L1-      ggggccgcatcgtggggctcttcgcgttcggcggcgcgctgtgcgtcgaa
A0A3Q3DUT7_BCL2L1-      ggggccgcatcgtggggctcttcgcgttcggcggcgcgctgtgcgtcgaa
W5MG74_BCL2L1-01        gggggcgcatcgtggggctcttcgctttcgggggtgcgctgtgcgtggag
A0A3Q3WIW8_BCL2L1-      ggggacgcatagtcggactcttcgctttcggcggtgcactgtgcgtagag
A0A2U9BY16_BCL2L1-      ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggag
A0A2U9BY16_BCL2L1-      ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggag
A0A2U9BY16_BCL2L1-      ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggag
A0A2U9BY16_BCL2L1-      ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggag
A0A2U9BY16_BCL2L1-      ggggccgcatcatagggctttttgcatttggcggggcgctgagtgtggag
A0A3B5PQJ0_BCL2L1-      ggggccgcatcgtggggctcttcgcgtttggtggcgcgctgtgcgtggag
A0A3P9N9Y4_BCL2L1-      ggggccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggag
A0A3B3WI27_BCL2L1-      ggggccgaatcgtggggctcttcgcgtttggtggcgcgctctgcgtggag
A0A087X9B7_BCL2L1-      ggggccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggaa
A0A3B3TUS7_BCL2L1-      ggggccgcatcgtggggctcttcgcgtttggtggcgcgctctgcgtggaa
A0A3Q2FR43_BCL2L1-      ggggccgcatcgtgggcctgttcgccttcggcggagcgctgtgcgtggaa
A0A3Q2QPL9_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggcgcgctctgcgtggag
A0A3Q3B3X5_BCL2L1-      ggggccgcattgtggggctctttgcattcggcggagcgctgtgcgtcgag
A0A3Q0RTF8_BCL2L1-      ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgag
I3IZK7_BCL2L1-01        ggggccgcatcgtagggctttttgcgttcggcggggcactgtgtgttgag
A0A3Q4N4B5_BCL2L1-      ggggccgcatcgtagggctttttgcgttcggtggggcactgtgtgtcgag
A0A3Q2X557_BCL2L1-      ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgag
A0A3P8P0F1_BCL2L1-      ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgag
A0A3P9D632_BCL2L1-      ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgag
A0A3P9D632_BCL2L1-      ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgag
A0A3B4FNX1_BCL2L1-      ggggccgcatcgtagggcttttcgcgttcggcggggcactgtgtgtcgag
G3NJY1_BCL2L1-01        ggggccgcatcgtggggctgttcgccttcggcggggcgctgtgcgtggag
A0A3B3DHA1_BCL2L1-      gggggcgcatcgtggggctcttcgcgttcggcggggcgctgtgcgtcgag
A0A3B3IB64_BCL2L1-      ggggccgcatcgtggggctcttcgcattcggcggggcgctgtgcgtggag
A0A3P9JYH1_BCL2L1-      ggggccgcatcgtggggctcttcgcattcggcggggcgctgtgcgtggag
C3VIT1_BCL2L1-01        ggggtcgcatcgtggggcttttcgctttcggcggggcgctgtgcgtggag
A0A3B4Z3X2_BCL2L1-      ggggccgcatcgtagggcttttcgcgttcggcggggcgctgtgtgtcgag
A0A3B4Z3X2_BCL2L1-      ggggccgcatcgtagggcttttcgcgttcggcggggcgctgtgtgtcgag
A0A3Q1FR00_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgcgtcgag
A0A3Q1FR00_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgcgtcgag
A0A3Q1DHJ3_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgtcgag
A0A3Q1DHJ3_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgtcgag
A0A3Q1DHJ3_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgtcgag
A0A3P8TL99_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgtcgag
A0A3P8TL99_BCL2L1-      ggggccgcatcgtggggctgttcgcgttcggcggggcgctgtgtgtcgag
A0A219P0Y3_BCL2L1-      ggggccgcatcgtagggcttttcgctttcggcggggcgctgtgcgtggag
A0A3Q3G2E1_BCL2L1-      ggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgag
A0A3Q3G2E1_BCL2L1-      ggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgag
A0A3Q3G2E1_BCL2L1-      ggggccgcatcgtggggctctttgctttcggcggggcgctgtgtgtcgag
A0A3B4V3T1_BCL2L1-      ggggccgcatcatagggctttttgtgttcggcggggcgctgtgtgtcgag
A0A3B4XU17_BCL2L1-      ggggccgcatcatagggctttttgtgttcggcggggcgctgtgtgtcgag
A0A3Q3IVF5_BCL2L1-      ggggccgcatcatagggctttttgcatttggcggggcgttgtgtgtcgag
A0A3Q3MX20_BCL2L1-      ggggtcgcatcatagggctttttgcattcggcggggctctgtgtgtcgag
A0A3Q1GZ93_BCL2L1-      ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgag
A0A3Q1GZ93_BCL2L1-      ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgag
A0A3Q1GZ93_BCL2L1-      ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgag
A0A0D6DR75_BCL2L1-      ggggccgcatcatagggctctttgcatttggtggggcactgtgtgttgag
A0A3B3E2W4_BCL2L1-      gggggcgtgttgtgggtttgtttgtctttggtggtgtgctgtgtgttgag
A0A3P9MKK4_BCL2L1-      gggggcgcgttgtgggtttatttgtctttggtggtgcgctgtgtgtcgag
A0A3P9MKK4_BCL2L1-      gggggcgcgttgtgggtttatttgtctttggtggtgcgctgtgtgtcgag
A0A3B3I2Q5_BCL2L1-      gggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgag
A0A3B3I2Q5_BCL2L1-      gggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgag
A0A3P9I2N4_BCL2L1-      gggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgag
A0A3P9I2N4_BCL2L1-      gggggcgcgttgtgggtttgtttgtctttggtggtgcgctgtgtgtcgag
A0A3B4BFZ8_BCL2L1-      ggggacggattgtgggtctttttgtttttggaggggttttgagtgtggag
A0A3P8VMA1_BCL2L1-      ggggacgcatagtcggcctgtttactttcggaggagtactgtgtgtggaa
A0A0F7L1T6_BCL2L1-      ggggacgagttgtgggactatttgcctttggcggggtactatgtgtggaa
H2U5I3_BCL2L1-01        ggggacgagttgtgggactatttgcctttggcggggtactatgtgtggaa
G3P7B4_BCL2L1-01        ggggccgcgtggtgggcctgtttgccttcggcggcgtgctctgcgtggag
A0A3Q3FUB6_BCL2L1-      gggggcgtatagtaggcctgtttgcctttggcggtgtactgtgtgtggaa
A0A3Q3X5M5_BCL2L1-      ggggacgtatagtgggactgtttgcctttggaggtgttctatgtgtggaa
A0A2U9BIG9_BCL2L1-      ggggacgtatagtgggcctgttcgcttttggcggcgtgctgtgtgtggaa
A0A3Q1JZ46_BCL2L1-      ggggacgtatagtggggctgtttgccttcggtggcgtgctgtgtgtggaa
A0A3Q1JZ46_BCL2L1-      ggggacgtatagtggggctgtttgccttcggtggcgtgctgtgtgtggaa
A0A3Q3NFM4_BCL2L1-      ggggacgcatagtgggcctgtttgctttcggtggtgtactgtgtgtggaa
A0A3Q3NFM4_BCL2L1-      ggggacgcatagtgggcctgtttgctttcggtggtgtactgtgtgtggaa
A0A3Q3J5K3_BCL2L1-      ggggacgtattgtgggcttgtttgcttttggtggtgcactgtgtgtggaa
A0A3B4V9K8_BCL2L1-      ggggacgtatagtgggcctatttgcctttgggggtgtactgtgtgtggaa
A0A3B4XS24_BCL2L1-      ggggacgtatagtgggcctgtttgcctttgggggtgtactgtgtgtggaa
A0A3B5B4X7_BCL2L1-      ggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaa
A0A3Q1EVP6_BCL2L1-      ggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaa
A0A3Q1BQA0_BCL2L1-      ggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaa
A0A3P8U812_BCL2L1-      ggggacgtatagtgggcctgttttgctttggcggtgtactgtgtgtggaa
E6ZFR0_BCL2L1-01        ggggacgtatagtgggcctgtttgcctttggcggtgtactgtgtgtagaa
A0A0B4KJI5_BCL2L1-      ggggacgtgtagtgggcctgtttgcttttggcggtgtgctgtgtgtggaa
A0A3Q3BEB7_BCL2L1-      ggggccgcgtggtgggcctgtttgccttcggcggcgtgctgtgcgttcag
A0A3Q2C6K4_BCL2L1-      ggggccgtgtggtggggctgtttgcctttggtggggttctgtgtgtgcac
A0A3Q2NRP4_BCL2L1-      gggggcgcgtggtggggctgtttgccttcggcggggttctgtgtgtggac
A0A3B5MGS2_BCL2L1-      gggggcgggtggtggccatgtttaccttcggggggattctgtgtgtggac
M4A558_BCL2L1-01        gggggcgggtggtggccatgtttaccttcggggggattctgtgtgtggac
A0A3P9QFB3_BCL2L1-      ggggtcgggtggtggccatgtttacctttggggggattctgtgtgtggac
A0A3B3XN57_BCL2L1-      ggggtcgggtggtggccatgtttacctttgggggaattctgtgtgtggat
A0A087YBW4_BCL2L1-      ggggtcgggtggtggccatgtttacctttgggggaattctgtgtgtggat
A0A3B3VWI7_BCL2L1-      ggggtcgggtggtggccatgtttacctttggggggattctgtgtgtggat
                                                      *  *     *        * 

R4JQR8_BCL2L1-01        tgtgtacaaagaggaatgccacaacttgtggattcaattgttgactgggt
A0A346RRN1_BCL2L1-      tgtgtacaaaatggaatgccacaacttgtagactcgatcgttgactgggt
Q2TAP5_BCL2L1-01        agtgcaaacaaggagatgactgatctgctacccagaattgtccagtggat
Q91828_BCL2L1-01        agtgcaaacaaggagatgactgatctgctacccagaattgtccagtggat
H9GHK7_BCL2L1-01        agcgttgacaaagagatgcaagggttggtggtgaggattgccagctggat
F6WA14_BCL2L1-01        agcgtggataaggagatggaagtcttggtaggacgcatcacctcctggat
G3WKX6_BCL2L1-01        agcgtggataaagagatggaagtcttggtagcacgcatcacctcctggat
A0A452FHY1_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggat
A0A452FHY1_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggat
A0A3Q1LRT3_BCL2L1-      agcatagacaaggagatacacgtattggtgagtcaggtcacaacttcaac
A0A452E1B1_BCL2L1-      agcatagtcaaggagatgcaggtattggtaagtcaggtcacgacttggat
W5PSA5_BCL2L1-01        agcatagtcaaggagatgcaggtattggtaagtcaggtcacgacttggat
G3SPN0_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
H0X6V2_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
O35843_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggattgcaagttggat
P53563_BCL2L1-02        agcgtagacaaggagatgcaggtattggtgagtcggattgcaagttggat
P53563_BCL2L1-03        agcgtagacaaggagatgcaggtattggtgagtcggattgcaagttggat
Q64373_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggattgcaagttggat
Q64373_BCL2L1-09        agcgtagacaaggagatgcaggtattggtgagtcggattgcaagttggat
P53563_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggattgcaagttggat
Q9MYW4_BCL2L1-01        agcgtggacaaggagatggaggtattggtgagtcggatcgcggcgtggat
A0A1U7QU73_BCL2L1-      agcgtagacaaggagatgcaggtgttggtgagtcggattgcaagttggat
G3HEA7_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
G3HEA7_BCL2L1-02        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
B2Z3Z4_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
O77737_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
G1P9D2_BCL2L1-01        agtgtggacaaggagatgcaggtattggtgagtcggattgcaacgtggat
A0A1S3EPX7_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
A0A286Y5D6_BCL2L1-      agcgtagacaaggagatgcaggtattggtgaggcggatcgcaagctggat
M3XA94_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
M3XA94_BCL2L1-03        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
M3XA94_BCL2L1-02        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A1U7T4L4_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A1U7T4L4_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
L8J061_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
Q05KJ0_BCL2L1-02        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
Q05KJ0_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A452FWV3_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
Q9MZS7_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A1S2ZQT6_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A3Q2H0F6_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacctggat
A0A287CZ07_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
I3MUP5_BCL2L1-02        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
I3MUP5_BCL2L1-03        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
I3MUP5_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
A0A250YD48_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
A0A1L5BWY3_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaagttggat
A0A3Q2H0F6_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacctggat
E2IV76_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A2K6G3C5_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A2K6G3C5_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A2J8VIH3_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggattgcagcttggat
G1RER8_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggattgcagcttggat
A0A2R8Z9D7_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2R8Z9D7_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5H963_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A2K5H963_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A096NV05_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A096NV05_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
Q2PFS6_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5M8B1_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5M8B1_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5VPG2_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5YR37_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5YR37_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5VPG2_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A0D9RJZ8_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
I7GKS6_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K6QFA2_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K6QFA2_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K6QFA2_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K6UWY8_BCL2L1-      agcgtagacaaggagatgcaagtattggtgagtcggatcgcagcttggat
E2IV77_BCL2L1-01        agcgtagacaaggagatgcaagtattggtgagtcggatcgcagcttggat
A0A2K6UWY8_BCL2L1-      agcgtagacaaggagatgcaagtattggtgagtcggatcgcagcttggat
A0A2K5Q6R6_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5Q6R6_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5Q6R6_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
F7IT34_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5EBP4_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
A0A2K5EBP4_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
E2IV75_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
Q76LT7_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
Q8SQ42_BCL2L1-01        agcgtagacaaggagatgcaggtattggtgagtcggatcgcagcttggat
M3Z2H9_BCL2L1-01        agcgtagacaaggagatgcaggcattggtgagtcggatcgcaacttggat
A0A452SDS4_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A384D3U1_BCL2L1-      agcgtagacaaggagatgcaggtattggtgagtcggatcgcaacttggat
A0A493TIA6_BCL2L1-      agcgtggacaaggagatgagggtcctggtggggcgcatcgtggcctggat
A0A452ILL8_BCL2L1-      agtgtcgacaaggagatgcaggtgttggttggacgcatcgtctcatggat
A0A452ILL8_BCL2L1-      agtgtcgacaaggagatgcaggtgttggttggacgcatcgtctcatggat
K7F655_BCL2L1-01        agtgtggacaaggagatgcaggtgttggtgggacgcatcgcctcttggat
U3JSL7_BCL2L1-01        agcgttgttaaggagatgcgggtattggtgaaacgcatcgtgtcttggat
H0Z8G3_BCL2L1-01        agcgttgttaaggagatgagggtattggtgaaacgcatcgtctcttggat
A0A218USB3_BCL2L1-      agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
A0A218USB3_BCL2L1-      agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
A0A218USB3_BCL2L1-      agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
A0A218USB3_BCL2L1-      agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
Q4U2V6_BCL2L1-01        agcgttgttaaggagatgagggtattggtgaaacgcatcgtgtcttggat
Q07816_BCL2L1-04        agcgtggacaaggagatgcgggtactggtgggacgcattgtgtcttggat
Q07816_BCL2L1-03        agcgtggacaaggagatgcgggtactggtgggacgcattgtgtcttggat
Q07816_BCL2L1-02        agcgtggacaaggagatgcgggtactggtgggacgcattgtgtcttggat
Q07816_BCL2L1-01        agcgtggacaaggagatgcgggtactggtgggacgcattgtgtcttggat
G1N5N5_BCL2L1-01        agcgtggacaaggagatgcgggtactggtgggacgcattgtgtcttggat
H3ANS8_BCL2L1-01        agtatggacaaggagatgtcttcactagtagagcggatcgctgagtggat
C1BLI0_BCL2L1-01        tgtgtcgagaaggatatgagtcacctggtagcgcgtattgcagattggat
A0A3P8XFS0_BCL2L1-      tgtgttgagaaggatatgagcctcctagtggcacgtattgcagactggat
A0A3P8XFS0_BCL2L1-      tgtgttgagaaggatatgagcctcctagtggcacgtattgcagactggat
A0A286MU87_BCL2L1-      tgtgttgagaaggatatgagcccgctggtggcgcgcatcgcagattggat
C0HAD8_BCL2L1-01        tgtgttgagaaggatatgagcccactggtggcgcgcatcgcagactggat
H3CH49_BCL2L1-01        tgtgtggagaaggagatgaatcctctggttggccggatcatagagtggat
A0A345BSW9_BCL2L1-      tgtgtggagaaggagatgagcccattagtgggacgcattgcagaatggat
Q90Z98_BCL2L1-02        tgtgtggagaaggagatgagtccgcttgtgggacgcatcgcagaatggat
Q90Z98_BCL2L1-01        tgtgtggagaaggagatgagtccgcttgtgggacgcatcgcagaatggat
A0A059PJI5_BCL2L1-      tgtgtggaaaaggagatgagtccgctggtggcacgtatcgccgagtggat
A0A3B3ZMX9_BCL2L1-      tgtgtggacaaagagatgagcaccctagtggctcgcatcgtcacctggat
A0A3B3ZMX9_BCL2L1-      tgtgtggacaaagagatgagcaccctagtggctcgcatcgtcacctggat
D2ITA2_BCL2L1-02        tgtgtggagaaggagatgagccacatggtgccccgcgtggcagagtggat
A0A3P8UWG7_BCL2L1-      tgcgtggagaaagagatgagtcagctggtggccaggattgcggattggat
A0A3B3QRZ2_BCL2L1-      tgtgtggagaaggagatgggccacctggtggatcgtattgctgactggat
A0A3B1JJ42_BCL2L1-      tgcgtggagaaggagatgagccccctggtgggacgcatcgcagagtggat
A0A3B4DTL9_BCL2L1-      tgtgtggaaaaggagatgagcccactcgtgggacgcatcgcagagtggat
A0A3P8XYL5_BCL2L1-      tgcgtggagaaggagatgagcccccttgtgggacggattgctgactggat
B5XAY3_BCL2L1-01        tgtgtggacaaggagatgaaccccttggtgggaaggatcacagactggat
A0A3B3TFR4_BCL2L1-      tgtgtcgagaaggagatgagcccgctggtgggccacattgtggactggat
A0A3Q3DUT7_BCL2L1-      tgcatggagaaggagatgatccccctggttgacaggatcatcgagtggat
A0A3Q3DUT7_BCL2L1-      tgcatggagaaggagatgatccccctggttgacaggatcatcgagtggat
A0A3Q3DUT7_BCL2L1-      tgcatggagaaggagatgatccccctggttgacaggatcatcgagtggat
W5MG74_BCL2L1-01        tgcgtggagaaggagatgagcaacctggtgagccgcatagccgagtggat
A0A3Q3WIW8_BCL2L1-      tgcgttgagaaggagatgagtccactggtgggcaggatcatcgagtggat
A0A2U9BY16_BCL2L1-      tgtgtggagaaggagatgagttcgctggtgggcaggatcgttgagtggat
A0A2U9BY16_BCL2L1-      tgtgtggagaaggagatgagttcgctggtgggcaggatcgttgagtggat
A0A2U9BY16_BCL2L1-      tgtgtggagaaggagatgagttcgctggtgggcaggatcgttgagtggat
A0A2U9BY16_BCL2L1-      tgtgtggagaaggagatgagttcgctggtgggcaggatcgttgagtggat
A0A2U9BY16_BCL2L1-      tgtgtggagaaggagatgagttcgctggtgggcaggatcgttgagtggat
A0A3B5PQJ0_BCL2L1-      tgcgtggagaaggagatgagccacctggtagccaggattgtagagtggat
A0A3P9N9Y4_BCL2L1-      tgtgtggagaaggagatgagccacctggtagccaggattgtagagtggat
A0A3B3WI27_BCL2L1-      tgtgtggagaaggagatgagccacctggtagccaggattgtagagtggat
A0A087X9B7_BCL2L1-      tgcgttgagaaggagatgagccacctggtagccaggattgtagagtggat
A0A3B3TUS7_BCL2L1-      tgcgttgagaaggagatgagccacctggtagccaggattgtagagtggat
A0A3Q2FR43_BCL2L1-      tgcgtggagaaggagatgagtcccctggtggggcggatcgtggagtggat
A0A3Q2QPL9_BCL2L1-      tgcgtggagaaggagatgagtcccctggtgggccgcatcgtggagtggat
A0A3Q3B3X5_BCL2L1-      tgcgtcgagaaggagatgagtcacctggtggccaggattgtggagtggat
A0A3Q0RTF8_BCL2L1-      tgtgtcgagaaggagatgagccccctggtgggcaggatcgtagagtggat
I3IZK7_BCL2L1-01        tgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtggat
A0A3Q4N4B5_BCL2L1-      tgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtggat
A0A3Q2X557_BCL2L1-      tgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtggat
A0A3P8P0F1_BCL2L1-      tgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtggat
A0A3P9D632_BCL2L1-      tgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtggat
A0A3P9D632_BCL2L1-      tgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtggat
A0A3B4FNX1_BCL2L1-      tgcgtcgagaaggagatgagccccttggtgggcaggatcgtagagtggat
G3NJY1_BCL2L1-01        tgcgtggacaaggagatgagtccgctggtgggcaggatcgtcgagtggat
A0A3B3DHA1_BCL2L1-      tgcgtggagaaggagatgagccccctggtggacaggattgtggagtggat
A0A3B3IB64_BCL2L1-      tgcgttgagaaggagatgagccccctggtggaccggattgtggagtggat
A0A3P9JYH1_BCL2L1-      tgcgttgagaaggagatgagccccctggtggaccggattgtggagtggat
C3VIT1_BCL2L1-01        tgcgtggagagggagatgagccccttggtgggcaggatcgtggagtggat
A0A3B4Z3X2_BCL2L1-      tgcgtcgagaaggagatgagccccctggtgggccggatcgtagagtggat
A0A3B4Z3X2_BCL2L1-      tgcgtcgagaaggagatgagccccctggtgggccggatcgtagagtggat
A0A3Q1FR00_BCL2L1-      tgcgtggaaaaggagatgagccccctggtgggcaggatcgtagagtggat
A0A3Q1FR00_BCL2L1-      tgcgtggaaaaggagatgagccccctggtgggcaggatcgtagagtggat
A0A3Q1DHJ3_BCL2L1-      tgcgtggagaaggagatgagccccctggtgggcaggatcgtagagtggat
A0A3Q1DHJ3_BCL2L1-      tgcgtggagaaggagatgagccccctggtgggcaggatcgtagagtggat
A0A3Q1DHJ3_BCL2L1-      tgcgtggagaaggagatgagccccctggtgggcaggatcgtagagtggat
A0A3P8TL99_BCL2L1-      tgcgtggagaaggagatgagccccctggtgggcaggatcgtagagtggat
A0A3P8TL99_BCL2L1-      tgcgtggagaaggagatgagccccctggtgggcaggatcgtagagtggat
A0A219P0Y3_BCL2L1-      tgcgttgagaaggagatgagtccgttggtgggcaggatcatagagtggaa
A0A3Q3G2E1_BCL2L1-      tgcgtggagaaggagatgagtcccctcgttggcaggatcatagagtggat
A0A3Q3G2E1_BCL2L1-      tgcgtggagaaggagatgagtcccctcgttggcaggatcatagagtggat
A0A3Q3G2E1_BCL2L1-      tgcgtggagaaggagatgagtcccctcgttggcaggatcatagagtggat
A0A3B4V3T1_BCL2L1-      tgtgtggagaaggagatgagtcctctggtgggcaggatcgtagagtggat
A0A3B4XU17_BCL2L1-      tgtgtggagaaggagatgagtcctctggtgggcaggatcgtagagtggat
A0A3Q3IVF5_BCL2L1-      tgtgtggagaaagagatgagtccgctggtgggtaggattgtagagtggat
A0A3Q3MX20_BCL2L1-      tgtgtggagaaggagatgagtccactggtgggcaggattgtggagtggat
A0A3Q1GZ93_BCL2L1-      tgtgtggagaaggagatgagtcagctggtgggaaggatcgtagagtggat
A0A3Q1GZ93_BCL2L1-      tgtgtggagaaggagatgagtcagctggtgggaaggatcgtagagtggat
A0A3Q1GZ93_BCL2L1-      tgtgtggagaaggagatgagtcagctggtgggaaggatcgtagagtggat
A0A0D6DR75_BCL2L1-      tgtgtggagaaggagatgagtcagctggtggtcaggatcgtagagtggat
A0A3B3E2W4_BCL2L1-      tgtgtcgagaggaatatgagtgagctggtctcccgcattgctgaatggat
A0A3P9MKK4_BCL2L1-      tgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggat
A0A3P9MKK4_BCL2L1-      tgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggat
A0A3B3I2Q5_BCL2L1-      tgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggat
A0A3B3I2Q5_BCL2L1-      tgtgtcgagaggaatatgggtgagctggtctcccgcattgctgaatggat
A0A3P9I2N4_BCL2L1-      tgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggat
A0A3P9I2N4_BCL2L1-      tgtgtagagaggaatatgggtgagctggtctcccgcattgctgaatggat
A0A3B4BFZ8_BCL2L1-      tgtgtggagaaggatatgagcattctggttcctcgcattgctaactggat
A0A3P8VMA1_BCL2L1-      tgtgtgcagaggaatatgagtgagttagttccccgcattgcagactggat
A0A0F7L1T6_BCL2L1-      tgtgtcgagagggatgcgagccaactggtttgccgcattgcagactggat
H2U5I3_BCL2L1-01        tgtgtcgagaaggatgcgagccaactggtttgccgcattgcagactggat
G3P7B4_BCL2L1-01        tgcgtagagaaggacatgaccgagctggtgtcccgcatcgcggactggat
A0A3Q3FUB6_BCL2L1-      tgcgtccagaaggatatgggtgaactggtttcccgcatcgcaggctggat
A0A3Q3X5M5_BCL2L1-      tgtgctgagaaggatacaggtgagcttgtttgccgcattgcagactggat
A0A2U9BIG9_BCL2L1-      tgcgtcgagaagaataggggcgagctggtcgcccgtatcgctgactggat
A0A3Q1JZ46_BCL2L1-      tgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggat
A0A3Q1JZ46_BCL2L1-      tgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggat
A0A3Q3NFM4_BCL2L1-      tgcattgagaagaacatgagtgcgctggtgtcccgcatcgcagattggat
A0A3Q3NFM4_BCL2L1-      tgcattgagaagaacatgagtgcgctggtgtcccgcatcgcagattggat
A0A3Q3J5K3_BCL2L1-      tgcgtcgagaagaatatgagtgagctggtgtcccgcatcgcagactggat
A0A3B4V9K8_BCL2L1-      tgcatacagaagaatatgagcgagctggtttcccgtatcacagactggat
A0A3B4XS24_BCL2L1-      tgcatacagaagaatatgagcgagctggtttcccgtatcgcagactggat
A0A3B5B4X7_BCL2L1-      tgcgtagacaagaatatgaacgagctggttccccgcatcgcagactggat
A0A3Q1EVP6_BCL2L1-      tgcgtagagaagaatatgagtgagctggttccccgcatcgctgactggat
A0A3Q1BQA0_BCL2L1-      tgcgtagagaagaatatgagtgagctggttccccgcatcgctgactggat
A0A3P8U812_BCL2L1-      tgcgtagataagaatatgagtgagctggttccccgcatcgctgactggat
E6ZFR0_BCL2L1-01        tgtgtcgagaaagatatgagtgagctggtttcccgcatcgcagactggat
A0A0B4KJI5_BCL2L1-      tgcgttgagaaggatacgagcgagctggtctcccgcatcgcagactggat
A0A3Q3BEB7_BCL2L1-      tgcgtcgagagggacatgagtgagctggtctcccgcattgcagactggat
A0A3Q2C6K4_BCL2L1-      tgcgtgcagaagaatatgagtgagttggtgtcccgcattgcagactggat
A0A3Q2NRP4_BCL2L1-      tgcgtccagaagaacatgagcgagctggtgccccgcatcgcagactggat
A0A3B5MGS2_BCL2L1-      tgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggat
M4A558_BCL2L1-01        tgcgtccagaagaatatgagtgagctggtctcccgcattgccgaatggat
A0A3P9QFB3_BCL2L1-      tgcgtccagaagaatatgagcgagctggtctcccgcattgctgaatggat
A0A3B3XN57_BCL2L1-      tgcgttcagaagaatatgagtgagctggtctcccgcattgccgaatggat
A0A087YBW4_BCL2L1-      tgcgttcagaagaatatgagtgagctggtctcccgcattgccgaatggat
A0A3B3VWI7_BCL2L1-      tgcgttcagaagaatatgagcgagctggtctcccgcattgccgaatggat
                         *       *               *  *        *       *    

R4JQR8_BCL2L1-01        atctacctatttgtgtaatagtttagagcaatggattacagataacggtg
A0A346RRN1_BCL2L1-      ttctgtatatttatgtgataatttagaaccatggattacttcaaatggtg
Q2TAP5_BCL2L1-01        ggtgaattatctagagcacacactgcagccctggatgcaggagaatggag
Q91828_BCL2L1-01        ggtgaattatctagagcacacactgcagccctggatgcaggagaatggag
H9GHK7_BCL2L1-01        gaccacgtacctgactgaacacctggacccctggatccaagaaaacggtg
F6WA14_BCL2L1-01        ggccacttacttggatgaccacctagacccttggatccaagaaaatggcg
G3WKX6_BCL2L1-01        ggccacttacttggatgagcacctagacccatggatccaagaaaatggcg
A0A452FHY1_BCL2L1-      ggccagccagctaaatgaccacctagagccttggatccaggagaatggcg
A0A452FHY1_BCL2L1-      ggccagccagctaaatgaccacctagagccttggatccaggagaatggcg
A0A3Q1LRT3_BCL2L1-      ggccacttacctaaataaccacctcaagccttggatccaagagaacggcg
A0A452E1B1_BCL2L1-      ggccacttacctaaataaccacctagagccttggatccaggagaatggcg
W5PSA5_BCL2L1-01        ggccacttacctaaatgaccacctagagccttggatccaggagaatggcg
G3SPN0_BCL2L1-01        ggctacttacctgaatgaccacctagagccttggatccaggagaacggcg
H0X6V2_BCL2L1-01        ggccacttacttgaatgaccacctagagccttggatccaggagaacggcg
O35843_BCL2L1-01        ggccacctatctgaatgaccacctagagccttggatccaggagaacggcg
P53563_BCL2L1-02        ggccacctacctgaatgaccacctagagccttggatccaggagaacggcg
P53563_BCL2L1-03        ggccacctacctgaatgaccacctagagccttggatccaggagaacggcg
Q64373_BCL2L1-01        ggccacctatctgaatgaccacctagagccttggatccaggagaacggcg
Q64373_BCL2L1-09        ggccacctatctgaatgaccacctagagccttggatccaggagaacggcg
P53563_BCL2L1-01        ggccacctacctgaatgaccacctagagccttggatccaggagaacggcg
Q9MYW4_BCL2L1-01        ggccacttacctgaatgaccacctggagccctggatccaggagaacggcg
A0A1U7QU73_BCL2L1-      ggccacctacctgaatgaccacctagagccttggatccaggacaacggcg
G3HEA7_BCL2L1-01        ggccacctacctgaatgaccacctagagccttggatccaggacaacggcg
G3HEA7_BCL2L1-02        ggccacctacctgaatgaccacctagagccttggatccaggacaacggcg
B2Z3Z4_BCL2L1-01        ggccacctacctgaatgaccacctagagccttggatccaggacaacggcg
O77737_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
G1P9D2_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggag
A0A1S3EPX7_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagcacggcg
A0A286Y5D6_BCL2L1-      ggctacttacctgaatgaccacctagaaccttggatccaggacaacggcg
M3XA94_BCL2L1-01        ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
M3XA94_BCL2L1-03        ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
M3XA94_BCL2L1-02        ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
A0A1U7T4L4_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggacaacggcg
A0A1U7T4L4_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggacaacggcg
L8J061_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
Q05KJ0_BCL2L1-02        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
Q05KJ0_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A452FWV3_BCL2L1-      ggctacttacctgaatgaccacctagagccttggatccaggagaacggcg
Q9MZS7_BCL2L1-01        ggctacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A1S2ZQT6_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaatggcg
A0A3Q2H0F6_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaagagaacggcg
A0A287CZ07_BCL2L1-      ---------------------------gccttggatccaagagaacggcg
I3MUP5_BCL2L1-02        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
I3MUP5_BCL2L1-03        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
I3MUP5_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A250YD48_BCL2L1-      ggctacttacctgaatgaccacctagaaccttggatccaggagaacggcg
A0A1L5BWY3_BCL2L1-      ggctacttacctgaatgaccacctagaaccttggatccaggagaacggcg
A0A3Q2H0F6_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaagagaacggcg
E2IV76_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K6G3C5_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K6G3C5_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2J8VIH3_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
G1RER8_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2R8Z9D7_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2R8Z9D7_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5H963_BCL2L1-      ggccacttatctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5H963_BCL2L1-      ggccacttatctgaatgaccacctagagccttggatccaggagaacggcg
A0A096NV05_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A096NV05_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
Q2PFS6_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5M8B1_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5M8B1_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5VPG2_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5YR37_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5YR37_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5VPG2_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A0D9RJZ8_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
I7GKS6_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K6QFA2_BCL2L1-      ggccacttatctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K6QFA2_BCL2L1-      ggccacttatctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K6QFA2_BCL2L1-      ggccacttatctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K6UWY8_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
E2IV77_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K6UWY8_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5Q6R6_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5Q6R6_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5Q6R6_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
F7IT34_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5EBP4_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
A0A2K5EBP4_BCL2L1-      ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
E2IV75_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
Q76LT7_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
Q8SQ42_BCL2L1-01        ggccacttacctgaatgaccacctagagccttggatccaggagaacggcg
M3Z2H9_BCL2L1-01        ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
A0A452SDS4_BCL2L1-      ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
A0A384D3U1_BCL2L1-      ggccacttacctgaacgaccacctagagccttggatccaggagaacggcg
A0A493TIA6_BCL2L1-      gaccacctacctgagcgaccacctcgacccctggatccaggagaacggcg
A0A452ILL8_BCL2L1-      gaccacttacctgactgaccacctagatccctggatccaagagaatggcg
A0A452ILL8_BCL2L1-      gaccacttacctgactgaccacctagatccctggatccaagagaatggcg
K7F655_BCL2L1-01        gaccacttacctgactgaccaccttgatccctggatccaagagaatggcg
U3JSL7_BCL2L1-01        gaccacgtacttgaccgaccacttagatccctggatccaggagaatggcg
H0Z8G3_BCL2L1-01        gaccacgtacttgaccgaccacttagatccctggatccaggagaatggcg
A0A218USB3_BCL2L1-      gaccacgtacttgaccgaccacttggatccctggatccaggagaatggcg
A0A218USB3_BCL2L1-      gaccacgtacttgaccgaccacttggatccctggatccaggagaatggcg
A0A218USB3_BCL2L1-      gaccacgtacttgaccgaccacttggatccctggatccaggagaatggcg
A0A218USB3_BCL2L1-      gaccacgtacttgaccgaccacttggatccctggatccaggagaatggcg
Q4U2V6_BCL2L1-01        gaccacgtacttgaccgaccacttagatccctggatccaggagaatggcg
Q07816_BCL2L1-04        gaccacgtacttgaccgaccatctagatccctggatccaggagaatggcg
Q07816_BCL2L1-03        gaccacgtacttgaccgaccatctagatccctggatccaggagaatggcg
Q07816_BCL2L1-02        gaccacgtacttgaccgaccatctagatccctggatccaggagaatggcg
Q07816_BCL2L1-01        gaccacgtacttgaccgaccatctagatccctggatccaggagaatggcg
G1N5N5_BCL2L1-01        gaccacgtacttgaccgaccatctagacccctggatccaggagaatggcg
H3ANS8_BCL2L1-01        gacgacttacctagatgataacttaaacccttggattcaggaacaaggag
C1BLI0_BCL2L1-01        gaccacctacctggacaaccacatccagccatggatacagagacagggtg
A0A3P8XFS0_BCL2L1-      gaccacctacctggacgaacacatccagccctggatccaaattcaaggag
A0A3P8XFS0_BCL2L1-      gaccacctacctggacgaacacatccagccctggatccaaattcaaggag
A0A286MU87_BCL2L1-      gaccacctatctggacaaccatatccagccctggatccagagccaaggcg
C0HAD8_BCL2L1-01        gaccacctacctggacaaccatatccagccctggatccagagccaaggag
H3CH49_BCL2L1-01        gacggtctatctggacaaccacatccagccctggatccagagtcaaggag
A0A345BSW9_BCL2L1-      gaccgtctacctggacaaccacattcagccctggatccagagccaaggag
Q90Z98_BCL2L1-02        gaccgtctacctagacaaccatattcaaccctggatccaaagccaaggag
Q90Z98_BCL2L1-01        gaccgtctacctagacaaccatattcaaccctggatccaaagccaaggag
A0A059PJI5_BCL2L1-      gaccgtctacctggacaaccacatccagccctggattgaagagcaaggag
A0A3B3ZMX9_BCL2L1-      gactgtgtatctggacgaacacatccaagactggatcgactcgcaagggg
A0A3B3ZMX9_BCL2L1-      gactgtgtatctggacgaacacatccaagactggatcgactcgcaagggg
D2ITA2_BCL2L1-02        gaccaggtacctggacgaccacattgaccactggatccagagcaacggag
A0A3P8UWG7_BCL2L1-      gacagtctatcttgacaaccacatccagccatggatcgaaacccaaggtg
A0A3B3QRZ2_BCL2L1-      gaccgtttacctggacagcaacatccagccctggatccagcggcagggag
A0A3B1JJ42_BCL2L1-      gaccgtctacttggacaaccacatccagccctggatccaggagcaaggag
A0A3B4DTL9_BCL2L1-      gactgtctacttggacaaccatatccagccctggatccaggaacaaggag
A0A3P8XYL5_BCL2L1-      gaccgtctacctggataaccacatccagccctggatcgagagccaaggag
B5XAY3_BCL2L1-01        gaccgtctacctggacaaccacatccagccctggatccagagccaaggag
A0A3B3TFR4_BCL2L1-      gaccgtctacttggacaaccatatccagccctggattcaaacccaaggag
A0A3Q3DUT7_BCL2L1-      gacggtgtacctggacaaccaccttcagccctggatagagagccaaggag
A0A3Q3DUT7_BCL2L1-      gacggtgtacctggacaaccaccttcagccctggatagagagccaaggag
A0A3Q3DUT7_BCL2L1-      gacggtgtacctggacaaccaccttcagccctggatagagagccaaggag
W5MG74_BCL2L1-01        gaccgtctacctggacaacaacattcagccctggatccagagtcagggag
A0A3Q3WIW8_BCL2L1-      gacggtctatctggacaaccaaatccagccctggatcgagagccagggag
A0A2U9BY16_BCL2L1-      gacggtgtacctagacaacaacatccagccctggatccaaagtcaaggag
A0A2U9BY16_BCL2L1-      gacggtgtacctagacaacaacatccagccctggatccaaagtcaaggag
A0A2U9BY16_BCL2L1-      gacggtgtacctagacaacaacatccagccctggatccaaagtcaaggag
A0A2U9BY16_BCL2L1-      gacggtgtacctagacaacaacatccagccctggatccaaagtcaaggag
A0A2U9BY16_BCL2L1-      gacggtgtacctagacaacaacatccagccctggatccaaagtcaaggag
A0A3B5PQJ0_BCL2L1-      gaccgtctacctggatgagcagattgaaccttgggtagaaagccaaggag
A0A3P9N9Y4_BCL2L1-      gaccgtctacctggatgagcggattgaaccttgggtggagagccaaggag
A0A3B3WI27_BCL2L1-      gaccgtctacttggatgagcggattgaaccttgggtggagagccaaggag
A0A087X9B7_BCL2L1-      gaccgtctacttggatgagcggattgaaccttgggtggagagccaaggag
A0A3B3TUS7_BCL2L1-      gaccgtctacttggatgagcggattgaaccttgggtggagagccaaggag
A0A3Q2FR43_BCL2L1-      gaccgtctacttggatgagcagatcgatccctggatccagagccaaggag
A0A3Q2QPL9_BCL2L1-      gaccgtctacctggacgagcagatcgacccctggatccagagccagggag
A0A3Q3B3X5_BCL2L1-      gaccgtctacctggacaaccacattcagccttggattcagagtcaagggg
A0A3Q0RTF8_BCL2L1-      gacagtctacctagacaaccacattcagccctggatccagagccaaggag
I3IZK7_BCL2L1-01        gaccgtctacctagacaaccacattcagccctggatccagagccaaggag
A0A3Q4N4B5_BCL2L1-      gacggtctacctagacaaccacattcagccctggatccagagccaaggag
A0A3Q2X557_BCL2L1-      gacggtctacctagacaaccacattcagccctggatccagagccaaggag
A0A3P8P0F1_BCL2L1-      gacggtctacctagacaaccacattcagccctggatccagagccaaggag
A0A3P9D632_BCL2L1-      gacggtctacctagacaaccacattcagccctggatccagagccaaggag
A0A3P9D632_BCL2L1-      gacggtctacctagacaaccacattcagccctggatccagagccaaggag
A0A3B4FNX1_BCL2L1-      gacggtctacctagacaaccacattcagccctggatccagagccaaggag
G3NJY1_BCL2L1-01        gacgctctacctggacaaccacattcagccctggatccagaaccagggag
A0A3B3DHA1_BCL2L1-      gaccgtctacctggacaaccacatccagccgtggatccagagccaaggcg
A0A3B3IB64_BCL2L1-      gaccgtctacctggacaaccacatccagccctggatccagagccaaggcg
A0A3P9JYH1_BCL2L1-      gaccgtctacctggacaaccacatccagccctggatccagagccaaggcg
C3VIT1_BCL2L1-01        gacggtctacctggacaaccacattcagccctggatccagagccagggag
A0A3B4Z3X2_BCL2L1-      gacggtttacctggacaaccacattcaggactggatccagagccaaggcg
A0A3B4Z3X2_BCL2L1-      gacggtttacctggacaaccacattcaggactggatccagagccaaggcg
A0A3Q1FR00_BCL2L1-      gaccgtctacctggacaaccacattcaggactggatccagggccagggag
A0A3Q1FR00_BCL2L1-      gaccgtctacctggacaaccacattcaggactggatccagggccagggag
A0A3Q1DHJ3_BCL2L1-      gaccgtctacctggacaaccacattcaggactggatccagagccaaggag
A0A3Q1DHJ3_BCL2L1-      gaccgtctacctggacaaccacattcaggactggatccagagccaaggag
A0A3Q1DHJ3_BCL2L1-      gaccgtctacctggacaaccacattcaggactggatccagagccaaggag
A0A3P8TL99_BCL2L1-      gaccgtctacctggacaaccacattcaggactggatccagagccaaggag
A0A3P8TL99_BCL2L1-      gaccgtctacctggacaaccacattcaggactggatccagagccaaggag
A0A219P0Y3_BCL2L1-      gacccgctatctggacaaccacattcagccctggatccagagccaaagag
A0A3Q3G2E1_BCL2L1-      gactgtctacctggacaaccgaattcaaccttggatcgagagccaaggag
A0A3Q3G2E1_BCL2L1-      gactgtctacctggacaaccgaattcaaccttggatcgagagccaaggag
A0A3Q3G2E1_BCL2L1-      gactgtctacctggacaaccgaattcaaccttggatcgagagccaaggag
A0A3B4V3T1_BCL2L1-      gaccgtctacctggacaaccgcattcagccatggatccagagtcaaggag
A0A3B4XU17_BCL2L1-      gaccgtctacctggacaaccgcattcagccatggatccagagtcaaggag
A0A3Q3IVF5_BCL2L1-      gacagtctacctggataaccacattcagccctggatccaaggccaaggag
A0A3Q3MX20_BCL2L1-      gaccctctacctggacaaccacattgagccctggatccaaagccagggag
A0A3Q1GZ93_BCL2L1-      gacagtctacctggacaaccacattcagccctggatccaaagccaaggag
A0A3Q1GZ93_BCL2L1-      gacagtctacctggacaaccacattcagccctggatccaaagccaaggag
A0A3Q1GZ93_BCL2L1-      gacagtctacctggacaaccacattcagccctggatccaaagccaaggag
A0A0D6DR75_BCL2L1-      gacagtgtacctggacgaccacattcagccctggatccaaagtcaaggag
A0A3B3E2W4_BCL2L1-      gaccatgtacctagacgagcaaataagtccatggatccacagtcaaggag
A0A3P9MKK4_BCL2L1-      gacccagtacctggatgagcaaataagtccatggatccacagtcatggag
A0A3P9MKK4_BCL2L1-      gacccagtacctggatgagcaaataagtccatggatccacagtcatggag
A0A3B3I2Q5_BCL2L1-      gacccagtacctggatgagcaaataagtccatggatccacagtcatggag
A0A3B3I2Q5_BCL2L1-      gacccagtacctggatgagcaaataagtccatggatccacagtcatggag
A0A3P9I2N4_BCL2L1-      gacccagtacctggatgagcaaataagtccatggatccacagtcatggag
A0A3P9I2N4_BCL2L1-      gacccagtacctggatgagcaaataagtccatggatccacagtcatggag
A0A3B4BFZ8_BCL2L1-      gactatctacctggatgagaatatcgccacgtggattcaaaaccagggag
A0A3P8VMA1_BCL2L1-      gaccatgtacttggatgaatacattgatccatggatccagagccaaggag
A0A0F7L1T6_BCL2L1-      gaccatttacctggatgagcatattaacccgtggatccagagtcaaggag
H2U5I3_BCL2L1-01        gaccatttacctggatgagcatattaacccgtggatccagagtcaaggag
G3P7B4_BCL2L1-01        gaccacgtacctggacgagcacatcagtgcttggatccagagccagggag
A0A3Q3FUB6_BCL2L1-      gactacgtacctggatgagcacattagtgcatggatcgagagccagggag
A0A3Q3X5M5_BCL2L1-      gaccacttacctggatgagcatattaatccgtggatccagagtcaaggtg
A0A2U9BIG9_BCL2L1-      gaccatgtacctggatgagcacatcagcccctggatccagagccaaggag
A0A3Q1JZ46_BCL2L1-      gaccatgtacctggatgagcacatcagtccttggatccagagccagggag
A0A3Q1JZ46_BCL2L1-      gaccatgtacctggatgagcacatcagtccttggatccagagccagggag
A0A3Q3NFM4_BCL2L1-      gaccatgtatctggatgagcacatcagtccgtggatcgagagccaaggag
A0A3Q3NFM4_BCL2L1-      gaccatgtatctggatgagcacatcagtccgtggatcgagagccaaggag
A0A3Q3J5K3_BCL2L1-      gaccatgtacctggatgagcacatcagtccgtggatccagaaccaaggag
A0A3B4V9K8_BCL2L1-      gaccatgtacctggatgagcacatcagtccgtggatccagagccaaggag
A0A3B4XS24_BCL2L1-      gaccatgtacctggatgagcacatcagtccgtggatccagagccaaggag
A0A3B5B4X7_BCL2L1-      gaccatgtacctggatgagcacatcagtctgtggatccaaagccaaggag
A0A3Q1EVP6_BCL2L1-      gaccatgtacctggatgagcacatcagtccctggatccagagccaaggag
A0A3Q1BQA0_BCL2L1-      gaccatgtacctggatgagcacatcagtccgtggatccaaagccaaggag
A0A3P8U812_BCL2L1-      gaccatgtacctggatgagcacatcagtccgtggatccaaagccaaggag
E6ZFR0_BCL2L1-01        gaccatgtacctggatgagcacatcagtccgtggatccagagccaaggag
A0A0B4KJI5_BCL2L1-      gaccatgtacctggatgagcacatcaatccgtggattgagagccaaggag
A0A3Q3BEB7_BCL2L1-      gaccgtttacctggatgagcagatcggtccgtggatcgacagccagggag
A0A3Q2C6K4_BCL2L1-      gaccatttacctagatgagcagcttaacccttggatccacagccagggag
A0A3Q2NRP4_BCL2L1-      gaccatttacctggatgagcagctcgacccctgggtccgcagccaggggg
A0A3B5MGS2_BCL2L1-      gaccacttacctggacgagcagctcagtccctggatccagagccagggag
M4A558_BCL2L1-01        gaccacttacctggatgagcagctcagtccctggatccagagccagggag
A0A3P9QFB3_BCL2L1-      gaccacttacttggacgagcagctcaatccctggatccagagccagggag
A0A3B3XN57_BCL2L1-      gaccacttacctggacgagcagctcaatccctggatccagagccagggag
A0A087YBW4_BCL2L1-      gaccacttacctggacgagcagctcaatccctggatccaaagccagggag
A0A3B3VWI7_BCL2L1-      gaccacttacctggacgagcagctcaatccctggatccaaagccagggag
                                                       *** *        *  * *

R4JQR8_BCL2L1-01        gtt--------gg--------------------------c----------
A0A346RRN1_BCL2L1-      gct--------gg--------------------------c----------
Q2TAP5_BCL2L1-01        gct--------gg--------------------------g----------
Q91828_BCL2L1-01        gct--------gg--------------------------g----------
H9GHK7_BCL2L1-01        gct--------gg-------------------------------------
F6WA14_BCL2L1-01        gct--------gg--------------------------g----------
G3WKX6_BCL2L1-01        gtt--------gg--------------------------g----------
A0A452FHY1_BCL2L1-      gct--------gg--------------------------g----------
A0A452FHY1_BCL2L1-      gct--------gg--------------------------g----------
A0A3Q1LRT3_BCL2L1-      ggt--------gg--------------------------g----------
A0A452E1B1_BCL2L1-      act--------gg--------------------------g----------
W5PSA5_BCL2L1-01        act--------gg--------------------------g----------
G3SPN0_BCL2L1-01        gct--------gggtaaggaccac---------------g----------
H0X6V2_BCL2L1-01        gct--------gg-----------------tggaggtgtc----------
O35843_BCL2L1-01        gct--------gg-----------ggtgtgagtggaggta----------
P53563_BCL2L1-02        gct--------gggtaagaaccacgccccttgtgtgtccg----------
P53563_BCL2L1-03        gct--------gggtaagaaccacgccccttgtgtgtccg----------
Q64373_BCL2L1-01        gct--------gg--------------------------g----------
Q64373_BCL2L1-09        gct--------gg--------------------------g----------
P53563_BCL2L1-01        gct--------gg--------------------------g----------
Q9MYW4_BCL2L1-01        gct--------gg--------------------------g----------
A0A1U7QU73_BCL2L1-      gct--------gg--------------------------g----------
G3HEA7_BCL2L1-01        gct--------gg--------------------------g----------
G3HEA7_BCL2L1-02        gct--------gg--------------------------g----------
B2Z3Z4_BCL2L1-01        gct--------gg--------------------------g----------
O77737_BCL2L1-01        gct--------gg--------------------------g----------
G1P9D2_BCL2L1-01        gct--------gg--------------------------g----------
A0A1S3EPX7_BCL2L1-      gct--------gg--------------------------g----------
A0A286Y5D6_BCL2L1-      gct--------gg--------------------------g----------
M3XA94_BCL2L1-01        gct--------gg--------------------------g----------
M3XA94_BCL2L1-03        gct--------gg--------------------------g----------
M3XA94_BCL2L1-02        gct--------gg--------------------------g----------
A0A1U7T4L4_BCL2L1-      gct--------gg--------------------------g----------
A0A1U7T4L4_BCL2L1-      gct--------gg--------------------------g----------
L8J061_BCL2L1-01        gct--------gg--------------------------g----------
Q05KJ0_BCL2L1-02        gct--------gg--------------------------g----------
Q05KJ0_BCL2L1-01        gct--------gg--------------------------g----------
A0A452FWV3_BCL2L1-      gct--------gg--------------------------g----------
Q9MZS7_BCL2L1-01        gct--------gg--------------------------g----------
A0A1S2ZQT6_BCL2L1-      gct--------gg--------------------------g----------
A0A3Q2H0F6_BCL2L1-      gct--------gg-----------------------aaag----------
A0A287CZ07_BCL2L1-      gct--------gg--------------------------g----------
I3MUP5_BCL2L1-02        gct--------gg--------------------------g----------
I3MUP5_BCL2L1-03        gct--------gg--------------------------g----------
I3MUP5_BCL2L1-01        gct--------gg--------------------------g----------
A0A250YD48_BCL2L1-      gct--------gg--------------------------g----------
A0A1L5BWY3_BCL2L1-      gct--------gg--------------------------g----------
A0A3Q2H0F6_BCL2L1-      gct--------gg--------------------------g----------
E2IV76_BCL2L1-01        gct--------gg--------------------------g----------
A0A2K6G3C5_BCL2L1-      gct--------gg--------------------------g----------
A0A2K6G3C5_BCL2L1-      gct--------gg--------------------------g----------
A0A2J8VIH3_BCL2L1-      gct--------gg--------------------------g----------
G1RER8_BCL2L1-01        gct--------gg--------------------------g----------
A0A2R8Z9D7_BCL2L1-      gct--------gg--------------------------g----------
A0A2R8Z9D7_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5H963_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5H963_BCL2L1-      gct--------gg--------------------------g----------
A0A096NV05_BCL2L1-      gct--------gg--------------------------g----------
A0A096NV05_BCL2L1-      gct--------gg--------------------------g----------
Q2PFS6_BCL2L1-01        gct--------gg--------------------------g----------
A0A2K5M8B1_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5M8B1_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5VPG2_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5YR37_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5YR37_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5VPG2_BCL2L1-      gct--------gg--------------------------g----------
A0A0D9RJZ8_BCL2L1-      gct--------gg--------------------------g----------
I7GKS6_BCL2L1-01        gct--------gg--------------------------g----------
A0A2K6QFA2_BCL2L1-      gct--------gg--------------------------g----------
A0A2K6QFA2_BCL2L1-      gct--------gg--------------------------g----------
A0A2K6QFA2_BCL2L1-      gct--------gg--------------------------g----------
A0A2K6UWY8_BCL2L1-      gct--------gg--------------------------g----------
E2IV77_BCL2L1-01        gct--------gg--------------------------g----------
A0A2K6UWY8_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5Q6R6_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5Q6R6_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5Q6R6_BCL2L1-      gct--------gg--------------------------g----------
F7IT34_BCL2L1-01        gct--------gg--------------------------g----------
A0A2K5EBP4_BCL2L1-      gct--------gg--------------------------g----------
A0A2K5EBP4_BCL2L1-      gct--------gg--------------------------g----------
E2IV75_BCL2L1-01        gct--------gg--------------------------g----------
Q76LT7_BCL2L1-01        gct--------gg--------------------------g----------
Q8SQ42_BCL2L1-01        gct--------gg--------------------------g----------
M3Z2H9_BCL2L1-01        gct--------gg--------------------------g----------
A0A452SDS4_BCL2L1-      gct--------gg--------------------------g----------
A0A384D3U1_BCL2L1-      gct--------gg--------------------------g----------
A0A493TIA6_BCL2L1-      gatgggtaagggg--------------------------g----------
A0A452ILL8_BCL2L1-      gtt--------gg--------------------------g----------
A0A452ILL8_BCL2L1-      gtt--------gg--------------------------g----------
K7F655_BCL2L1-01        gtt--------gg--------------------------g----------
U3JSL7_BCL2L1-01        gat--------gg--------------------------g----------
H0Z8G3_BCL2L1-01        gat--------gg--------------------------g----------
A0A218USB3_BCL2L1-      gat--------gg--------------------------g----------
A0A218USB3_BCL2L1-      gat--------gg--------------------------g----------
A0A218USB3_BCL2L1-      gat--------gg--------------------------g----------
A0A218USB3_BCL2L1-      gat--------gg--------------------------g----------
Q4U2V6_BCL2L1-01        gat--------gg--------------------------g----------
Q07816_BCL2L1-04        gct--------gg--------------------------g----------
Q07816_BCL2L1-03        gct--------gg--------------------------g----------
Q07816_BCL2L1-02        gct--------gg--------------------------g----------
Q07816_BCL2L1-01        gct--------gg--------------------------g----------
G1N5N5_BCL2L1-01        gct--------gg--------------------------g----------
H3ANS8_BCL2L1-01        gat--------gg--------------------------g----------
C1BLI0_BCL2L1-01        gat--------gg--------------------------g----------
A0A3P8XFS0_BCL2L1-      gat--------gg--------------------------g----------
A0A3P8XFS0_BCL2L1-      gat--------gg--------------------------g----------
A0A286MU87_BCL2L1-      gat--------gg-------------------------------------
C0HAD8_BCL2L1-01        gat--------gg--------------------------g----------
H3CH49_BCL2L1-01        gat--------gg--------------------------g----------
A0A345BSW9_BCL2L1-      gat--------g--------------------------------------
Q90Z98_BCL2L1-02        gat--------gg--------------------------g----------
Q90Z98_BCL2L1-01        gat--------gg--------------------------g----------
A0A059PJI5_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3ZMX9_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3ZMX9_BCL2L1-      gat--------gg--------------------------g----------
D2ITA2_BCL2L1-02        gat--------gg--------------------------a----------
A0A3P8UWG7_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3QRZ2_BCL2L1-      gat--------gg--------------------------g----------
A0A3B1JJ42_BCL2L1-      gat--------gg--------------------------g----------
A0A3B4DTL9_BCL2L1-      gat--------gg--------------------------g----------
A0A3P8XYL5_BCL2L1-      gat--------gg--------------------------g----------
B5XAY3_BCL2L1-01        gat--------gg--------------------------g----------
A0A3B3TFR4_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3DUT7_BCL2L1-      gat--------gg--------------------------c----------
A0A3Q3DUT7_BCL2L1-      gat--------gg--------------------------c----------
A0A3Q3DUT7_BCL2L1-      gat--------gg--------------------------c----------
W5MG74_BCL2L1-01        gat--------gg--------------------------g----------
A0A3Q3WIW8_BCL2L1-      gat--------gg--------------------------c----------
A0A2U9BY16_BCL2L1-      gat--------gg--------------------------actttttgcca
A0A2U9BY16_BCL2L1-      gat--------gg--------------------------g----------
A0A2U9BY16_BCL2L1-      gat--------gg--------------------------g----------
A0A2U9BY16_BCL2L1-      gat--------gg--------------------------g----------
A0A2U9BY16_BCL2L1-      gat--------gg--------------------------g----------
A0A3B5PQJ0_BCL2L1-      gat--------gg--------------------------g----------
A0A3P9N9Y4_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3WI27_BCL2L1-      gat--------gg--------------------------g----------
A0A087X9B7_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3TUS7_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q2FR43_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q2QPL9_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3B3X5_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q0RTF8_BCL2L1-      gat--------gg--------------------------g----------
I3IZK7_BCL2L1-01        gat--------gg--------------------------g----------
A0A3Q4N4B5_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q2X557_BCL2L1-      gat--------gg--------------------------g----------
A0A3P8P0F1_BCL2L1-      gat--------gg--------------------------g----------
A0A3P9D632_BCL2L1-      gat--------gg--------------------------g----------
A0A3P9D632_BCL2L1-      gat--------gg--------------------------g----------
A0A3B4FNX1_BCL2L1-      gat--------gg--------------------------g----------
G3NJY1_BCL2L1-01        gct--------gg-------------------------------------
A0A3B3DHA1_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3IB64_BCL2L1-      gat--------gg--------------------------g----------
A0A3P9JYH1_BCL2L1-      gat--------gg--------------------------g----------
C3VIT1_BCL2L1-01        gat--------gg--------------------------g----------
A0A3B4Z3X2_BCL2L1-      gat--------gg--------------------------g----------
A0A3B4Z3X2_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1FR00_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1FR00_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1DHJ3_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1DHJ3_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1DHJ3_BCL2L1-      gat--------gg--------------------------g----------
A0A3P8TL99_BCL2L1-      gat--------gg--------------------------g----------
A0A3P8TL99_BCL2L1-      gat--------gg--------------------------g----------
A0A219P0Y3_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3G2E1_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3G2E1_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3G2E1_BCL2L1-      gat--------gg--------------------------g----------
A0A3B4V3T1_BCL2L1-      gat--------gg--------------------------g----------
A0A3B4XU17_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3IVF5_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3MX20_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1GZ93_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1GZ93_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1GZ93_BCL2L1-      gat--------gg--------------------------g----------
A0A0D6DR75_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3E2W4_BCL2L1-      gat--------gg--------------------------g----------
A0A3P9MKK4_BCL2L1-      gat--------gg--------------------------g----------
A0A3P9MKK4_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3I2Q5_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3I2Q5_BCL2L1-      gat--------gg--------------------------g----------
A0A3P9I2N4_BCL2L1-      gat--------gg--------------------------g----------
A0A3P9I2N4_BCL2L1-      gat--------gg--------------------------g----------
A0A3B4BFZ8_BCL2L1-      gct--------gg--------------------------g----------
A0A3P8VMA1_BCL2L1-      gct--------gg--------------------------g----------
A0A0F7L1T6_BCL2L1-      gat--------gg--------------------------g----------
H2U5I3_BCL2L1-01        gat--------gg--------------------------g----------
G3P7B4_BCL2L1-01        gat--------gg--------------------------g----------
A0A3Q3FUB6_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3X5M5_BCL2L1-      gat--------gg--------------------------g----------
A0A2U9BIG9_BCL2L1-      gct--------gg--------------------------g----------
A0A3Q1JZ46_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1JZ46_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3NFM4_BCL2L1-      gct--------gg--------------------------g----------
A0A3Q3NFM4_BCL2L1-      gct--------gg--------------------------g----------
A0A3Q3J5K3_BCL2L1-      gct--------gg--------------------------g----------
A0A3B4V9K8_BCL2L1-      gct--------gg--------------------------g----------
A0A3B4XS24_BCL2L1-      gct--------gg--------------------------g----------
A0A3B5B4X7_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q1EVP6_BCL2L1-      act--------gg--------------------------g----------
A0A3Q1BQA0_BCL2L1-      gat--------gg--------------------------g----------
A0A3P8U812_BCL2L1-      gat--------gg--------------------------g----------
E6ZFR0_BCL2L1-01        gat--------gg--------------------------g----------
A0A0B4KJI5_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q3BEB7_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q2C6K4_BCL2L1-      gat--------gg--------------------------g----------
A0A3Q2NRP4_BCL2L1-      gat--------gg--------------------------g----------
A0A3B5MGS2_BCL2L1-      gat--------gg--------------------------g----------
M4A558_BCL2L1-01        gat--------gg--------------------------g----------
A0A3P9QFB3_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3XN57_BCL2L1-      gat--------gg--------------------------g----------
A0A087YBW4_BCL2L1-      gat--------gg--------------------------g----------
A0A3B3VWI7_BCL2L1-      gat--------gg--------------------------g----------
                          *        *                                      

R4JQR8_BCL2L1-01        ----------------------------------------------aa--
A0A346RRN1_BCL2L1-      ----------------------------------------------ag--
Q2TAP5_BCL2L1-01        ----------------------------------------------aa--
Q91828_BCL2L1-01        ----------------------------------------------aa--
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        ----------------------------------------------ac--
G3WKX6_BCL2L1-01        ----------------------------------------------ac--
A0A452FHY1_BCL2L1-      ----------------------------------------------ac--
A0A452FHY1_BCL2L1-      ----------------------------------------------ac--
A0A3Q1LRT3_BCL2L1-      ----------------------------------------------ac--
A0A452E1B1_BCL2L1-      ----------------------------------------------ac--
W5PSA5_BCL2L1-01        ----------------------------------------------ac--
G3SPN0_BCL2L1-01        ----------------------------------------------cc--
H0X6V2_BCL2L1-01        ----------------------------------------------ag--
O35843_BCL2L1-01        ----------------------------------------------ca--
P53563_BCL2L1-02        ----------------------------------------------cc--
P53563_BCL2L1-03        ----------------------------------------------cc--
Q64373_BCL2L1-01        ----------------------------------------------ac--
Q64373_BCL2L1-09        ----------------------------------------------ac--
P53563_BCL2L1-01        ----------------------------------------------ac--
Q9MYW4_BCL2L1-01        ----------------------------------------------ac--
A0A1U7QU73_BCL2L1-      ----------------------------------------------ac--
G3HEA7_BCL2L1-01        ----------------------------------------------ac--
G3HEA7_BCL2L1-02        ----------------------------------------------ac--
B2Z3Z4_BCL2L1-01        ----------------------------------------------ac--
O77737_BCL2L1-01        ----------------------------------------------ac--
G1P9D2_BCL2L1-01        ----------------------------------------------ac--
A0A1S3EPX7_BCL2L1-      ----------------------------------------------ac--
A0A286Y5D6_BCL2L1-      ----------------------------------------------ac--
M3XA94_BCL2L1-01        ----------------------------------------------tt--
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        ----------------------------------------------ac--
A0A1U7T4L4_BCL2L1-      ----------------------------------------------ac--
A0A1U7T4L4_BCL2L1-      ----------------------------------------------ac--
L8J061_BCL2L1-01        ----------------------------------------------ac--
Q05KJ0_BCL2L1-02        ----------------------------------------------ac--
Q05KJ0_BCL2L1-01        ----------------------------------------------ac--
A0A452FWV3_BCL2L1-      ----------------------------------------------ac--
Q9MZS7_BCL2L1-01        ----------------------------------------------ac--
A0A1S2ZQT6_BCL2L1-      ----------------------------------------------ac--
A0A3Q2H0F6_BCL2L1-      ----------------------------------------------aa--
A0A287CZ07_BCL2L1-      ----------------------------------------------ac--
I3MUP5_BCL2L1-02        ----------------------------------------------ac--
I3MUP5_BCL2L1-03        ----------------------------------------------ac--
I3MUP5_BCL2L1-01        ----------------------------------------------ac--
A0A250YD48_BCL2L1-      ----------------------------------------------ac--
A0A1L5BWY3_BCL2L1-      ----------------------------------------------ac--
A0A3Q2H0F6_BCL2L1-      ----------------------------------------------ac--
E2IV76_BCL2L1-01        ----------------------------------------------ac--
A0A2K6G3C5_BCL2L1-      ----------------------------------------------ac--
A0A2K6G3C5_BCL2L1-      ----------------------------------------------ac--
A0A2J8VIH3_BCL2L1-      ----------------------------------------------at--
G1RER8_BCL2L1-01        ----------------------------------------------at--
A0A2R8Z9D7_BCL2L1-      ----------------------------------------------at--
A0A2R8Z9D7_BCL2L1-      ----------------------------------------------at--
A0A2K5H963_BCL2L1-      ----------------------------------------------ac--
A0A2K5H963_BCL2L1-      ----------------------------------------------ac--
A0A096NV05_BCL2L1-      ----------------------------------------------at--
A0A096NV05_BCL2L1-      ----------------------------------------------at--
Q2PFS6_BCL2L1-01        ----------------------------------------------ac--
A0A2K5M8B1_BCL2L1-      ----------------------------------------------ac--
A0A2K5M8B1_BCL2L1-      ----------------------------------------------ac--
A0A2K5VPG2_BCL2L1-      ----------------------------------------------ac--
A0A2K5YR37_BCL2L1-      ----------------------------------------------ac--
A0A2K5YR37_BCL2L1-      ----------------------------------------------ac--
A0A2K5VPG2_BCL2L1-      ----------------------------------------------ac--
A0A0D9RJZ8_BCL2L1-      ----------------------------------------------ac--
I7GKS6_BCL2L1-01        ----------------------------------------------ac--
A0A2K6QFA2_BCL2L1-      ----------------------------------------------ac--
A0A2K6QFA2_BCL2L1-      ----------------------------------------------ac--
A0A2K6QFA2_BCL2L1-      ----------------------------------------------ac--
A0A2K6UWY8_BCL2L1-      ----------------------------------------------ac--
E2IV77_BCL2L1-01        ----------------------------------------------ac--
A0A2K6UWY8_BCL2L1-      ----------------------------------------------ac--
A0A2K5Q6R6_BCL2L1-      ----------------------------------------------ac--
A0A2K5Q6R6_BCL2L1-      ----------------------------------------------ac--
A0A2K5Q6R6_BCL2L1-      ----------------------------------------------ac--
F7IT34_BCL2L1-01        ----------------------------------------------ac--
A0A2K5EBP4_BCL2L1-      ----------------------------------------------ac--
A0A2K5EBP4_BCL2L1-      ----------------------------------------------ac--
E2IV75_BCL2L1-01        ----------------------------------------------ac--
Q76LT7_BCL2L1-01        ----------------------------------------------at--
Q8SQ42_BCL2L1-01        ----------------------------------------------at--
M3Z2H9_BCL2L1-01        ----------------------------------------------ac--
A0A452SDS4_BCL2L1-      ----------------------------------------------ac--
A0A384D3U1_BCL2L1-      ----------------------------------------------ac--
A0A493TIA6_BCL2L1-      ----------------------------------------------tg--
A0A452ILL8_BCL2L1-      ----------------------------------------------ag--
A0A452ILL8_BCL2L1-      ----------------------------------------------ag--
K7F655_BCL2L1-01        ----------------------------------------------ag--
U3JSL7_BCL2L1-01        ----------------------------------------------ag--
H0Z8G3_BCL2L1-01        ----------------------------------------------ag--
A0A218USB3_BCL2L1-      ----------------------------------------------ag--
A0A218USB3_BCL2L1-      ----------------------------------------------ag--
A0A218USB3_BCL2L1-      ----------------------------------------------ag--
A0A218USB3_BCL2L1-      ----------------------------------------------ag--
Q4U2V6_BCL2L1-01        ----------------------------------------------ag--
Q07816_BCL2L1-04        ----------------------------------------------ag--
Q07816_BCL2L1-03        ----------------------------------------------ag--
Q07816_BCL2L1-02        ----------------------------------------------ag--
Q07816_BCL2L1-01        ----------------------------------------------ag--
G1N5N5_BCL2L1-01        ----------------------------------------------ag--
H3ANS8_BCL2L1-01        --------------------------------------------caac--
C1BLI0_BCL2L1-01        ----------------------------------------------ac--
A0A3P8XFS0_BCL2L1-      ----------------------------------------------at--
A0A3P8XFS0_BCL2L1-      ----------------------------------------------at--
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        ----------------------------------------------ac--
H3CH49_BCL2L1-01        ----------------------------------------------aa--
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        ----------------------------------------------aa--
Q90Z98_BCL2L1-01        ----------------------------------------------aa--
A0A059PJI5_BCL2L1-      ----------------------------------------------aa--
A0A3B3ZMX9_BCL2L1-      ----------------------------------------------cc--
A0A3B3ZMX9_BCL2L1-      ----------------------------------------------cc--
D2ITA2_BCL2L1-02        ----------------------------------------------aa--
A0A3P8UWG7_BCL2L1-      ----------------------------------------------ag--
A0A3B3QRZ2_BCL2L1-      ----------------------------------------------ac--
A0A3B1JJ42_BCL2L1-      ----------------------------------------------aa--
A0A3B4DTL9_BCL2L1-      ----------------------------------------------ag--
A0A3P8XYL5_BCL2L1-      ----------------------------------------------ac--
B5XAY3_BCL2L1-01        ----------------------------------------------ac--
A0A3B3TFR4_BCL2L1-      ----------------------------------------------at--
A0A3Q3DUT7_BCL2L1-      ----------------------------------------------aa--
A0A3Q3DUT7_BCL2L1-      ----------------------------------------------aa--
A0A3Q3DUT7_BCL2L1-      ----------------------------------------------aa--
W5MG74_BCL2L1-01        ----------------------------------------------ac--
A0A3Q3WIW8_BCL2L1-      ----------------------------------------------aa--
A0A2U9BY16_BCL2L1-      ccagaccaccaggccagtcaagcccagaaagatgaagatgccccccagga
A0A2U9BY16_BCL2L1-      ----------------------------------------------ag--
A0A2U9BY16_BCL2L1-      ----------------------------------------------ag--
A0A2U9BY16_BCL2L1-      ----------------------------------------------ag--
A0A2U9BY16_BCL2L1-      ----------------------------------------------ag--
A0A3B5PQJ0_BCL2L1-      ----------------------------------------------ag--
A0A3P9N9Y4_BCL2L1-      ----------------------------------------------ag--
A0A3B3WI27_BCL2L1-      ----------------------------------------------ac--
A0A087X9B7_BCL2L1-      ----------------------------------------------ac--
A0A3B3TUS7_BCL2L1-      ----------------------------------------------ac--
A0A3Q2FR43_BCL2L1-      ----------------------------------------------aa--
A0A3Q2QPL9_BCL2L1-      ----------------------------------------------ag--
A0A3Q3B3X5_BCL2L1-      ----------------------------------------------ag--
A0A3Q0RTF8_BCL2L1-      ----------------------------------------------ag--
I3IZK7_BCL2L1-01        ----------------------------------------------ag--
A0A3Q4N4B5_BCL2L1-      ----------------------------------------------ag--
A0A3Q2X557_BCL2L1-      ----------------------------------------------ag--
A0A3P8P0F1_BCL2L1-      ----------------------------------------------ag--
A0A3P9D632_BCL2L1-      ----------------------------------------------ag--
A0A3P9D632_BCL2L1-      ----------------------------------------------ag--
A0A3B4FNX1_BCL2L1-      ----------------------------------------------ag--
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      ----------------------------------------------ag--
A0A3B3IB64_BCL2L1-      ----------------------------------------------ag--
A0A3P9JYH1_BCL2L1-      ----------------------------------------------ag--
C3VIT1_BCL2L1-01        ----------------------------------------------aa--
A0A3B4Z3X2_BCL2L1-      ----------------------------------------------ac--
A0A3B4Z3X2_BCL2L1-      ----------------------------------------------ac--
A0A3Q1FR00_BCL2L1-      ----------------------------------------------ag--
A0A3Q1FR00_BCL2L1-      ----------------------------------------------ag--
A0A3Q1DHJ3_BCL2L1-      ----------------------------------------------ag--
A0A3Q1DHJ3_BCL2L1-      ----------------------------------------------ag--
A0A3Q1DHJ3_BCL2L1-      ----------------------------------------------ag--
A0A3P8TL99_BCL2L1-      ----------------------------------------------ag--
A0A3P8TL99_BCL2L1-      ----------------------------------------------ag--
A0A219P0Y3_BCL2L1-      ----------------------------------------------ag--
A0A3Q3G2E1_BCL2L1-      ----------------------------------------------ag--
A0A3Q3G2E1_BCL2L1-      ----------------------------------------------ag--
A0A3Q3G2E1_BCL2L1-      ----------------------------------------------ag--
A0A3B4V3T1_BCL2L1-      ----------------------------------------------ag--
A0A3B4XU17_BCL2L1-      ----------------------------------------------ag--
A0A3Q3IVF5_BCL2L1-      ----------------------------------------------ag--
A0A3Q3MX20_BCL2L1-      ----------------------------------------------ag--
A0A3Q1GZ93_BCL2L1-      ----------------------------------------------ag--
A0A3Q1GZ93_BCL2L1-      ----------------------------------------------ag--
A0A3Q1GZ93_BCL2L1-      ----------------------------------------------ag--
A0A0D6DR75_BCL2L1-      ----------------------------------------------ag--
A0A3B3E2W4_BCL2L1-      ----------------------------------------------at--
A0A3P9MKK4_BCL2L1-      ----------------------------------------------at--
A0A3P9MKK4_BCL2L1-      ----------------------------------------------at--
A0A3B3I2Q5_BCL2L1-      ----------------------------------------------at--
A0A3B3I2Q5_BCL2L1-      ----------------------------------------------at--
A0A3P9I2N4_BCL2L1-      ----------------------------------------------at--
A0A3P9I2N4_BCL2L1-      ----------------------------------------------at--
A0A3B4BFZ8_BCL2L1-      ----------------------------------------------cc--
A0A3P8VMA1_BCL2L1-      ----------------------------------------------ac--
A0A0F7L1T6_BCL2L1-      ----------------------------------------------at--
H2U5I3_BCL2L1-01        ----------------------------------------------at--
G3P7B4_BCL2L1-01        ----------------------------------------------ac--
A0A3Q3FUB6_BCL2L1-      ----------------------------------------------ac--
A0A3Q3X5M5_BCL2L1-      ----------------------------------------------gc--
A0A2U9BIG9_BCL2L1-      ----------------------------------------------gc--
A0A3Q1JZ46_BCL2L1-      ----------------------------------------------ac--
A0A3Q1JZ46_BCL2L1-      ----------------------------------------------ac--
A0A3Q3NFM4_BCL2L1-      ----------------------------------------------ac--
A0A3Q3NFM4_BCL2L1-      ----------------------------------------------ac--
A0A3Q3J5K3_BCL2L1-      ----------------------------------------------ac--
A0A3B4V9K8_BCL2L1-      ----------------------------------------------ac--
A0A3B4XS24_BCL2L1-      ----------------------------------------------ac--
A0A3B5B4X7_BCL2L1-      ----------------------------------------------ag--
A0A3Q1EVP6_BCL2L1-      ----------------------------------------------ag--
A0A3Q1BQA0_BCL2L1-      ----------------------------------------------ag--
A0A3P8U812_BCL2L1-      ----------------------------------------------ag--
E6ZFR0_BCL2L1-01        ----------------------------------------------ac--
A0A0B4KJI5_BCL2L1-      ----------------------------------------------ac--
A0A3Q3BEB7_BCL2L1-      ----------------------------------------------ac--
A0A3Q2C6K4_BCL2L1-      ----------------------------------------------ac--
A0A3Q2NRP4_BCL2L1-      ----------------------------------------------aa--
A0A3B5MGS2_BCL2L1-      ----------------------------------------------ac--
M4A558_BCL2L1-01        ----------------------------------------------ac--
A0A3P9QFB3_BCL2L1-      ----------------------------------------------ac--
A0A3B3XN57_BCL2L1-      ----------------------------------------------ac--
A0A087YBW4_BCL2L1-      ----------------------------------------------ac--
A0A3B3VWI7_BCL2L1-      ----------------------------------------------ac--
                                                                          

R4JQR8_BCL2L1-01        --------ggatttgtgga---------agcctataaccaag--------
A0A346RRN1_BCL2L1-      --------ggctttgtgga---------atactataaccaag--------
Q2TAP5_BCL2L1-01        --------gcttttgtcgg---------cctgtatggaaaga--------
Q91828_BCL2L1-01        --------gcttttgtcgg---------cctgtatggaaaga--------
H9GHK7_BCL2L1-01        ----------------aaa---------tcaaaggggggaca--------
F6WA14_BCL2L1-01        --------acctttgtgga---------actttatgggaatg--------
G3WKX6_BCL2L1-01        --------accttcgtgga---------gctttatgggaatg--------
A0A452FHY1_BCL2L1-      --------acttctgtgga---------attctgtgaaaaca--------
A0A452FHY1_BCL2L1-      --------acttctgtgga---------attctgtgaaaaca--------
A0A3Q1LRT3_BCL2L1-      --------acttttgtgga---------actctacgaaagca--------
A0A452E1B1_BCL2L1-      --------atttttgtgga---------actctacgaaaaca--------
W5PSA5_BCL2L1-01        --------atttttgtgga---------actctacgaaaaca--------
G3SPN0_BCL2L1-01        --------ccttttgtgct---------tc--------------------
H0X6V2_BCL2L1-01        --------gcctttccaga---------gcttctctctccca--------
O35843_BCL2L1-01        --------cccctcagatc---------tgtcttcagaaggc--------
P53563_BCL2L1-02        --------ccttgtgtgtc---------tctcctctgtggag--------
P53563_BCL2L1-03        --------ccttgtgtgtc---------tctcctctgtggag--------
Q64373_BCL2L1-01        --------acttttgtgga---------tctctacgggaaca--------
Q64373_BCL2L1-09        --------acttttgtgga---------tctctacgggaaca--------
P53563_BCL2L1-01        --------acttttgtgga---------tctctacgggaaca--------
Q9MYW4_BCL2L1-01        --------acgtttgtgga---------actctacggcaaca--------
A0A1U7QU73_BCL2L1-      --------actttcgtgga---------actctatgggaaca--------
G3HEA7_BCL2L1-01        --------actttcgtgga---------actctacggaaaca--------
G3HEA7_BCL2L1-02        --------actttcgtgga---------actctacggaaaca--------
B2Z3Z4_BCL2L1-01        --------actttcgtgga---------actctacggaaaca--------
O77737_BCL2L1-01        --------acttttgtgga---------actctacggaaaca--------
G1P9D2_BCL2L1-01        --------acttttgtgga---------actctacgggaaca--------
A0A1S3EPX7_BCL2L1-      --------acttttgtgga---------actctacgggaaca--------
A0A286Y5D6_BCL2L1-      --------acttttgtgga---------actctacgggaaca--------
M3XA94_BCL2L1-01        --------gttattgagca---------ccaacggtgtgcca--------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------acttttgtgga---------actctacgggaaca--------
A0A1U7T4L4_BCL2L1-      --------acttttgtgga---------actctacgggaaca--------
A0A1U7T4L4_BCL2L1-      --------acttttgtgga---------actctacgggaaca--------
L8J061_BCL2L1-01        --------acttttgtgga---------actctacgggaaca--------
Q05KJ0_BCL2L1-02        --------acttttgtgga---------actctacgggaaca--------
Q05KJ0_BCL2L1-01        --------acttttgtgga---------actctacgggaaca--------
A0A452FWV3_BCL2L1-      --------acgtttgtgga---------actctatgggaaca--------
Q9MZS7_BCL2L1-01        --------acgtttgtgga---------actctacgggaaca--------
A0A1S2ZQT6_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A3Q2H0F6_BCL2L1-      --------actgctttggg---------gaccttctgctact--------
A0A287CZ07_BCL2L1-      --------acttttgtgga---------actctacaggaata--------
I3MUP5_BCL2L1-02        --------acttttgtgga---------actctacgggaata--------
I3MUP5_BCL2L1-03        --------acttttgtgga---------actctacgggaata--------
I3MUP5_BCL2L1-01        --------acttttgtgga---------actctacgggaata--------
A0A250YD48_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
A0A1L5BWY3_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
A0A3Q2H0F6_BCL2L1-      --------acctttgtgga---------actctacgggaaca--------
E2IV76_BCL2L1-01        --------acttttgtgga---------actctacgggaaca--------
A0A2K6G3C5_BCL2L1-      --------acttttgtgga---------actctacggaaaca--------
A0A2K6G3C5_BCL2L1-      --------acttttgtgga---------actctacggaaaca--------
A0A2J8VIH3_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
G1RER8_BCL2L1-01        --------acttttgtgga---------actctatgggaaca--------
A0A2R8Z9D7_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2R8Z9D7_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K5H963_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K5H963_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A096NV05_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A096NV05_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
Q2PFS6_BCL2L1-01        --------acttttgtgga---------actctatgggaaca--------
A0A2K5M8B1_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K5M8B1_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K5VPG2_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K5YR37_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K5YR37_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K5VPG2_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A0D9RJZ8_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
I7GKS6_BCL2L1-01        --------acttttgtgga---------actctatgggaaca--------
A0A2K6QFA2_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K6QFA2_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K6QFA2_BCL2L1-      --------acttttgtgga---------actctatgggaaca--------
A0A2K6UWY8_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
E2IV77_BCL2L1-01        --------acttttgtgga---------actctatggaaaca--------
A0A2K6UWY8_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
A0A2K5Q6R6_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
A0A2K5Q6R6_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
A0A2K5Q6R6_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
F7IT34_BCL2L1-01        --------acttttgtgga---------actctatggaaaca--------
A0A2K5EBP4_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
A0A2K5EBP4_BCL2L1-      --------acttttgtgga---------actctatggaaaca--------
E2IV75_BCL2L1-01        --------acttttgtgga---------actctatggaaaca--------
Q76LT7_BCL2L1-01        --------acttttgtgga---------actctacgggaaca--------
Q8SQ42_BCL2L1-01        --------acttttgtgga---------actctacgggaaca--------
M3Z2H9_BCL2L1-01        --------actttcgtgga---------actctacgggaaca--------
A0A452SDS4_BCL2L1-      --------actttcgtgga---------actctacgggaaca--------
A0A384D3U1_BCL2L1-      --------actttcgtgga---------actctacgggaaca--------
A0A493TIA6_BCL2L1-      --------ctccttctgca-------ctcctctgggggatct--------
A0A452ILL8_BCL2L1-      --------cggtttgtgga---------tctctatgggaatg--------
A0A452ILL8_BCL2L1-      --------cggtttgtgga---------tctctatgggaatg--------
K7F655_BCL2L1-01        --------cgctttgtgga---------tctctacgggaacg--------
U3JSL7_BCL2L1-01        --------cgctttgtgga---------cctctatgggaacg--------
H0Z8G3_BCL2L1-01        --------cgctttgtgga---------cctctatgggaacg--------
A0A218USB3_BCL2L1-      --------cgctttgtgga---------cctctatgggaacg--------
A0A218USB3_BCL2L1-      --------cgctttgtgga---------cctctatgggaacg--------
A0A218USB3_BCL2L1-      --------cgctttgtgga---------cctctatgggaacg--------
A0A218USB3_BCL2L1-      --------cgctttgtgga---------cctctatgggaacg--------
Q4U2V6_BCL2L1-01        --------cgctttgtgga---------cctctatgggaacg--------
Q07816_BCL2L1-04        --------cgctttgtgga---------tctgtatgggaaca--------
Q07816_BCL2L1-03        --------cgctttgtgga---------tctgtatgggaaca--------
Q07816_BCL2L1-02        --------cgctttgtgga---------tctgtatgggaaca--------
Q07816_BCL2L1-01        --------cgctttgtgga---------tctgtatgggaaca--------
G1N5N5_BCL2L1-01        --------cgctttgtgga---------cctgtatgggaata--------
H3ANS8_BCL2L1-01        --------cataatacaca--------------ttgacgggg--------
C1BLI0_BCL2L1-01        --------cgatttgctga---------cattttcggcaggg--------
A0A3P8XFS0_BCL2L1-      --------cgttttgctga---------catttttggcagag--------
A0A3P8XFS0_BCL2L1-      --------cgttttgctga---------catttttggcagag--------
A0A286MU87_BCL2L1-      --------------gcaga---------gatctttggcagag--------
C0HAD8_BCL2L1-01        --------cgttttgcaga---------gatctttggcagag--------
H3CH49_BCL2L1-01        --------cgttttgctga---------actcttcgggcagg--------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------cgctttgcaga---------gatctttggaaaag--------
Q90Z98_BCL2L1-01        --------cgctttgcaga---------gatctttggaaaag--------
A0A059PJI5_BCL2L1-      --------cggtttgcaga---------gatctttgggaaag--------
A0A3B3ZMX9_BCL2L1-      --------cgtttcgcaga---------gatctacgggcagg--------
A0A3B3ZMX9_BCL2L1-      --------cgtttcgcaga---------gatctacgggcagg--------
D2ITA2_BCL2L1-02        --------cactttgctgc---------ggtttttggaagcg--------
A0A3P8UWG7_BCL2L1-      --------cattttgcgga---------actctttggtcagg--------
A0A3B3QRZ2_BCL2L1-      --------cgttttgctga---------aatctttgggaagg--------
A0A3B1JJ42_BCL2L1-      --------cgctttgcaga---------gatctttgggaacg--------
A0A3B4DTL9_BCL2L1-      --------cgctttgcaga---------gatctttgggaagg--------
A0A3P8XYL5_BCL2L1-      --------cgttttgcaga---------gatctttgggaagg--------
B5XAY3_BCL2L1-01        --------cggtttgcaga---------gatctttggaatgg--------
A0A3B3TFR4_BCL2L1-      --------cgcttcgccga---------gatcttcggcaacg--------
A0A3Q3DUT7_BCL2L1-      --------cgctttgccga---------aatttttggccacg--------
A0A3Q3DUT7_BCL2L1-      --------cgctttgccga---------aatttttggccacg--------
A0A3Q3DUT7_BCL2L1-      --------cgctttgccga---------aatttttggccacg--------
W5MG74_BCL2L1-01        --------aggtttgcgga---------gatctttggcaagg--------
A0A3Q3WIW8_BCL2L1-      --------cgctttgccga---------aatcttcggacagg--------
A0A2U9BY16_BCL2L1-      cggtcttccactctgctgacggctcctgcatctctgggaaggtctggcag
A0A2U9BY16_BCL2L1-      --------cactttgctga---------aatcttcgggcagg--------
A0A2U9BY16_BCL2L1-      --------cactttgctga---------aatcttcgggcagg--------
A0A2U9BY16_BCL2L1-      --------cactttgctga---------aatcttcgggcagg--------
A0A2U9BY16_BCL2L1-      --------cactttgctga---------aatcttcgggcagg--------
A0A3B5PQJ0_BCL2L1-      --------cgcttcgctga---------gatcttcgggggca--------
A0A3P9N9Y4_BCL2L1-      --------cgtttcgctga---------gatcttcgggggca--------
A0A3B3WI27_BCL2L1-      --------cgtttcgctga---------gatcttcgggggca--------
A0A087X9B7_BCL2L1-      --------cgtttcgctga---------gatcttcgggggca--------
A0A3B3TUS7_BCL2L1-      --------cgtttcgctga---------gatcttcgggggca--------
A0A3Q2FR43_BCL2L1-      --------cgctttgctga---------aatcttcggaggcg--------
A0A3Q2QPL9_BCL2L1-      --------cgctttgctga---------aatctttgggggca--------
A0A3Q3B3X5_BCL2L1-      --------cgctttgctga---------aatcttcggcgaca--------
A0A3Q0RTF8_BCL2L1-      --------cgctttgctga---------aatctttgggcagg--------
I3IZK7_BCL2L1-01        --------cgcttcgctga---------aatcttcgggcagg--------
A0A3Q4N4B5_BCL2L1-      --------cacttcgctga---------aatctttgggcagg--------
A0A3Q2X557_BCL2L1-      --------cgcttcgctga---------aatcttcgggcagg--------
A0A3P8P0F1_BCL2L1-      --------cgcttcgctga---------aatcttcgggcagg--------
A0A3P9D632_BCL2L1-      --------cgcttcgctga---------aatcttcgggcagg--------
A0A3P9D632_BCL2L1-      --------cgcttcgctga---------aatcttcgggcagg--------
A0A3B4FNX1_BCL2L1-      --------cgcttcgctga---------aatcttcgggcagg--------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------cgttttgctga---------aatctttgggcagg--------
A0A3B3IB64_BCL2L1-      --------cgttttgctga---------aatctttgggcagg--------
A0A3P9JYH1_BCL2L1-      --------cgttttgctga---------aatctttgggcagg--------
C3VIT1_BCL2L1-01        --------cgcttcgctga---------gatcttcgggcagg--------
A0A3B4Z3X2_BCL2L1-      --------cgcttcgctga---------aatcttcggccagg--------
A0A3B4Z3X2_BCL2L1-      --------cgcttcgctga---------aatcttcggccagg--------
A0A3Q1FR00_BCL2L1-      --------cgttttgctga---------gatcttcggtcagg--------
A0A3Q1FR00_BCL2L1-      --------cgttttgctga---------gatcttcggtcagg--------
A0A3Q1DHJ3_BCL2L1-      --------cgttttgctga---------aatcttcggtcagg--------
A0A3Q1DHJ3_BCL2L1-      --------cgttttgctga---------aatcttcggtcagg--------
A0A3Q1DHJ3_BCL2L1-      --------cgttttgctga---------aatcttcggtcagg--------
A0A3P8TL99_BCL2L1-      --------cgttttgctga---------aatcttcggtcagg--------
A0A3P8TL99_BCL2L1-      --------cgttttgctga---------aatcttcggtcagg--------
A0A219P0Y3_BCL2L1-      --------cgcttcgccga---------aatcttcgggcagg--------
A0A3Q3G2E1_BCL2L1-      --------cgcttctctga---------aatctttgggcagg--------
A0A3Q3G2E1_BCL2L1-      --------cgcttctctga---------aatctttgggcagg--------
A0A3Q3G2E1_BCL2L1-      --------cgcttctctga---------aatctttgggcagg--------
A0A3B4V3T1_BCL2L1-      --------cgctttgctga---------aatcttcgggcagg--------
A0A3B4XU17_BCL2L1-      --------cgatttgctga---------aatctttgggcagg--------
A0A3Q3IVF5_BCL2L1-      --------cgctttgctga---------actctttgggcagg--------
A0A3Q3MX20_BCL2L1-      --------cactttgctga---------aatctttgggcagg--------
A0A3Q1GZ93_BCL2L1-      --------cgctttgctga---------gctcttcggccacg--------
A0A3Q1GZ93_BCL2L1-      --------cgctttgctga---------gctcttcggccacg--------
A0A3Q1GZ93_BCL2L1-      --------cgctttgctga---------gctcttcggccacg--------
A0A0D6DR75_BCL2L1-      --------cactttgctga---------aatcttcgggcatg--------
A0A3B3E2W4_BCL2L1-      --------tgctttgcaca---------gctgtatgggcagg--------
A0A3P9MKK4_BCL2L1-      --------tgctttgcacg---------gctgtatggccaga--------
A0A3P9MKK4_BCL2L1-      --------tgctttgcacg---------gctgtatggccaga--------
A0A3B3I2Q5_BCL2L1-      --------tgctttgcacg---------gctgtatggccaga--------
A0A3B3I2Q5_BCL2L1-      --------tgctttgcacg---------gctgtatggccaga--------
A0A3P9I2N4_BCL2L1-      --------tgctttgcacg---------gctgtatggccaga--------
A0A3P9I2N4_BCL2L1-      --------tgctttgcacg---------gctgtatggccaga--------
A0A3B4BFZ8_BCL2L1-      --------agctttgctca---------aatttttgggcaga--------
A0A3P8VMA1_BCL2L1-      --------cgttttgctga---------gatttttggcacag--------
A0A0F7L1T6_BCL2L1-      --------tgcttcgcgaa---------gatttttggggacg--------
H2U5I3_BCL2L1-01        --------tgcttcgcgaa---------gatttttggggacg--------
G3P7B4_BCL2L1-01        --------tgttttgctga---------cattttcgggcggg--------
A0A3Q3FUB6_BCL2L1-      --------tgctttgttga---------aattttcggacggg--------
A0A3Q3X5M5_BCL2L1-      --------tgctttgctga---------ggtttttgggcaca--------
A0A2U9BIG9_BCL2L1-      --------tgctttgcgga---------gatttttgggcaag--------
A0A3Q1JZ46_BCL2L1-      --------tgctttgctga---------gatatttgggcaag--------
A0A3Q1JZ46_BCL2L1-      --------tgctttgctga---------gatatttgggcaag--------
A0A3Q3NFM4_BCL2L1-      --------tgctttgctga---------gatttttgggcgag--------
A0A3Q3NFM4_BCL2L1-      --------tgctttgctga---------gatttttgggcgag--------
A0A3Q3J5K3_BCL2L1-      --------tgctttgcaga---------gatttttgggcgag--------
A0A3B4V9K8_BCL2L1-      --------tgctttgctga---------gatgtttgggcaag--------
A0A3B4XS24_BCL2L1-      --------tgctttgctga---------gatgtttgggcaag--------
A0A3B5B4X7_BCL2L1-      --------tgctttgctga---------aattttcgggcaag--------
A0A3Q1EVP6_BCL2L1-      --------tgctttgctga---------gatttttgggcaga--------
A0A3Q1BQA0_BCL2L1-      --------tgctttgctga---------gatttttgggcaga--------
A0A3P8U812_BCL2L1-      --------tgctttgctga---------gatttttgggcaga--------
E6ZFR0_BCL2L1-01        --------tgctttgctga---------ggtttttgggcgag--------
A0A0B4KJI5_BCL2L1-      --------tcctttgctga---------ggtttttgggcgag--------
A0A3Q3BEB7_BCL2L1-      --------agcttcgctga---------gatgtacgggcgag--------
A0A3Q2C6K4_BCL2L1-      --------tgctttgctaa---------gctgtacggccaag--------
A0A3Q2NRP4_BCL2L1-      --------tgctttgctaa---------gctgtacggccagg--------
A0A3B5MGS2_BCL2L1-      --------cgctttgctaa---------cctgtacggccagg--------
M4A558_BCL2L1-01        --------cgctttgctaa---------cctgtacggccagg--------
A0A3P9QFB3_BCL2L1-      --------cacttcgctaa---------cctgtacggccagg--------
A0A3B3XN57_BCL2L1-      --------cgcttcgctaa---------cctgtacggccagg--------
A0A087YBW4_BCL2L1-      --------cgcttcgctaa---------cctgtacggccagg--------
A0A3B3VWI7_BCL2L1-      --------cgcttcgctaa---------cctgtacggccagg--------
                                                                          

R4JQR8_BCL2L1-01        -------------------gacagaa-------------------tcata
A0A346RRN1_BCL2L1-      -------------------cacagaa-------------------ccata
Q2TAP5_BCL2L1-01        -------------atgc--cgcagcc------------------------
Q91828_BCL2L1-01        -------------atgc--cgcagcc------------------------
H9GHK7_BCL2L1-01        -------------aatc---------------------------------
F6WA14_BCL2L1-01        -------------atgc--agctgca------------------------
G3WKX6_BCL2L1-01        -------------atgc--agcagca------------------------
A0A452FHY1_BCL2L1-      -------------atac--agcaacc------------------------
A0A452FHY1_BCL2L1-      -------------atac--agcaacc------------------------
A0A3Q1LRT3_BCL2L1-      -------------atac--aacaaac------------------------
A0A452E1B1_BCL2L1-      -------------atac--agcaacc------------------------
W5PSA5_BCL2L1-01        -------------atac--agcaacc------------------------
G3SPN0_BCL2L1-01        -------------------agtacct------------------------
H0X6V2_BCL2L1-01        -------------aatc--aaattcc-------------------attta
O35843_BCL2L1-01        -------------ttgttcaagtgcc------------------------
P53563_BCL2L1-02        -------------atccctaactgccctttttggtctcctggcatggttg
P53563_BCL2L1-03        -------------atccctaactgccctttttggtctcctggcatggttg
Q64373_BCL2L1-01        -------------atgc--agcagcc------------------------
Q64373_BCL2L1-09        -------------atgc--agcagcc------------------------
P53563_BCL2L1-01        -------------atgc--agcagcc------------------------
Q9MYW4_BCL2L1-01        -------------acgc--agcagcc------------------------
A0A1U7QU73_BCL2L1-      -------------atgc--agcagct------------------------
G3HEA7_BCL2L1-01        -------------atgc--agcagct------------------------
G3HEA7_BCL2L1-02        -------------atgc--agcagct------------------------
B2Z3Z4_BCL2L1-01        -------------atgc--agcagct------------------------
O77737_BCL2L1-01        -------------atgc--agcagct------------------------
G1P9D2_BCL2L1-01        -------------acgc--agcagcc------------------------
A0A1S3EPX7_BCL2L1-      -------------atgc--agcagct------------------------
A0A286Y5D6_BCL2L1-      -------------atgc--agcagcc------------------------
M3XA94_BCL2L1-01        ----------------------ggct------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        -------------atgc--agcggcc------------------------
A0A1U7T4L4_BCL2L1-      -------------atgc--agcagct------------------------
A0A1U7T4L4_BCL2L1-      -------------atgc--agcagct------------------------
L8J061_BCL2L1-01        -------------atgc--agcagcc------------------------
Q05KJ0_BCL2L1-02        -------------atgc--agcagcc------------------------
Q05KJ0_BCL2L1-01        -------------atgc--agcagcc------------------------
A0A452FWV3_BCL2L1-      -------------acgc--agcagcc------------------------
Q9MZS7_BCL2L1-01        -------------acgc--agcagcc------------------------
A0A1S2ZQT6_BCL2L1-      -------------atgc--agcagct------------------------
A0A3Q2H0F6_BCL2L1-      -------------tcgt--ttcatcc----------------------ct
A0A287CZ07_BCL2L1-      -------------atgc--ggcagca------------------------
I3MUP5_BCL2L1-02        -------------atgc--agcagca------------------------
I3MUP5_BCL2L1-03        -------------atgc--agcagca------------------------
I3MUP5_BCL2L1-01        -------------atgc--agcagca------------------------
A0A250YD48_BCL2L1-      -------------atgc--agcagcc------------------------
A0A1L5BWY3_BCL2L1-      -------------atgc--agcagct------------------------
A0A3Q2H0F6_BCL2L1-      -------------acgc--ggcagcc------------------------
E2IV76_BCL2L1-01        -------------atgc--agcagct------------------------
A0A2K6G3C5_BCL2L1-      -------------atgc--agcagct------------------------
A0A2K6G3C5_BCL2L1-      -------------atgc--agcagct------------------------
A0A2J8VIH3_BCL2L1-      -------------atgc--agcagct------------------------
G1RER8_BCL2L1-01        -------------atgc--agcagcc------------------------
A0A2R8Z9D7_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2R8Z9D7_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K5H963_BCL2L1-      -------------atgc--agcagct------------------------
A0A2K5H963_BCL2L1-      -------------atgc--agcagct------------------------
A0A096NV05_BCL2L1-      -------------atgc--agcagcc------------------------
A0A096NV05_BCL2L1-      -------------atgc--agcagcc------------------------
Q2PFS6_BCL2L1-01        -------------atgc--agcagcc------------------------
A0A2K5M8B1_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K5M8B1_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K5VPG2_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K5YR37_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K5YR37_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K5VPG2_BCL2L1-      -------------atgc--agcagcc------------------------
A0A0D9RJZ8_BCL2L1-      -------------atgc--agcagcc------------------------
I7GKS6_BCL2L1-01        -------------atgc--agcagcc------------------------
A0A2K6QFA2_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K6QFA2_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K6QFA2_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K6UWY8_BCL2L1-      -------------atgc--agcagcc------------------------
E2IV77_BCL2L1-01        -------------atgc--agcagcc------------------------
A0A2K6UWY8_BCL2L1-      -------------atgc--agcagcc------------------------
A0A2K5Q6R6_BCL2L1-      -------------atgc--ggcagcc------------------------
A0A2K5Q6R6_BCL2L1-      -------------atgc--ggcagcc------------------------
A0A2K5Q6R6_BCL2L1-      -------------atgc--ggcagcc------------------------
F7IT34_BCL2L1-01        -------------atgc--ggcagcc------------------------
A0A2K5EBP4_BCL2L1-      -------------atgc--ggcagcc------------------------
A0A2K5EBP4_BCL2L1-      -------------atgc--ggcagcc------------------------
E2IV75_BCL2L1-01        -------------atgc--ggcagcc------------------------
Q76LT7_BCL2L1-01        -------------atgc--agcagcc------------------------
Q8SQ42_BCL2L1-01        -------------atgc--agcagcc------------------------
M3Z2H9_BCL2L1-01        -------------atgc--agcagcc------------------------
A0A452SDS4_BCL2L1-      -------------atgc--agcggct------------------------
A0A384D3U1_BCL2L1-      -------------atgc--agcggct------------------------
A0A493TIA6_BCL2L1-      -------------gggc--tg-----------------------------
A0A452ILL8_BCL2L1-      -------------acgc--tgctgcc------------------------
A0A452ILL8_BCL2L1-      -------------acgc--tgctgcc------------------------
K7F655_BCL2L1-01        -------------atgc--tgctgcc------------------------
U3JSL7_BCL2L1-01        -------------atgc--tgctgcc------------------------
H0Z8G3_BCL2L1-01        -------------atgc--tgctgcc------------------------
A0A218USB3_BCL2L1-      -------------atgc--tgctgcc------------------------
A0A218USB3_BCL2L1-      -------------atgc--tgctgcc------------------------
A0A218USB3_BCL2L1-      -------------atgc--tgctgcc------------------------
A0A218USB3_BCL2L1-      -------------atgc--tgctgcc------------------------
Q4U2V6_BCL2L1-01        -------------atgc--tgctgcc------------------------
Q07816_BCL2L1-04        -------------acgc--tgctgcc------------------------
Q07816_BCL2L1-03        -------------acgc--tgctgcc------------------------
Q07816_BCL2L1-02        -------------acgc--tgctgcc------------------------
Q07816_BCL2L1-01        -------------acgc--tgctgcc------------------------
G1N5N5_BCL2L1-01        -------------atgc--tgctgcc------------------------
H3ANS8_BCL2L1-01        -------------ttga--cgctatg------------------------
C1BLI0_BCL2L1-01        -------------atgc--tgctgct------------------------
A0A3P8XFS0_BCL2L1-      -------------atgc--agctgca------------------------
A0A3P8XFS0_BCL2L1-      -------------atgc--agctgca------------------------
A0A286MU87_BCL2L1-      -------------atgc--tgctgca------------------------
C0HAD8_BCL2L1-01        -------------atgc--tgctgca------------------------
H3CH49_BCL2L1-01        -------------acgc--ggctgca------------------------
A0A345BSW9_BCL2L1-      -------------------------g------------------------
Q90Z98_BCL2L1-02        -------------atgc--agcggcg------------------------
Q90Z98_BCL2L1-01        -------------atgc--agcggcg------------------------
A0A059PJI5_BCL2L1-      -------------atgc--agcagca------------------------
A0A3B3ZMX9_BCL2L1-      -------------acgc--cgccgcg------------------------
A0A3B3ZMX9_BCL2L1-      -------------acgc--cgccgcg------------------------
D2ITA2_BCL2L1-02        -------------acgc--ggcagcg------------------------
A0A3P8UWG7_BCL2L1-      -------------atgc--agcagcg------------------------
A0A3B3QRZ2_BCL2L1-      -------------atgc--agcagct------------------------
A0A3B1JJ42_BCL2L1-      -------------acac--agcagca------------------------
A0A3B4DTL9_BCL2L1-      -------------atgc--cgcagca------------------------
A0A3P8XYL5_BCL2L1-      -------------atgc--tgcagcc------------------------
B5XAY3_BCL2L1-01        -------------acgc--tgcagcc------------------------
A0A3B3TFR4_BCL2L1-      -------------acgc--agccgcc------------------------
A0A3Q3DUT7_BCL2L1-      -------------acgc--ggcagcg------------------------
A0A3Q3DUT7_BCL2L1-      -------------acgc--ggcagcg------------------------
A0A3Q3DUT7_BCL2L1-      -------------acgc--ggcagcg------------------------
W5MG74_BCL2L1-01        -------------atgc--ggctgcg------------------------
A0A3Q3WIW8_BCL2L1-      -------------acgc--ggctgct------------------------
A0A2U9BY16_BCL2L1-      aacttgagtcggtacac--tgcagca------------------------
A0A2U9BY16_BCL2L1-      -------------acgc--ggcggca------------------------
A0A2U9BY16_BCL2L1-      -------------acgc--ggcggca------------------------
A0A2U9BY16_BCL2L1-      -------------acgc--ggcggca------------------------
A0A2U9BY16_BCL2L1-      -------------acgc--ggcggca------------------------
A0A3B5PQJ0_BCL2L1-      -------------acgc--ggcggca------------------------
A0A3P9N9Y4_BCL2L1-      -------------acgc--ggcggca------------------------
A0A3B3WI27_BCL2L1-      -------------acgc--ggcggca------------------------
A0A087X9B7_BCL2L1-      -------------acgc--ggcggca------------------------
A0A3B3TUS7_BCL2L1-      -------------acgc--ggcggca------------------------
A0A3Q2FR43_BCL2L1-      -------------acgc--agcggct------------------------
A0A3Q2QPL9_BCL2L1-      -------------acgc--agcggcg------------------------
A0A3Q3B3X5_BCL2L1-      -------------acgc--ggcggct------------------------
A0A3Q0RTF8_BCL2L1-      -------------acgc--ggcggct------------------------
I3IZK7_BCL2L1-01        -------------atgc--ggcggct------------------------
A0A3Q4N4B5_BCL2L1-      -------------atgc--ggcggct------------------------
A0A3Q2X557_BCL2L1-      -------------atgc--ggcggct------------------------
A0A3P8P0F1_BCL2L1-      -------------atgc--ggcggct------------------------
A0A3P9D632_BCL2L1-      -------------atgc--ggcggct------------------------
A0A3P9D632_BCL2L1-      -------------atgc--ggcggct------------------------
A0A3B4FNX1_BCL2L1-      -------------atgc--ggcggct------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      -------------aggc--cgcagcc------------------------
A0A3B3IB64_BCL2L1-      -------------aagc--cgcggct------------------------
A0A3P9JYH1_BCL2L1-      -------------aagc--cgctgct------------------------
C3VIT1_BCL2L1-01        -------------acgc--ggcggcc------------------------
A0A3B4Z3X2_BCL2L1-      -------------acgc--ggcagcc------------------------
A0A3B4Z3X2_BCL2L1-      -------------acgc--ggcagcc------------------------
A0A3Q1FR00_BCL2L1-      -------------acgc--ggcggcc------------------------
A0A3Q1FR00_BCL2L1-      -------------acgc--ggcggcc------------------------
A0A3Q1DHJ3_BCL2L1-      -------------acgc--ggcggct------------------------
A0A3Q1DHJ3_BCL2L1-      -------------acgc--ggcggct------------------------
A0A3Q1DHJ3_BCL2L1-      -------------acgc--ggcggct------------------------
A0A3P8TL99_BCL2L1-      -------------acgc--ggcggcc------------------------
A0A3P8TL99_BCL2L1-      -------------acgc--ggcggcc------------------------
A0A219P0Y3_BCL2L1-      -------------acgc--ggcggca------------------------
A0A3Q3G2E1_BCL2L1-      -------------atgc--ggcggga------------------------
A0A3Q3G2E1_BCL2L1-      -------------atgc--ggcggga------------------------
A0A3Q3G2E1_BCL2L1-      -------------atgc--ggcggga------------------------
A0A3B4V3T1_BCL2L1-      -------------acgc--agcagca------------------------
A0A3B4XU17_BCL2L1-      -------------acgc--agcagca------------------------
A0A3Q3IVF5_BCL2L1-      -------------atgc--ggcggca------------------------
A0A3Q3MX20_BCL2L1-      -------------atgc--agcagca------------------------
A0A3Q1GZ93_BCL2L1-      -------------acgc--agcagca------------------------
A0A3Q1GZ93_BCL2L1-      -------------acgc--agcagca------------------------
A0A3Q1GZ93_BCL2L1-      -------------acgc--agcagca------------------------
A0A0D6DR75_BCL2L1-      -------------atgc--agctgca------------------------
A0A3B3E2W4_BCL2L1-      -------------atgg--cgctgca------------------------
A0A3P9MKK4_BCL2L1-      -------------acgg--cgctgca------------------------
A0A3P9MKK4_BCL2L1-      -------------acgg--cgctgca------------------------
A0A3B3I2Q5_BCL2L1-      -------------acgg--cgctgca------------------------
A0A3B3I2Q5_BCL2L1-      -------------acgg--cgctgca------------------------
A0A3P9I2N4_BCL2L1-      -------------acgg--cgccgca------------------------
A0A3P9I2N4_BCL2L1-      -------------acgg--cgccgca------------------------
A0A3B4BFZ8_BCL2L1-      -------------atgc--agcagga------------------------
A0A3P8VMA1_BCL2L1-      -------------actg--tattcca------------------------
A0A0F7L1T6_BCL2L1-      -------------acgc--cgcggca------------------------
H2U5I3_BCL2L1-01        -------------acgc--cgcggca------------------------
G3P7B4_BCL2L1-01        -------------acgg--cgcggca------------------------
A0A3Q3FUB6_BCL2L1-      -------------gcgc--tgttgga------------------------
A0A3Q3X5M5_BCL2L1-      -------------acgc--cgctgca------------------------
A0A2U9BIG9_BCL2L1-      -------------gcgc--cggcgca------------------------
A0A3Q1JZ46_BCL2L1-      -------------atgc--cgctgct------------------------
A0A3Q1JZ46_BCL2L1-      -------------atgc--cgctgct------------------------
A0A3Q3NFM4_BCL2L1-      -------------atgc--agctgca------------------------
A0A3Q3NFM4_BCL2L1-      -------------atgc--agctgca------------------------
A0A3Q3J5K3_BCL2L1-      -------------ataa--cgctgca------------------------
A0A3B4V9K8_BCL2L1-      -------------acgc--cgctgca------------------------
A0A3B4XS24_BCL2L1-      -------------acgc--cgctgca------------------------
A0A3B5B4X7_BCL2L1-      -------------acgc--cgccgca------------------------
A0A3Q1EVP6_BCL2L1-      -------------acgc--cgctgca------------------------
A0A3Q1BQA0_BCL2L1-      -------------acgc--cgctgca------------------------
A0A3P8U812_BCL2L1-      -------------acgc--cgctgca------------------------
E6ZFR0_BCL2L1-01        -------------acgc--cgccgca------------------------
A0A0B4KJI5_BCL2L1-      -------------acgc--agctgca------------------------
A0A3Q3BEB7_BCL2L1-      -------------atgc--cgctgca------------------------
A0A3Q2C6K4_BCL2L1-      -------------acgc--cgctgca------------------------
A0A3Q2NRP4_BCL2L1-      -------------acgc--cgccgca------------------------
A0A3B5MGS2_BCL2L1-      -------------acgc--cgctgca------------------------
M4A558_BCL2L1-01        -------------acgc--cgctgca------------------------
A0A3P9QFB3_BCL2L1-      -------------acgc--cgctgca------------------------
A0A3B3XN57_BCL2L1-      -------------acgc--cgctgca------------------------
A0A087YBW4_BCL2L1-      -------------atgc--cgctgca------------------------
A0A3B3VWI7_BCL2L1-      -------------atgc--cgctgca------------------------
                                                                          

R4JQR8_BCL2L1-01        atgacagtccgtgggatgtg----aaag-------------g--------
A0A346RRN1_BCL2L1-      atgacaatcagtggaacttg----ggag-------------a--------
Q2TAP5_BCL2L1-01        ---cagagcagagaaagcca----ggaa-------------c--------
Q91828_BCL2L1-01        ---cagagcagagaaagcca----ggaa-------------c--------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        ---gagagccggaagggcca----ggaa-------------c--------
G3WKX6_BCL2L1-01        ---gagagccggaagggcca----ggaa-------------c--------
A0A452FHY1_BCL2L1-      ---gagagccaaaagggcca----ggag-------------c--------
A0A452FHY1_BCL2L1-      ---gagagccaaaagggcca----ggag-------------c--------
A0A3Q1LRT3_BCL2L1-      ---gagagccagaagggcca----agag-------------c--------
A0A452E1B1_BCL2L1-      ---gagagccaaaagggcca----agag-------------c--------
W5PSA5_BCL2L1-01        ---gagagccaaaagggcca----agag-------------c--------
G3SPN0_BCL2L1-01        ---cagtgaaggaagacata------------------------------
H0X6V2_BCL2L1-01        tttcaaagtttgcatgtgtg----gcaa----------------------
O35843_BCL2L1-01        -aggagtggcggagca-------------------------c--------
P53563_BCL2L1-02        ttgaagatatcgattattca----ggagacattcctggcttc--------
P53563_BCL2L1-03        ttgaagatatcgattattca----ggagacattcctggcttc--------
Q64373_BCL2L1-01        ---gagagccggaaaggcca----ggag-------------c--------
Q64373_BCL2L1-09        ---gagagccggaaaggcca----ggag-------------c--------
P53563_BCL2L1-01        ---gagagccggaaaggcca----ggag-------------c--------
Q9MYW4_BCL2L1-01        ---gagagccgcaagggcca----ggag-------------c--------
A0A1U7QU73_BCL2L1-      ---gagagccggaaaggcca----ggag-------------c--------
G3HEA7_BCL2L1-01        ---gagagccggaaaggcca----ggag-------------c--------
G3HEA7_BCL2L1-02        ---gagagccggaaaggcca----ggag-------------c--------
B2Z3Z4_BCL2L1-01        ---gagagccggaaaggcca----ggag-------------c--------
O77737_BCL2L1-01        ---gagagccggaagggcca----ggaa-------------c--------
G1P9D2_BCL2L1-01        ---gagagccggaagggcca----ggaa-------------c--------
A0A1S3EPX7_BCL2L1-      ---gagagtcggaagggcca----ggag-------------c--------
A0A286Y5D6_BCL2L1-      ---gagagccggaagggcca----ggag-------------c--------
M3XA94_BCL2L1-01        ---ctgtgctccacagggt------gca-------------c------ac
M3XA94_BCL2L1-03        -------tctggactggct-------------------------------
M3XA94_BCL2L1-02        ---gagagccggaagggccaggtcagaa-------------c------aa
A0A1U7T4L4_BCL2L1-      ---gagagccggaagggcca----ggag-------------c--------
A0A1U7T4L4_BCL2L1-      ---gagagccggaagggcca----ggag-------------c--------
L8J061_BCL2L1-01        ---gagagccggaagggcca----ggag-------------c--------
Q05KJ0_BCL2L1-02        ---gagagccggaagggcca----ggag-------------c--------
Q05KJ0_BCL2L1-01        ---gagagccggaagggcca----ggag-------------c--------
A0A452FWV3_BCL2L1-      ---gagagccggaagggcca----ggag-------------c--------
Q9MZS7_BCL2L1-01        ---gagagccggaagggcca----ggag-------------c--------
A0A1S2ZQT6_BCL2L1-      ---gagagccgaaagggaca----ggag-------------c--------
A0A3Q2H0F6_BCL2L1-      gatgagactctca--ggccaaggcggag-------------ccttacagc
A0A287CZ07_BCL2L1-      ---gagagccggaagggcca----ggag-------------c--------
I3MUP5_BCL2L1-02        ---gagagccggaagggcca----ggag-------------c--------
I3MUP5_BCL2L1-03        ---gagagccggaagggcca----ggag-------------c--------
I3MUP5_BCL2L1-01        ---gagagccggaagggcca----ggag-------------c--------
A0A250YD48_BCL2L1-      ---gagagccggaagggcca----ggag-------------c--------
A0A1L5BWY3_BCL2L1-      ---gagagccggaagggcca----ggag-------------c--------
A0A3Q2H0F6_BCL2L1-      ---gaaagccggaagggcca----ggag-------------c--------
E2IV76_BCL2L1-01        ---gagagccggaagggcca----ggaa-------------c--------
A0A2K6G3C5_BCL2L1-      ---gagagccggaagggcca----ggaa-------------c--------
A0A2K6G3C5_BCL2L1-      ---gagagccggaagggcca----ggaa-------------c--------
A0A2J8VIH3_BCL2L1-      ---gagagccgaaagggcca----ggaa-------------c--------
G1RER8_BCL2L1-01        ---gagagccgaaagggcca----ggaa-------------c--------
A0A2R8Z9D7_BCL2L1-      ---gagagccgaaagggcca----ggaa-------------c--------
A0A2R8Z9D7_BCL2L1-      ---gagagccgaaagggcca----ggaa-------------c--------
A0A2K5H963_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5H963_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A096NV05_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A096NV05_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
Q2PFS6_BCL2L1-01        ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5M8B1_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5M8B1_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5VPG2_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5YR37_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5YR37_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5VPG2_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A0D9RJZ8_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
I7GKS6_BCL2L1-01        ---gagagccgaaagggcca----ggag-------------c--------
A0A2K6QFA2_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K6QFA2_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K6QFA2_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K6UWY8_BCL2L1-      ---gagagcagaaagggcca----ggag-------------c--------
E2IV77_BCL2L1-01        ---gagagcagaaagggcca----ggag-------------c--------
A0A2K6UWY8_BCL2L1-      ---gagagcagaaagggcca----ggag-------------c--------
A0A2K5Q6R6_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5Q6R6_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5Q6R6_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
F7IT34_BCL2L1-01        ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5EBP4_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
A0A2K5EBP4_BCL2L1-      ---gagagccgaaagggcca----ggag-------------c--------
E2IV75_BCL2L1-01        ---gagagccgaaagggcca----ggag-------------c--------
Q76LT7_BCL2L1-01        ---gagagccggaagggcca----ggag-------------c--------
Q8SQ42_BCL2L1-01        ---gagagccggaagggcca----ggag-------------c--------
M3Z2H9_BCL2L1-01        ---gagagccggaagggcca----ggag-------------c--------
A0A452SDS4_BCL2L1-      ---gaaagccggaagggcca----ggag-------------c--------
A0A384D3U1_BCL2L1-      ---gaaagccggaagggcca----ggag-------------c--------
A0A493TIA6_BCL2L1-      ----------gatctggccc----ctta-------------g--------
A0A452ILL8_BCL2L1-      ---aagagcaggaaaggcca----ggag-------------c--------
A0A452ILL8_BCL2L1-      ---aagagcaggaaaggcca----ggag-------------c--------
K7F655_BCL2L1-01        ---aagagcaggaaaggcca----ggag-------------c--------
U3JSL7_BCL2L1-01        ---gaggtgagaaaaggcca----ggag-------------a--------
H0Z8G3_BCL2L1-01        ---gagatgagaaaaggcca----ggag-------------a--------
A0A218USB3_BCL2L1-      ---gagatgagaaaaggcca----ggag-------------a--------
A0A218USB3_BCL2L1-      ---gagatgagaaaaggcca----ggag-------------a--------
A0A218USB3_BCL2L1-      ---gagatgagaaaaggcca----ggag-------------a--------
A0A218USB3_BCL2L1-      ---gagatgagaaaaggcca----ggag-------------a--------
Q4U2V6_BCL2L1-01        ---gagatgagaaaaggcca----ggag-------------a--------
Q07816_BCL2L1-04        ---gagctgaggaagggcca----ggag-------------a--------
Q07816_BCL2L1-03        ---gagctgaggaagggcca----ggag-------------a--------
Q07816_BCL2L1-02        ---gagctgaggaagggcca----ggag-------------a--------
Q07816_BCL2L1-01        ---gagctgaggaagggcca----ggag-------------a--------
G1N5N5_BCL2L1-01        ---gagctgaggaagggcca----ggag-------------a--------
H3ANS8_BCL2L1-01        ---cagcgctcaaacac-ca----ggag----------------------
C1BLI0_BCL2L1-01        ---gaggttcgacgttccca----ggag-------------a--------
A0A3P8XFS0_BCL2L1-      ---gacatccgacgttccca----agaa-------------a--------
A0A3P8XFS0_BCL2L1-      ---gacatccgacgttccca----agaa-------------a--------
A0A286MU87_BCL2L1-      ---gacgttcgacggtctca----ggag-------------a--------
C0HAD8_BCL2L1-01        ---gacgttcgacggtctca----ggag-------------a--------
H3CH49_BCL2L1-01        ---gaaagccgcaggtccca----ggag-------------c--------
A0A345BSW9_BCL2L1-      ---gtgagtggaaaattact----tgca----------------------
Q90Z98_BCL2L1-02        ---gaaagcaggaaatcgca----agaa-------------a--------
Q90Z98_BCL2L1-01        ---gaaagcaggaaatcgca----agaa-------------a--------
A0A059PJI5_BCL2L1-      ---gaaggcagaaggtcaca----ggaa-------------a--------
A0A3B3ZMX9_BCL2L1-      ---cagagccgccattccga----agaa-------------c--------
A0A3B3ZMX9_BCL2L1-      ---cagagccgccattccga----agaa-------------c--------
D2ITA2_BCL2L1-02        ---ggagcgaggcgtacccg----ggac-------------a--------
A0A3P8UWG7_BCL2L1-      ---gagagccggaggtcaca----ggag-------------a--------
A0A3B3QRZ2_BCL2L1-      ---gagagcaggaggtccca----agag-------------a--------
A0A3B1JJ42_BCL2L1-      ---gagagcagaaggatgca----ggaa-------------c--------
A0A3B4DTL9_BCL2L1-      ---gagagcagaaggtcaca----ggag-------------a--------
A0A3P8XYL5_BCL2L1-      ---aacagcaggaagtctca----ggag-------------a--------
B5XAY3_BCL2L1-01        ---gagagcaggaagtctca----ggag-------------a--------
A0A3B3TFR4_BCL2L1-      ---gaaggccgccgctctcg----ggag-------------a--------
A0A3Q3DUT7_BCL2L1-      ---gaggtccgccgctccca----ggag-------------a--------
A0A3Q3DUT7_BCL2L1-      ---gaggtccgccgctccca----ggag-------------a--------
A0A3Q3DUT7_BCL2L1-      ---gaggtccgccgctccca----ggag-------------a--------
W5MG74_BCL2L1-01        ---gagtaccggagatcaca----ggag-------------a--------
A0A3Q3WIW8_BCL2L1-      ---gagagcaggaggtctca----ggag-------------a--------
A0A2U9BY16_BCL2L1-      ---g---gtcaaag-----a----ggag-------------a--------
A0A2U9BY16_BCL2L1-      ---gggagtcgaaggtctca----ggag-------------a--------
A0A2U9BY16_BCL2L1-      ---gggagtcgaaggtctca----ggag-------------a--------
A0A2U9BY16_BCL2L1-      ---gggagtcgaaggtctca----ggag-------------a--------
A0A2U9BY16_BCL2L1-      ---gggagtcgaaggtctca----ggag-------------a--------
A0A3B5PQJ0_BCL2L1-      ---gagagcagaagatctca----ggag-------------a--------
A0A3P9N9Y4_BCL2L1-      ---gagagcagaagatctca----ggag-------------a--------
A0A3B3WI27_BCL2L1-      ---gagagcagaagatctca----ggag-------------a--------
A0A087X9B7_BCL2L1-      ---gagagcagaagatctca----ggag-------------a--------
A0A3B3TUS7_BCL2L1-      ---gagagcagaagatctca----ggag-------------a--------
A0A3Q2FR43_BCL2L1-      ---gagagcagaaggtctca----ggag-------------a--------
A0A3Q2QPL9_BCL2L1-      ---gagagcagaaggtctca----ggag-------------a--------
A0A3Q3B3X5_BCL2L1-      ---gaaagcagaatctctca----ggag-------------g--------
A0A3Q0RTF8_BCL2L1-      ---gaaagccggaggtctca----ggag-------------a--------
I3IZK7_BCL2L1-01        ---gaaagccggaggtctca----ggag-------------a--------
A0A3Q4N4B5_BCL2L1-      ---gaaagccggaggtctca----ggag-------------a--------
A0A3Q2X557_BCL2L1-      ---gaaagccggaggtctca----ggag-------------a--------
A0A3P8P0F1_BCL2L1-      ---gaaagccggaggtctca----ggag-------------a--------
A0A3P9D632_BCL2L1-      ---gaaagccggaggtctca----ggag-------------a--------
A0A3P9D632_BCL2L1-      ---gaaagccggaggtctca----ggag-------------a--------
A0A3B4FNX1_BCL2L1-      ---gaaagccggaggtctca----ggag-------------a--------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      ---gaaagcagaaggtctca----ggag-------------a--------
A0A3B3IB64_BCL2L1-      ---gagagcagaaggtctca----ggag-------------a--------
A0A3P9JYH1_BCL2L1-      ---gagagcagaaggtctca----ggag-------------a--------
C3VIT1_BCL2L1-01        ---gaaagcaggaggtctca----ggag-------------a--------
A0A3B4Z3X2_BCL2L1-      ---gagagccggaggtctca----ggag-------------a--------
A0A3B4Z3X2_BCL2L1-      ---gagagccggaggtctca----ggag-------------a--------
A0A3Q1FR00_BCL2L1-      ---gagagcaggaggtctca----ggag-------------a--------
A0A3Q1FR00_BCL2L1-      ---gagagcaggaggtctca----ggag-------------a--------
A0A3Q1DHJ3_BCL2L1-      ---gagagcaggaagtctca----ggag-------------a--------
A0A3Q1DHJ3_BCL2L1-      ---gagagcaggaagtctca----ggag-------------a--------
A0A3Q1DHJ3_BCL2L1-      ---gagagcaggaagtctca----ggag-------------a--------
A0A3P8TL99_BCL2L1-      ---gagagcaggaagtctca----ggag-------------a--------
A0A3P8TL99_BCL2L1-      ---gagagcaggaagtctca----ggag-------------a--------
A0A219P0Y3_BCL2L1-      ---gagagcaggaggtctca----ggag-------------a--------
A0A3Q3G2E1_BCL2L1-      ---gagatcaggaggtctca----ggag-------------a--------
A0A3Q3G2E1_BCL2L1-      ---gagatcaggaggtctca----ggag-------------a--------
A0A3Q3G2E1_BCL2L1-      ---gagatcaggaggtctca----ggag-------------a--------
A0A3B4V3T1_BCL2L1-      ---gagagcaggaggtctca----ggag-------------a--------
A0A3B4XU17_BCL2L1-      ---gacagcaggaggtctca----ggag-------------a--------
A0A3Q3IVF5_BCL2L1-      ---gagaacaggaggtctca----ggag-------------a--------
A0A3Q3MX20_BCL2L1-      ---gagagcaggaggtccca----agag-------------a--------
A0A3Q1GZ93_BCL2L1-      ---gagggcaggcggtctca----ggag-------------a--------
A0A3Q1GZ93_BCL2L1-      ---gagggcaggcggtctca----ggag-------------a--------
A0A3Q1GZ93_BCL2L1-      ---gagggcaggcggtctca----ggag-------------a--------
A0A0D6DR75_BCL2L1-      ---gagagcaggaggtctca----ggag-------------a--------
A0A3B3E2W4_BCL2L1-      ---gaagcgagaagatttca----agag-------------a--------
A0A3P9MKK4_BCL2L1-      ---gaagcgaggagatttca----agag-------------a--------
A0A3P9MKK4_BCL2L1-      ---gaagcgaggagatttca----agag-------------a--------
A0A3B3I2Q5_BCL2L1-      ---gaagcgaggagatttca----agag-------------a--------
A0A3B3I2Q5_BCL2L1-      ---gaagcgaggagatttca----agag-------------a--------
A0A3P9I2N4_BCL2L1-      ---gaagcaaggagatttca----agag-------------a--------
A0A3P9I2N4_BCL2L1-      ---gaagcaaggagatttca----agag-------------a--------
A0A3B4BFZ8_BCL2L1-      ---gaggccagaaggtcccg----agag-------------a--------
A0A3P8VMA1_BCL2L1-      ---agaacgaggagttgtcg----ggac-------------a--------
A0A0F7L1T6_BCL2L1-      ---gaggggaggagagctcg----cgag-------------a--------
H2U5I3_BCL2L1-01        ---gaggggaggagagctcg----cgag-------------a--------
G3P7B4_BCL2L1-01        ---gcggcgaggagatctca----ggag-------------a--------
A0A3Q3FUB6_BCL2L1-      ---gaagtgaggagatctcg----ggaa-------------a--------
A0A3Q3X5M5_BCL2L1-      ---gaagcaaggagatctca----ggag-------------a--------
A0A2U9BIG9_BCL2L1-      ---gaagcaaggagatatcg----ggag-------------a--------
A0A3Q1JZ46_BCL2L1-      ---gaggcgaggagatctcg----ggag-------------g--------
A0A3Q1JZ46_BCL2L1-      ---gaggcgaggagatctcg----ggag-------------g--------
A0A3Q3NFM4_BCL2L1-      ---gaagcaaggagatcaca----ggaa-------------a--------
A0A3Q3NFM4_BCL2L1-      ---gaagcaaggagatcaca----ggaa-------------a--------
A0A3Q3J5K3_BCL2L1-      ---gaagtgcgaagatctca----ggag-------------a--------
A0A3B4V9K8_BCL2L1-      ---gaagcgaggagatctcg----ggaa-------------g--------
A0A3B4XS24_BCL2L1-      ---gaagcgaggagatctcg----ggag-------------g--------
A0A3B5B4X7_BCL2L1-      ---gaagcacggagatctcg----ggat-------------t--------
A0A3Q1EVP6_BCL2L1-      ---gaagcacggaggtctcg----ggat-------------a--------
A0A3Q1BQA0_BCL2L1-      ---gaagcacgaaggtctcg----ggat-------------a--------
A0A3P8U812_BCL2L1-      ---gaagcacgaaggtctcg----ggat-------------a--------
E6ZFR0_BCL2L1-01        ---gaagcgaggagatctcg----ggag-------------a--------
A0A0B4KJI5_BCL2L1-      ---gaagcgaggagatctcg----ggag-------------a--------
A0A3Q3BEB7_BCL2L1-      ---gaagcgaggaggtttca----ggag-------------t--------
A0A3Q2C6K4_BCL2L1-      ---gaggggcggagatctca----cgag-------------a--------
A0A3Q2NRP4_BCL2L1-      ---gcgggccggaggtttca----ggag-------------a--------
A0A3B5MGS2_BCL2L1-      ---gagggccggaggtttcg----ggag-------------a--------
M4A558_BCL2L1-01        ---gagggccggaggtttcg----ggag-------------a--------
A0A3P9QFB3_BCL2L1-      ---gagggccggaggtttcg----ggag-------------a--------
A0A3B3XN57_BCL2L1-      ---gagggccggaggtttcg----ggag-------------a--------
A0A087YBW4_BCL2L1-      ---gagggccggaggtttcg----ggag-------------a--------
A0A3B3VWI7_BCL2L1-      ---gagggccggaggtttcg----ggag-------------a--------
                                                                          

R4JQR8_BCL2L1-01        --acttgttaa---------------------------------------
A0A346RRN1_BCL2L1-      --atttgtacg---------------------------------------
Q2TAP5_BCL2L1-01        --gatt-tggc--------------------------------------a
Q91828_BCL2L1-01        --gatt-tggc--------------------------------------a
H9GHK7_BCL2L1-01        --attt-ca-----------------------------------------
F6WA14_BCL2L1-01        --gctt-caac--------------------------------------c
G3WKX6_BCL2L1-01        --gctt-caac--------------------------------------a
A0A452FHY1_BCL2L1-      --gctt-caac--------------------------------------t
A0A452FHY1_BCL2L1-      --gctt-caac--------------------------------------t
A0A3Q1LRT3_BCL2L1-      --gttt-caac--------------------------------------t
A0A452E1B1_BCL2L1-      --actt-caac--------------------------------------c
W5PSA5_BCL2L1-01        --acct-caac--------------------------------------c
G3SPN0_BCL2L1-01        --gcct-atgt---------------------------------------
H0X6V2_BCL2L1-01        --tttt-tgct--------------------------------------c
O35843_BCL2L1-01        --gtttgtgat--------------------------------------c
P53563_BCL2L1-02        --actt-taat--------------------------------------a
P53563_BCL2L1-03        --actt-taat--------------------------------------a
Q64373_BCL2L1-01        --gctt-caac--------------------------------------c
Q64373_BCL2L1-09        --gctt-caac--------------------------------------c
P53563_BCL2L1-01        --gttt-caac--------------------------------------c
Q9MYW4_BCL2L1-01        --gctt-caac--------------------------------------c
A0A1U7QU73_BCL2L1-      --gctt-caac--------------------------------------c
G3HEA7_BCL2L1-01        --gctt-caac--------------------------------------c
G3HEA7_BCL2L1-02        --gctt-caac--------------------------------------c
B2Z3Z4_BCL2L1-01        --gctt-caac--------------------------------------c
O77737_BCL2L1-01        --gctt-caac--------------------------------------c
G1P9D2_BCL2L1-01        --gctt-caat--------------------------------------c
A0A1S3EPX7_BCL2L1-      --gctt-caac--------------------------------------c
A0A286Y5D6_BCL2L1-      --gctt-caac--------------------------------------c
M3XA94_BCL2L1-01        agccca-gaacaaagcagcccatggag----------------------c
M3XA94_BCL2L1-03        -------------------------------------------------t
M3XA94_BCL2L1-02        acgccg-aaacagagctgccacagagagtttgtccggtcctggggacgac
A0A1U7T4L4_BCL2L1-      --gctt-caac--------------------------------------c
A0A1U7T4L4_BCL2L1-      --gctt-caac--------------------------------------c
L8J061_BCL2L1-01        --gctt-caac--------------------------------------c
Q05KJ0_BCL2L1-02        --gctt-caac--------------------------------------c
Q05KJ0_BCL2L1-01        --gctt-caac--------------------------------------c
A0A452FWV3_BCL2L1-      --gctt-caac--------------------------------------c
Q9MZS7_BCL2L1-01        --gctt-caac--------------------------------------c
A0A1S2ZQT6_BCL2L1-      --gctt-caac--------------------------------------c
A0A3Q2H0F6_BCL2L1-      tagctc-caag--------------------------------------c
A0A287CZ07_BCL2L1-      --gctt-caac--------------------------------------c
I3MUP5_BCL2L1-02        --gctt-caac--------------------------------------c
I3MUP5_BCL2L1-03        --gctt-caac--------------------------------------c
I3MUP5_BCL2L1-01        --gctt-caac--------------------------------------c
A0A250YD48_BCL2L1-      --gctt-caac--------------------------------------c
A0A1L5BWY3_BCL2L1-      --gctt-caac--------------------------------------c
A0A3Q2H0F6_BCL2L1-      --gctt-caac--------------------------------------c
E2IV76_BCL2L1-01        --gctt-caac--------------------------------------c
A0A2K6G3C5_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K6G3C5_BCL2L1-      --gctt-caac--------------------------------------c
A0A2J8VIH3_BCL2L1-      --gctt-caac--------------------------------------c
G1RER8_BCL2L1-01        --gctt-caac--------------------------------------c
A0A2R8Z9D7_BCL2L1-      --gctt-caac--------------------------------------c
A0A2R8Z9D7_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5H963_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5H963_BCL2L1-      --gctt-caac--------------------------------------c
A0A096NV05_BCL2L1-      --gctt-caac--------------------------------------c
A0A096NV05_BCL2L1-      --gctt-caac--------------------------------------c
Q2PFS6_BCL2L1-01        --gctt-caac--------------------------------------c
A0A2K5M8B1_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5M8B1_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5VPG2_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5YR37_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5YR37_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5VPG2_BCL2L1-      --gctt-caac--------------------------------------c
A0A0D9RJZ8_BCL2L1-      --gctt-caac--------------------------------------c
I7GKS6_BCL2L1-01        --gctt-caac--------------------------------------c
A0A2K6QFA2_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K6QFA2_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K6QFA2_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K6UWY8_BCL2L1-      --gctt-caac--------------------------------------c
E2IV77_BCL2L1-01        --gctt-caac--------------------------------------c
A0A2K6UWY8_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5Q6R6_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5Q6R6_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5Q6R6_BCL2L1-      --gctt-caac--------------------------------------c
F7IT34_BCL2L1-01        --gctt-caac--------------------------------------c
A0A2K5EBP4_BCL2L1-      --gctt-caac--------------------------------------c
A0A2K5EBP4_BCL2L1-      --gctt-caac--------------------------------------c
E2IV75_BCL2L1-01        --gctt-caac--------------------------------------c
Q76LT7_BCL2L1-01        --gctt-caac--------------------------------------c
Q8SQ42_BCL2L1-01        --gctc-caac--------------------------------------c
M3Z2H9_BCL2L1-01        --gctt-caac--------------------------------------c
A0A452SDS4_BCL2L1-      --gctt-caac--------------------------------------c
A0A384D3U1_BCL2L1-      --gctt-caac--------------------------------------c
A0A493TIA6_BCL2L1-      --tgct-ctgc--------------------------------------a
A0A452ILL8_BCL2L1-      --agtt-caac--------------------------------------a
A0A452ILL8_BCL2L1-      --agtt-caac--------------------------------------a
K7F655_BCL2L1-01        --agtt-caac--------------------------------------a
U3JSL7_BCL2L1-01        --cctt-caac--------------------------------------a
H0Z8G3_BCL2L1-01        --cctt-caac--------------------------------------a
A0A218USB3_BCL2L1-      --cctt-caac--------------------------------------a
A0A218USB3_BCL2L1-      --cctt-caac--------------------------------------a
A0A218USB3_BCL2L1-      --cctt-caac--------------------------------------a
A0A218USB3_BCL2L1-      --cctt-caac--------------------------------------a
Q4U2V6_BCL2L1-01        --cctt-caac--------------------------------------a
Q07816_BCL2L1-04        --cctt-caac--------------------------------------a
Q07816_BCL2L1-03        --cctt-caac--------------------------------------a
Q07816_BCL2L1-02        --cctt-caac--------------------------------------a
Q07816_BCL2L1-01        --cctt-caac--------------------------------------a
G1N5N5_BCL2L1-01        --cctt-caac--------------------------------------a
H3ANS8_BCL2L1-01        -----t-gaaa--------------------------------------a
C1BLI0_BCL2L1-01        --acct-aaga--------------------------------------a
A0A3P8XFS0_BCL2L1-      --gctt-gagg--------------------------------------a
A0A3P8XFS0_BCL2L1-      --gctt-gagg--------------------------------------a
A0A286MU87_BCL2L1-      --gcat-aatt--------------------------------------a
C0HAD8_BCL2L1-01        --gcat-aatt--------------------------------------a
H3CH49_BCL2L1-01        --gatt-ccga--------------------------------------a
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --gctt-caag--------------------------------------a
Q90Z98_BCL2L1-01        --gctt-caag--------------------------------------a
A0A059PJI5_BCL2L1-      --gctt-taag--------------------------------------a
A0A3B3ZMX9_BCL2L1-      --gctt-caag--------------------------------------a
A0A3B3ZMX9_BCL2L1-      --gctt-caag--------------------------------------a
D2ITA2_BCL2L1-02        --gtca-cagg--------------------------------------a
A0A3P8UWG7_BCL2L1-      --gttt-taag--------------------------------------a
A0A3B3QRZ2_BCL2L1-      --actt-caaa--------------------------------------a
A0A3B1JJ42_BCL2L1-      --gcta-taag--------------------------------------a
A0A3B4DTL9_BCL2L1-      --actt-taag--------------------------------------a
A0A3P8XYL5_BCL2L1-      --gctt-taag--------------------------------------a
B5XAY3_BCL2L1-01        --gctt-taag--------------------------------------a
A0A3B3TFR4_BCL2L1-      --ggtt-ccag--------------------------------------c
A0A3Q3DUT7_BCL2L1-      --gttt-caag--------------------------------------a
A0A3Q3DUT7_BCL2L1-      --gttt-caag--------------------------------------a
A0A3Q3DUT7_BCL2L1-      --gttt-caag--------------------------------------a
W5MG74_BCL2L1-01        --gctt-caag--------------------------------------a
A0A3Q3WIW8_BCL2L1-      --gctt-caag--------------------------------------a
A0A2U9BY16_BCL2L1-      --aaaa-cagg--------------------------------------a
A0A2U9BY16_BCL2L1-      --gttt-caag--------------------------------------a
A0A2U9BY16_BCL2L1-      --gttt-caag--------------------------------------a
A0A2U9BY16_BCL2L1-      --gttt-caag--------------------------------------a
A0A2U9BY16_BCL2L1-      --gttt-caag--------------------------------------a
A0A3B5PQJ0_BCL2L1-      --gctt-caaa--------------------------------------a
A0A3P9N9Y4_BCL2L1-      --gctt-caaa--------------------------------------a
A0A3B3WI27_BCL2L1-      --gctt-caaa--------------------------------------a
A0A087X9B7_BCL2L1-      --gctt-caaa--------------------------------------a
A0A3B3TUS7_BCL2L1-      --gctt-caaa--------------------------------------a
A0A3Q2FR43_BCL2L1-      --gcct-gaag--------------------------------------a
A0A3Q2QPL9_BCL2L1-      --gctt-caag--------------------------------------a
A0A3Q3B3X5_BCL2L1-      --gttt-aaag--------------------------------------a
A0A3Q0RTF8_BCL2L1-      --gctt-caag--------------------------------------a
I3IZK7_BCL2L1-01        --gttt-caag--------------------------------------a
A0A3Q4N4B5_BCL2L1-      --gttt-caag--------------------------------------a
A0A3Q2X557_BCL2L1-      --gttt-caag--------------------------------------a
A0A3P8P0F1_BCL2L1-      --gttt-caag--------------------------------------a
A0A3P9D632_BCL2L1-      --gttt-caag--------------------------------------a
A0A3P9D632_BCL2L1-      --gttt-caag--------------------------------------a
A0A3B4FNX1_BCL2L1-      --gttt-caag--------------------------------------a
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --gctt-caag--------------------------------------a
A0A3B3IB64_BCL2L1-      --gctt-caag--------------------------------------a
A0A3P9JYH1_BCL2L1-      --gctt-caag--------------------------------------a
C3VIT1_BCL2L1-01        --gctt-caag--------------------------------------a
A0A3B4Z3X2_BCL2L1-      --gctt-caag--------------------------------------a
A0A3B4Z3X2_BCL2L1-      --gctt-caag--------------------------------------a
A0A3Q1FR00_BCL2L1-      --gctt-caag--------------------------------------a
A0A3Q1FR00_BCL2L1-      --gctt-caag--------------------------------------a
A0A3Q1DHJ3_BCL2L1-      --gctt-caag--------------------------------------a
A0A3Q1DHJ3_BCL2L1-      --gctt-caag--------------------------------------a
A0A3Q1DHJ3_BCL2L1-      --gctt-caag--------------------------------------a
A0A3P8TL99_BCL2L1-      --gctt-caag--------------------------------------a
A0A3P8TL99_BCL2L1-      --gctt-caag--------------------------------------a
A0A219P0Y3_BCL2L1-      --gttt-caaa--------------------------------------a
A0A3Q3G2E1_BCL2L1-      --gttt-caaa--------------------------------------a
A0A3Q3G2E1_BCL2L1-      --gttt-caaa--------------------------------------a
A0A3Q3G2E1_BCL2L1-      --gttt-caaa--------------------------------------a
A0A3B4V3T1_BCL2L1-      --gttt-caag--------------------------------------a
A0A3B4XU17_BCL2L1-      --gttt-taag--------------------------------------a
A0A3Q3IVF5_BCL2L1-      --gctt-caag--------------------------------------a
A0A3Q3MX20_BCL2L1-      --attt-caag--------------------------------------a
A0A3Q1GZ93_BCL2L1-      --gttt-caag--------------------------------------a
A0A3Q1GZ93_BCL2L1-      --gttt-caag--------------------------------------a
A0A3Q1GZ93_BCL2L1-      --gttt-caag--------------------------------------a
A0A0D6DR75_BCL2L1-      --gttt-caag--------------------------------------a
A0A3B3E2W4_BCL2L1-      --cgct-gaaa--------------------------------------a
A0A3P9MKK4_BCL2L1-      --cgct-gaag--------------------------------------a
A0A3P9MKK4_BCL2L1-      --cgct-gaag--------------------------------------a
A0A3B3I2Q5_BCL2L1-      --cgct-gaag--------------------------------------a
A0A3B3I2Q5_BCL2L1-      --cgct-gaag--------------------------------------a
A0A3P9I2N4_BCL2L1-      --cgct-gaag--------------------------------------a
A0A3P9I2N4_BCL2L1-      --cgct-gaag--------------------------------------a
A0A3B4BFZ8_BCL2L1-      --ctct-gaag--------------------------------------a
A0A3P8VMA1_BCL2L1-      --cagt-gaga--------------------------------------a
A0A0F7L1T6_BCL2L1-      --acct-gagt--------------------------------------a
H2U5I3_BCL2L1-01        --acct-gagt--------------------------------------a
G3P7B4_BCL2L1-01        --cgat-gaga--------------------------------------a
A0A3Q3FUB6_BCL2L1-      --ctct-cacc--------------------------------------a
A0A3Q3X5M5_BCL2L1-      --ctct-gaat--------------------------------------a
A0A2U9BIG9_BCL2L1-      --gcgt-gagg--------------------------------------c
A0A3Q1JZ46_BCL2L1-      --ctct-gaga--------------------------------------a
A0A3Q1JZ46_BCL2L1-      --ctct-gaga--------------------------------------a
A0A3Q3NFM4_BCL2L1-      --ccct-gagg--------------------------------------a
A0A3Q3NFM4_BCL2L1-      --ccct-gagg--------------------------------------a
A0A3Q3J5K3_BCL2L1-      --ccct-gagg--------------------------------------a
A0A3B4V9K8_BCL2L1-      --ctgt-gatg--------------------------------------a
A0A3B4XS24_BCL2L1-      --ctgt-gagg--------------------------------------a
A0A3B5B4X7_BCL2L1-      --ctct-gaag--------------------------------------c
A0A3Q1EVP6_BCL2L1-      --ctct-gaag--------------------------------------c
A0A3Q1BQA0_BCL2L1-      --ctct-gaag--------------------------------------a
A0A3P8U812_BCL2L1-      --ctct-gaag--------------------------------------a
E6ZFR0_BCL2L1-01        --ctct-gagt--------------------------------------a
A0A0B4KJI5_BCL2L1-      --ctct-gagt--------------------------------------c
A0A3Q3BEB7_BCL2L1-      --ccct-gaag--------------------------------------a
A0A3Q2C6K4_BCL2L1-      --catt-gaac--------------------------------------a
A0A3Q2NRP4_BCL2L1-      --cgtt-gaac--------------------------------------a
A0A3B5MGS2_BCL2L1-      --cctt-gaac--------------------------------------a
M4A558_BCL2L1-01        --cctt-gaac--------------------------------------a
A0A3P9QFB3_BCL2L1-      --cctt-gaac--------------------------------------a
A0A3B3XN57_BCL2L1-      --cctt-gaac--------------------------------------a
A0A087YBW4_BCL2L1-      --cctt-gaac--------------------------------------a
A0A3B3VWI7_BCL2L1-      --cctt-gaac--------------------------------------a
                                                                          

R4JQR8_BCL2L1-01        --ata----------------------------------cggagcaatag
A0A346RRN1_BCL2L1-      --tta----------------------------------tggggccattg
Q2TAP5_BCL2L1-01        g---------------------------------gttgctga-----cta
Q91828_BCL2L1-01        g---------------------------------gttgctga-----cta
H9GHK7_BCL2L1-01        ----------------------------------gttatcta-----cac
F6WA14_BCL2L1-01        g-atg-----------------------------gctgctga-----ctg
G3WKX6_BCL2L1-01        g-atg-----------------------------gctgctga-----ctg
A0A452FHY1_BCL2L1-      g-ctg-----------------------------gtccctga-----cgg
A0A452FHY1_BCL2L1-      g-ctg-----------------------------gtccctga-----cgg
A0A3Q1LRT3_BCL2L1-      g-ctg-----------------------------gtccctga------cg
A0A452E1B1_BCL2L1-      g-ctg-----------------------------gtccctga-----cgg
W5PSA5_BCL2L1-01        g-ctg-----------------------------gtccctga-----cgg
G3SPN0_BCL2L1-01        ----------------------------------gttcattc-----agg
H0X6V2_BCL2L1-01        t-ttg-----------------------------gctgcagctgggagat
O35843_BCL2L1-01        c-cag---------------------------------------------
P53563_BCL2L1-02        c-caggggttaactttgggaatattgatgaccctgtttttaa-----gga
P53563_BCL2L1-03        c-caggggttaactttgggaatattgatgaccctgtttttaa-----gga
Q64373_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
Q64373_BCL2L1-09        g-ctg-----------------------------gttcctga-----cgg
P53563_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
Q9MYW4_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A1U7QU73_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
G3HEA7_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
G3HEA7_BCL2L1-02        g-ctg-----------------------------gttcctga-----cgg
B2Z3Z4_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
O77737_BCL2L1-01        g-atg-----------------------------gttcctga-----cgg
G1P9D2_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A1S3EPX7_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A286Y5D6_BCL2L1-      g-ctg-----------------------------gttgctga-----cgg
M3XA94_BCL2L1-01        a-cct-----------------------------cttctagagaaaggag
M3XA94_BCL2L1-03        a-ttt-----------------------------taccctgagttc-ctg
M3XA94_BCL2L1-02        g-cct-----------------------------tgcctggatttcgctg
A0A1U7T4L4_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A1U7T4L4_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
L8J061_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
Q05KJ0_BCL2L1-02        g-ctg-----------------------------gttcctga-----cgg
Q05KJ0_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A452FWV3_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
Q9MZS7_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A1S2ZQT6_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A3Q2H0F6_BCL2L1-      t-aca-----------------------------gtgctttt-----tgg
A0A287CZ07_BCL2L1-      g-ttg-----------------------------gttcctga-----cgg
I3MUP5_BCL2L1-02        g-ttg-----------------------------gttcctga-----cgg
I3MUP5_BCL2L1-03        g-ttg-----------------------------gttcctga-----cgg
I3MUP5_BCL2L1-01        g-ttg-----------------------------gttcctga-----cgg
A0A250YD48_BCL2L1-      g-ctg-----------------------------gttcctga-----cag
A0A1L5BWY3_BCL2L1-      g-ctg-----------------------------gttcctga-----cag
A0A3Q2H0F6_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
E2IV76_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A2K6G3C5_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K6G3C5_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2J8VIH3_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
G1RER8_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A2R8Z9D7_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2R8Z9D7_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5H963_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5H963_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A096NV05_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A096NV05_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
Q2PFS6_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A2K5M8B1_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5M8B1_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5VPG2_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5YR37_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5YR37_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5VPG2_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A0D9RJZ8_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
I7GKS6_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A2K6QFA2_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K6QFA2_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K6QFA2_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K6UWY8_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
E2IV77_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A2K6UWY8_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5Q6R6_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5Q6R6_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5Q6R6_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
F7IT34_BCL2L1-01        g-ctg-----------------------------gttcctga-----cgg
A0A2K5EBP4_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
A0A2K5EBP4_BCL2L1-      g-ctg-----------------------------gttcctga-----cgg
E2IV75_BCL2L1-01        g-ctg-----------------------------gttcctga-----cag
Q76LT7_BCL2L1-01        g-ctg-----------------------------gttcctga-----cag
Q8SQ42_BCL2L1-01        g-ctg-----------------------------gttcctga-----cag
M3Z2H9_BCL2L1-01        g-ctg-----------------------------gttcctga-----cag
A0A452SDS4_BCL2L1-      g-ctg-----------------------------gttcctga-----cag
A0A384D3U1_BCL2L1-      g-ctg-----------------------------gttcctga-----cag
A0A493TIA6_BCL2L1-      g-ata-----------------------------accccccc-----ccc
A0A452ILL8_BCL2L1-      g-gtg-----------------------------gcttctga-----ccg
A0A452ILL8_BCL2L1-      g-gtg-----------------------------gcttctga-----ccg
K7F655_BCL2L1-01        g-ggg-----------------------------gctgctga-----cgg
U3JSL7_BCL2L1-01        a-atg-----------------------------gctcctga-----ccg
H0Z8G3_BCL2L1-01        a-atg-----------------------------gctcctga-----cgg
A0A218USB3_BCL2L1-      a-atg-----------------------------gctcctga-----ccg
A0A218USB3_BCL2L1-      a-atg-----------------------------gctcctga-----ccg
A0A218USB3_BCL2L1-      a-atg-----------------------------gctcctga-----ccg
A0A218USB3_BCL2L1-      a-atg-----------------------------gctcctga-----ccg
Q4U2V6_BCL2L1-01        a-atg-----------------------------gctcctga-----ccg
Q07816_BCL2L1-04        a-atg-----------------------------gctcctca-----ccg
Q07816_BCL2L1-03        a-atg-----------------------------gctcctca-----ccg
Q07816_BCL2L1-02        a-atg-----------------------------gctcctca-----ccg
Q07816_BCL2L1-01        a-atg-----------------------------gctcctca-----ccg
G1N5N5_BCL2L1-01        a-atg-----------------------------gctcctga-----ccg
H3ANS8_BCL2L1-01        a-ttg-----------------------------ggttttgt-----tgg
C1BLI0_BCL2L1-01        g-atg-----------------------------gctgctag-----tag
A0A3P8XFS0_BCL2L1-      a-atg-----------------------------gctgctat-----ttg
A0A3P8XFS0_BCL2L1-      a-atg-----------------------------gctgctat-----ttg
A0A286MU87_BCL2L1-      a-atg-----------------------------gctgctag-----ttg
C0HAD8_BCL2L1-01        a-atg-----------------------------gctgctag-----ttg
H3CH49_BCL2L1-01        a-cgg-----------------------------gctgtttc-----tgg
A0A345BSW9_BCL2L1-      ----------------------------------tttctttc-----c--
Q90Z98_BCL2L1-02        a-atg-----------------------------gttgtttg-----cag
Q90Z98_BCL2L1-01        a-atg-----------------------------gttgtttg-----cag
A0A059PJI5_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A3B3ZMX9_BCL2L1-      a-atg-----------------------------gctttttg-----ccg
A0A3B3ZMX9_BCL2L1-      a-atg-----------------------------gctttttg-----ccg
D2ITA2_BCL2L1-02        g-atg-----------------------------gatgctgg-----tgg
A0A3P8UWG7_BCL2L1-      a-atg-----------------------------gttgctgg-----ctg
A0A3B3QRZ2_BCL2L1-      a-gtg-----------------------------gctgttag-----ctg
A0A3B1JJ42_BCL2L1-      t-gtg-----------------------------gctgctgg-----tgg
A0A3B4DTL9_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A3P8XYL5_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
B5XAY3_BCL2L1-01        a-gtg-----------------------------gcttctgg-----cag
A0A3B3TFR4_BCL2L1-      a-gtg-----------------------------gctgccgg-----cgg
A0A3Q3DUT7_BCL2L1-      a-gtg-----------------------------gcttttgg-----ccg
A0A3Q3DUT7_BCL2L1-      a-gtg-----------------------------gcttttgg-----ccg
A0A3Q3DUT7_BCL2L1-      a-gtg-----------------------------gcttttgg-----ccg
W5MG74_BCL2L1-01        a-gtg-----------------------------gctgctgg-----cgg
A0A3Q3WIW8_BCL2L1-      a-gtg-----------------------------gctgctgg-----ccg
A0A2U9BY16_BCL2L1-      aggtg-----------------------------tacagtgt-----cat
A0A2U9BY16_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A2U9BY16_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A2U9BY16_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A2U9BY16_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A3B5PQJ0_BCL2L1-      a-ctg-----------------------------gctgctgc-----tgg
A0A3P9N9Y4_BCL2L1-      a-ctg-----------------------------gctgctgc-----tgg
A0A3B3WI27_BCL2L1-      a-ctg-----------------------------gctgctgc-----tgg
A0A087X9B7_BCL2L1-      a-ctg-----------------------------gctgctgc-----tgg
A0A3B3TUS7_BCL2L1-      a-ctg-----------------------------gctgctgc-----tgg
A0A3Q2FR43_BCL2L1-      a-ctg-----------------------------gctgctgc-----tgg
A0A3Q2QPL9_BCL2L1-      a-ctg-----------------------------gctgctgc-----tgg
A0A3Q3B3X5_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3Q0RTF8_BCL2L1-      a-gtg-----------------------------gctgcttg-----tgg
I3IZK7_BCL2L1-01        a-gtg-----------------------------gctgctgg-----tgg
A0A3Q4N4B5_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3Q2X557_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3P8P0F1_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3P9D632_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3P9D632_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3B4FNX1_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3B3IB64_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3P9JYH1_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
C3VIT1_BCL2L1-01        a-gtg-----------------------------gctgctgg-----tgg
A0A3B4Z3X2_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3B4Z3X2_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3Q1FR00_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3Q1FR00_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3Q1DHJ3_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3Q1DHJ3_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3Q1DHJ3_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3P8TL99_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A3P8TL99_BCL2L1-      a-gtg-----------------------------gctgctgg-----tgg
A0A219P0Y3_BCL2L1-      a-gtg-----------------------------gctgctgg-----cgg
A0A3Q3G2E1_BCL2L1-      a-gtg-----------------------------gctgctgg-----cgg
A0A3Q3G2E1_BCL2L1-      a-gtg-----------------------------gctgctgg-----cgg
A0A3Q3G2E1_BCL2L1-      a-gtg-----------------------------gctgctgg-----cgg
A0A3B4V3T1_BCL2L1-      a-gtg-----------------------------gctgctgg-----cgg
A0A3B4XU17_BCL2L1-      a-gtg-----------------------------gctgctgg-----cgg
A0A3Q3IVF5_BCL2L1-      a-gtg-----------------------------gctgctgg-----cgg
A0A3Q3MX20_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A3Q1GZ93_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A3Q1GZ93_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A3Q1GZ93_BCL2L1-      a-gtg-----------------------------gctgctgg-----cag
A0A0D6DR75_BCL2L1-      a-gtg-----------------------------gctgctgg-----cgg
A0A3B3E2W4_BCL2L1-      a-gtg-----------------------------gacgctgg-----tcg
A0A3P9MKK4_BCL2L1-      a-gtg-----------------------------gatgctgg-----tca
A0A3P9MKK4_BCL2L1-      a-gtg-----------------------------gatgctgg-----tca
A0A3B3I2Q5_BCL2L1-      a-gtg-----------------------------gatgctgg-----tca
A0A3B3I2Q5_BCL2L1-      a-gtg-----------------------------gatgctgg-----tca
A0A3P9I2N4_BCL2L1-      a-gtg-----------------------------gatgctgg-----tca
A0A3P9I2N4_BCL2L1-      a-gtg-----------------------------gatgctgg-----tca
A0A3B4BFZ8_BCL2L1-      a-atg-----------------------------gctgctag-----ttg
A0A3P8VMA1_BCL2L1-      g-atg-----------------------------gctgctag-----tgg
A0A0F7L1T6_BCL2L1-      g-atg-----------------------------gatgctgg-----gcg
H2U5I3_BCL2L1-01        g-atg-----------------------------gatgctgg-----gcg
G3P7B4_BCL2L1-01        g-gtg-----------------------------gctgctcg-----tcg
A0A3Q3FUB6_BCL2L1-      g-atg-----------------------------gctgctag-----ttg
A0A3Q3X5M5_BCL2L1-      g-atg-----------------------------gctcctag-----tcg
A0A2U9BIG9_BCL2L1-      g-atg-----------------------------gctgctag-----ttg
A0A3Q1JZ46_BCL2L1-      g-atg-----------------------------gctgctag-----ttg
A0A3Q1JZ46_BCL2L1-      g-atg-----------------------------gctgctag-----ttg
A0A3Q3NFM4_BCL2L1-      g-gtg-----------------------------gctgctag-----ttg
A0A3Q3NFM4_BCL2L1-      g-gtg-----------------------------gctgctag-----ttg
A0A3Q3J5K3_BCL2L1-      g-atg-----------------------------gctgctag-----ttg
A0A3B4V9K8_BCL2L1-      a-gtg-----------------------------gctgctag-----ttg
A0A3B4XS24_BCL2L1-      g-gtg-----------------------------gctgctag-----ttg
A0A3B5B4X7_BCL2L1-      g-atg-----------------------------gctgctag-----tcg
A0A3Q1EVP6_BCL2L1-      g-atg-----------------------------gctgctag-----ccg
A0A3Q1BQA0_BCL2L1-      g-atg-----------------------------gctgctag-----tcg
A0A3P8U812_BCL2L1-      g-atg-----------------------------gctgctag-----tcg
E6ZFR0_BCL2L1-01        g-atg-----------------------------gctgctaa-----ttg
A0A0B4KJI5_BCL2L1-      g-gtg-----------------------------gctgctgg-----ttg
A0A3Q3BEB7_BCL2L1-      a-atg-----------------------------gctgctag-----ctg
A0A3Q2C6K4_BCL2L1-      a-atg-----------------------------gctgctag-----ttg
A0A3Q2NRP4_BCL2L1-      a-atg-----------------------------gctgctag-----tcg
A0A3B5MGS2_BCL2L1-      a-atg-----------------------------gctgctag-----ttg
M4A558_BCL2L1-01        a-atg-----------------------------gctgctag-----ttg
A0A3P9QFB3_BCL2L1-      a-atg-----------------------------gctgctag-----tcg
A0A3B3XN57_BCL2L1-      a-atg-----------------------------gctgctag-----tcg
A0A087YBW4_BCL2L1-      a-atg-----------------------------gctgctag-----tcg
A0A3B3VWI7_BCL2L1-      a-atg-----------------------------gctgctag-----tcg
                                                                          

R4JQR8_BCL2L1-01        gtgta--------------a------------------------------
A0A346RRN1_BCL2L1-      gtgtg--------------g------------------------------
Q2TAP5_BCL2L1-01        tagtg--------------a------------------------------
Q91828_BCL2L1-01        tagtg--------------a------------------------------
H9GHK7_BCL2L1-01        gcatc--------------a------------------------------
F6WA14_BCL2L1-01        gcatg--------------a------------------------------
G3WKX6_BCL2L1-01        gcatg--------------a------------------------------
A0A452FHY1_BCL2L1-      ctgtg--------------a------------------------------
A0A452FHY1_BCL2L1-      ctgtg--------------a------------------------------
A0A3Q1LRT3_BCL2L1-      acacg--------------a------------------------------
A0A452E1B1_BCL2L1-      acgtg--------------a------------------------------
W5PSA5_BCL2L1-01        acatg--------------a------------------------------
G3SPN0_BCL2L1-01        tcaaa--------------a------------------------------
H0X6V2_BCL2L1-01        gcttg--------------a------------------------------
O35843_BCL2L1-01        -------------------c------------------------------
P53563_BCL2L1-02        acctg------tatttttca------------------------------
P53563_BCL2L1-03        acctg------tatttttca------------------------------
Q64373_BCL2L1-01        gcatg--------------a------------------------------
Q64373_BCL2L1-09        gcatg--------------a------------------------------
P53563_BCL2L1-01        gcatg--------------a------------------------------
Q9MYW4_BCL2L1-01        gcatg--------------a------------------------------
A0A1U7QU73_BCL2L1-      gcatg--------------a------------------------------
G3HEA7_BCL2L1-01        gcatg--------------a------------------------------
G3HEA7_BCL2L1-02        gcatg--------------a------------------------------
B2Z3Z4_BCL2L1-01        gcatg--------------a------------------------------
O77737_BCL2L1-01        gcatg--------------a------------------------------
G1P9D2_BCL2L1-01        gcatg--------------a------------------------------
A0A1S3EPX7_BCL2L1-      gcatg--------------a------------------------------
A0A286Y5D6_BCL2L1-      gcgtg--------------a------------------------------
M3XA94_BCL2L1-01        acacg--------------a-----------cggacaaggaaacaaacaa
M3XA94_BCL2L1-03        gcaca--------------g------------ggcctg--aggttgggta
M3XA94_BCL2L1-02        ggacg--------------ggaagggactgttggcctggaaggtggagga
A0A1U7T4L4_BCL2L1-      gcatg--------------a------------------------------
A0A1U7T4L4_BCL2L1-      gcatg--------------a------------------------------
L8J061_BCL2L1-01        gcatg--------------a------------------------------
Q05KJ0_BCL2L1-02        gcatg--------------a------------------------------
Q05KJ0_BCL2L1-01        gcatg--------------a------------------------------
A0A452FWV3_BCL2L1-      gcatg--------------a------------------------------
Q9MZS7_BCL2L1-01        gcatg--------------a------------------------------
A0A1S2ZQT6_BCL2L1-      gcgtg--------------a------------------------------
A0A3Q2H0F6_BCL2L1-      gca-g--------------a------------------------------
A0A287CZ07_BCL2L1-      gcatg--------------a------------------------------
I3MUP5_BCL2L1-02        gcatg--------------a------------------------------
I3MUP5_BCL2L1-03        gcatg--------------a------------------------------
I3MUP5_BCL2L1-01        gcatg--------------a------------------------------
A0A250YD48_BCL2L1-      gcatg--------------a------------------------------
A0A1L5BWY3_BCL2L1-      gcatg--------------a------------------------------
A0A3Q2H0F6_BCL2L1-      gcatg--------------a------------------------------
E2IV76_BCL2L1-01        gcatg--------------a------------------------------
A0A2K6G3C5_BCL2L1-      gcatg--------------a------------------------------
A0A2K6G3C5_BCL2L1-      gcatg--------------a------------------------------
A0A2J8VIH3_BCL2L1-      gcatg--------------a------------------------------
G1RER8_BCL2L1-01        gc------------------------------------------------
A0A2R8Z9D7_BCL2L1-      gcatg--------------a------------------------------
A0A2R8Z9D7_BCL2L1-      gcatg--------------a------------------------------
A0A2K5H963_BCL2L1-      gcatg--------------a------------------------------
A0A2K5H963_BCL2L1-      gcatg--------------a------------------------------
A0A096NV05_BCL2L1-      gcatg--------------a------------------------------
A0A096NV05_BCL2L1-      gcatg--------------a------------------------------
Q2PFS6_BCL2L1-01        gcatg--------------a------------------------------
A0A2K5M8B1_BCL2L1-      gcatg--------------a------------------------------
A0A2K5M8B1_BCL2L1-      gcatg--------------a------------------------------
A0A2K5VPG2_BCL2L1-      gcatg--------------a------------------------------
A0A2K5YR37_BCL2L1-      gcatg--------------a------------------------------
A0A2K5YR37_BCL2L1-      gcatg--------------a------------------------------
A0A2K5VPG2_BCL2L1-      gcatg--------------a------------------------------
A0A0D9RJZ8_BCL2L1-      gcatg--------------a------------------------------
I7GKS6_BCL2L1-01        gcatg--------------a------------------------------
A0A2K6QFA2_BCL2L1-      gcatg--------------a------------------------------
A0A2K6QFA2_BCL2L1-      gcatg--------------a------------------------------
A0A2K6QFA2_BCL2L1-      gcatg--------------a------------------------------
A0A2K6UWY8_BCL2L1-      gcatg--------------a------------------------------
E2IV77_BCL2L1-01        gcatg--------------a------------------------------
A0A2K6UWY8_BCL2L1-      gcatg--------------a------------------------------
A0A2K5Q6R6_BCL2L1-      gcatg--------------a------------------------------
A0A2K5Q6R6_BCL2L1-      gcatg--------------a------------------------------
A0A2K5Q6R6_BCL2L1-      gcatg--------------a------------------------------
F7IT34_BCL2L1-01        gcatg--------------a------------------------------
A0A2K5EBP4_BCL2L1-      gcatg--------------a------------------------------
A0A2K5EBP4_BCL2L1-      gcatg--------------a------------------------------
E2IV75_BCL2L1-01        gcatg--------------a------------------------------
Q76LT7_BCL2L1-01        gcatg--------------a------------------------------
Q8SQ42_BCL2L1-01        gcatg--------------a------------------------------
M3Z2H9_BCL2L1-01        gcatg--------------a------------------------------
A0A452SDS4_BCL2L1-      gcatg--------------a------------------------------
A0A384D3U1_BCL2L1-      gcatg--------------a------------------------------
A0A493TIA6_BCL2L1-      ccgcc--------------c------------------------------
A0A452ILL8_BCL2L1-      gggcg--------------a------------------------------
A0A452ILL8_BCL2L1-      gggcg--------------a------------------------------
K7F655_BCL2L1-01        gggcg--------------a------------------------------
U3JSL7_BCL2L1-01        gggcg--------------a------------------------------
H0Z8G3_BCL2L1-01        gggcg--------------a------------------------------
A0A218USB3_BCL2L1-      gggcg--------------a------------------------------
A0A218USB3_BCL2L1-      gggcg--------------a------------------------------
A0A218USB3_BCL2L1-      gggcg--------------a------------------------------
A0A218USB3_BCL2L1-      gggcg--------------a------------------------------
Q4U2V6_BCL2L1-01        gggcg--------------a------------------------------
Q07816_BCL2L1-04        gggcg--------------a------------------------------
Q07816_BCL2L1-03        gggcg--------------a------------------------------
Q07816_BCL2L1-02        gggcg--------------a------------------------------
Q07816_BCL2L1-01        gggcg--------------a------------------------------
G1N5N5_BCL2L1-01        gggcg--------------a------------------------------
H3ANS8_BCL2L1-01        gtttt---------------------------------------------
C1BLI0_BCL2L1-01        gggcg--------------a------------------------------
A0A3P8XFS0_BCL2L1-      ggatg---------------------------------------------
A0A3P8XFS0_BCL2L1-      gggtg--------------a------------------------------
A0A286MU87_BCL2L1-      gggtg--------------a------------------------------
C0HAD8_BCL2L1-01        gggtg--------------a------------------------------
H3CH49_BCL2L1-01        gcatg--------------a------------------------------
A0A345BSW9_BCL2L1-      ----t--------------a------------------------------
Q90Z98_BCL2L1-02        gaatg--------------a------------------------------
Q90Z98_BCL2L1-01        gaatg--------------a------------------------------
A0A059PJI5_BCL2L1-      gtgtg--------------a------------------------------
A0A3B3ZMX9_BCL2L1-      gaatg--------------a------------------------------
A0A3B3ZMX9_BCL2L1-      gaatg--------------a------------------------------
D2ITA2_BCL2L1-02        gcgcg--------------g------------------------------
A0A3P8UWG7_BCL2L1-      ggatg--------------a------------------------------
A0A3B3QRZ2_BCL2L1-      ggatg--------------a------------------------------
A0A3B1JJ42_BCL2L1-      ggatg--------------a------------------------------
A0A3B4DTL9_BCL2L1-      ggatg--------------a------------------------------
A0A3P8XYL5_BCL2L1-      gaatg--------------a------------------------------
B5XAY3_BCL2L1-01        ggatg--------------a------------------------------
A0A3B3TFR4_BCL2L1-      cgatg--------------g------------------------------
A0A3Q3DUT7_BCL2L1-      gggtg--------------a------------------------------
A0A3Q3DUT7_BCL2L1-      gggtg--------------a------------------------------
A0A3Q3DUT7_BCL2L1-      gggtg--------------a------------------------------
W5MG74_BCL2L1-01        gcatg--------------a------------------------------
A0A3Q3WIW8_BCL2L1-      ggatg--------------a------------------------------
A0A2U9BY16_BCL2L1-      ggatgcaacaggctcaccca------------------------------
A0A2U9BY16_BCL2L1-      ggatg--------------a------------------------------
A0A2U9BY16_BCL2L1-      ggatg--------------a------------------------------
A0A2U9BY16_BCL2L1-      ggatg--------------a------------------------------
A0A2U9BY16_BCL2L1-      ggatg--------------a------------------------------
A0A3B5PQJ0_BCL2L1-      ggatg--------------a------------------------------
A0A3P9N9Y4_BCL2L1-      ggatg--------------a------------------------------
A0A3B3WI27_BCL2L1-      ggatg--------------a------------------------------
A0A087X9B7_BCL2L1-      ggatg--------------a------------------------------
A0A3B3TUS7_BCL2L1-      ggatg--------------a------------------------------
A0A3Q2FR43_BCL2L1-      ggatg--------------a------------------------------
A0A3Q2QPL9_BCL2L1-      ggatg--------------a------------------------------
A0A3Q3B3X5_BCL2L1-      ggatg--------------a------------------------------
A0A3Q0RTF8_BCL2L1-      gcatg--------------a------------------------------
I3IZK7_BCL2L1-01        ggatg--------------a------------------------------
A0A3Q4N4B5_BCL2L1-      ggatg--------------a------------------------------
A0A3Q2X557_BCL2L1-      ggatg--------------a------------------------------
A0A3P8P0F1_BCL2L1-      ggatg--------------a------------------------------
A0A3P9D632_BCL2L1-      ggatg--------------a------------------------------
A0A3P9D632_BCL2L1-      ggatg--------------a------------------------------
A0A3B4FNX1_BCL2L1-      ggatg--------------a------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      ggatg--------------a------------------------------
A0A3B3IB64_BCL2L1-      ggatg--------------a------------------------------
A0A3P9JYH1_BCL2L1-      ggatg--------------a------------------------------
C3VIT1_BCL2L1-01        ggatg--------------a------------------------------
A0A3B4Z3X2_BCL2L1-      ggatg--------------a------------------------------
A0A3B4Z3X2_BCL2L1-      ggatg--------------a------------------------------
A0A3Q1FR00_BCL2L1-      ggatg--------------a------------------------------
A0A3Q1FR00_BCL2L1-      ggatg--------------a------------------------------
A0A3Q1DHJ3_BCL2L1-      ggatg--------------a------------------------------
A0A3Q1DHJ3_BCL2L1-      ggatg--------------a------------------------------
A0A3Q1DHJ3_BCL2L1-      ggatg--------------a------------------------------
A0A3P8TL99_BCL2L1-      ggatg--------------a------------------------------
A0A3P8TL99_BCL2L1-      ggatg--------------a------------------------------
A0A219P0Y3_BCL2L1-      ggatg--------------a------------------------------
A0A3Q3G2E1_BCL2L1-      ggatg--------------a------------------------------
A0A3Q3G2E1_BCL2L1-      ggatg--------------a------------------------------
A0A3Q3G2E1_BCL2L1-      ggatg--------------a------------------------------
A0A3B4V3T1_BCL2L1-      ggatg--------------a------------------------------
A0A3B4XU17_BCL2L1-      ggatg--------------a------------------------------
A0A3Q3IVF5_BCL2L1-      ggatg--------------a------------------------------
A0A3Q3MX20_BCL2L1-      ggatg--------------a------------------------------
A0A3Q1GZ93_BCL2L1-      gcatg--------------a------------------------------
A0A3Q1GZ93_BCL2L1-      gcatg--------------a------------------------------
A0A3Q1GZ93_BCL2L1-      gcatg--------------a------------------------------
A0A0D6DR75_BCL2L1-      ggatg--------------a------------------------------
A0A3B3E2W4_BCL2L1-      cagtg--------------g------------------------------
A0A3P9MKK4_BCL2L1-      cagtg--------------g------------------------------
A0A3P9MKK4_BCL2L1-      cagtg--------------g------------------------------
A0A3B3I2Q5_BCL2L1-      cagtg--------------g------------------------------
A0A3B3I2Q5_BCL2L1-      cagtg--------------g------------------------------
A0A3P9I2N4_BCL2L1-      cagtg--------------g------------------------------
A0A3P9I2N4_BCL2L1-      cagtg--------------g------------------------------
A0A3B4BFZ8_BCL2L1-      gagta--------------g------------------------------
A0A3P8VMA1_BCL2L1-      gagca--------------g------------------------------
A0A0F7L1T6_BCL2L1-      gattg--------------g------------------------------
H2U5I3_BCL2L1-01        gattg--------------g------------------------------
G3P7B4_BCL2L1-01        gggtg--------------g------------------------------
A0A3Q3FUB6_BCL2L1-      gaatg--------------g------------------------------
A0A3Q3X5M5_BCL2L1-      gggtg--------------g------------------------------
A0A2U9BIG9_BCL2L1-      gagtg--------------g------------------------------
A0A3Q1JZ46_BCL2L1-      gagtg--------------g------------------------------
A0A3Q1JZ46_BCL2L1-      gagtg--------------g------------------------------
A0A3Q3NFM4_BCL2L1-      gagtg--------------g------------------------------
A0A3Q3NFM4_BCL2L1-      gagtg--------------g------------------------------
A0A3Q3J5K3_BCL2L1-      gagtg--------------g------------------------------
A0A3B4V9K8_BCL2L1-      gagtg--------------g------------------------------
A0A3B4XS24_BCL2L1-      gagtg--------------g------------------------------
A0A3B5B4X7_BCL2L1-      gaggg--------------g------------------------------
A0A3Q1EVP6_BCL2L1-      gaggg--------------g------------------------------
A0A3Q1BQA0_BCL2L1-      gaggg--------------g------------------------------
A0A3P8U812_BCL2L1-      gaggg--------------g------------------------------
E6ZFR0_BCL2L1-01        gggtg--------------g------------------------------
A0A0B4KJI5_BCL2L1-      gagtg--------------g------------------------------
A0A3Q3BEB7_BCL2L1-      gagcg--------------g------------------------------
A0A3Q2C6K4_BCL2L1-      gtgcg--------------g------------------------------
A0A3Q2NRP4_BCL2L1-      gcgcg--------------g------------------------------
A0A3B5MGS2_BCL2L1-      gtgtg--------------g------------------------------
M4A558_BCL2L1-01        gtgtg--------------g------------------------------
A0A3P9QFB3_BCL2L1-      gtgtg--------------g------------------------------
A0A3B3XN57_BCL2L1-      gtgtg--------------g------------------------------
A0A087YBW4_BCL2L1-      gtgtg--------------g------------------------------
A0A3B3VWI7_BCL2L1-      gtgtg--------------g------------------------------
                                                                          

R4JQR8_BCL2L1-01        ---------------------tag--------------g-----------
A0A346RRN1_BCL2L1-      ---------------------ttg--------------g-----------
Q2TAP5_BCL2L1-01        -------ttc-----------tga--------ctg---g-----------
Q91828_BCL2L1-01        -------tgc-----------tga--------ctg---g-----------
H9GHK7_BCL2L1-01        -------ttc-----------cga--------------------------
F6WA14_BCL2L1-01        -------cag-----------tgg--------ccg---g-----------
G3WKX6_BCL2L1-01        -------cag-----------tgg--------ctg---g-----------
A0A452FHY1_BCL2L1-      -------ctt-----------tgg--------ctg---ggctcgctcttc
A0A452FHY1_BCL2L1-      -------ctt-----------tgg--------ctg---gg---ggatcag
A0A3Q1LRT3_BCL2L1-      -------ctg-----------tgg--------ctg---------------
A0A452E1B1_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
W5PSA5_BCL2L1-01        -------ctg-----------tgg--------ccg---g-----------
G3SPN0_BCL2L1-01        ------ccta-----------tgc--------------a-----------
H0X6V2_BCL2L1-01        -------cta-----------tag--------------g-----------
O35843_BCL2L1-01        -------ctt-----------tgg--------gag---g-----------
P53563_BCL2L1-02        -------ttc-----------tgg--------ctaccct-----------
P53563_BCL2L1-03        -------ttc-----------tgg--------ctaccct-----------
Q64373_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
Q64373_BCL2L1-09        -------ctg-----------tgg--------ctg---g-----------
P53563_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
Q9MYW4_BCL2L1-01        -------ccg-----------tgg--------ctg---g-----------
A0A1U7QU73_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
G3HEA7_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
G3HEA7_BCL2L1-02        -------ctg-----------tgg--------ctg---g-----------
B2Z3Z4_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
O77737_BCL2L1-01        -------ctc-----------tag--------ctg---g-----------
G1P9D2_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
A0A1S3EPX7_BCL2L1-      -------ccg-----------tgg--------ccg---g-----------
A0A286Y5D6_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
M3XA94_BCL2L1-01        gattgttccg-----------ggg--------ata---a-----------
M3XA94_BCL2L1-03        a--------------------------------gg---g-----------
M3XA94_BCL2L1-02        aacctccttt-----------ggg--------cgg---g-----------
A0A1U7T4L4_BCL2L1-      -------ccg-----------tag--------ctg---g-----------
A0A1U7T4L4_BCL2L1-      -------ccg-----------tag--------ctg---g-----------
L8J061_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
Q05KJ0_BCL2L1-02        -------ctg-----------tgg--------ctg---g-----------
Q05KJ0_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
A0A452FWV3_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
Q9MZS7_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
A0A1S2ZQT6_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
A0A3Q2H0F6_BCL2L1-      -------ctc-----------cagagctcccctcg---ga----------
A0A287CZ07_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
I3MUP5_BCL2L1-02        -------ctg-----------tgg--------ccg---g-----------
I3MUP5_BCL2L1-03        -------ctg-----------tgg--------ccg---g-----------
I3MUP5_BCL2L1-01        -------ctg-----------tgg--------ccg---g-----------
A0A250YD48_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
A0A1L5BWY3_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
A0A3Q2H0F6_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
E2IV76_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
A0A2K6G3C5_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
A0A2K6G3C5_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
A0A2J8VIH3_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2R8Z9D7_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5H963_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5H963_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A096NV05_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A096NV05_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
Q2PFS6_BCL2L1-01        -------ctg-----------tgg--------ccg---g-----------
A0A2K5M8B1_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5M8B1_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5VPG2_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5YR37_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5YR37_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5VPG2_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A0D9RJZ8_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
I7GKS6_BCL2L1-01        -------ctg-----------tgg--------ccg---g-----------
A0A2K6QFA2_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K6QFA2_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K6QFA2_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K6UWY8_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
E2IV77_BCL2L1-01        -------ctg-----------tgg--------ccg---g-----------
A0A2K6UWY8_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5Q6R6_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5Q6R6_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5Q6R6_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
F7IT34_BCL2L1-01        -------ctg-----------tgg--------ccg---g-----------
A0A2K5EBP4_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
A0A2K5EBP4_BCL2L1-      -------ctg-----------tgg--------ccg---g-----------
E2IV75_BCL2L1-01        -------ctg-----------tgg--------ccg---g-----------
Q76LT7_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
Q8SQ42_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
M3Z2H9_BCL2L1-01        -------ctg-----------tgg--------ctg---g-----------
A0A452SDS4_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
A0A384D3U1_BCL2L1-      -------ctg-----------tgg--------ctg---g-----------
A0A493TIA6_BCL2L1-      -------ccc-----------ccc--------ccc---c-----------
A0A452ILL8_BCL2L1-      -------ctc-----------tgg--------cag---g-----------
A0A452ILL8_BCL2L1-      -------ctc-----------tgg--------cag---g-----------
K7F655_BCL2L1-01        -------ctg-----------tgg--------ccg---g-----------
U3JSL7_BCL2L1-01        -------cgg-----------tgg--------ccg---g-----------
H0Z8G3_BCL2L1-01        -------cgg-----------tgg--------ccg---g-----------
A0A218USB3_BCL2L1-      -------cgg-----------tgg--------ccg---g-----------
A0A218USB3_BCL2L1-      -------cgg-----------tgg--------ccg---g-----------
A0A218USB3_BCL2L1-      -------cgg-----------tgg--------ccg---g-----------
A0A218USB3_BCL2L1-      -------cgg-----------tgg--------ccg---g-----------
Q4U2V6_BCL2L1-01        -------cgg-----------tgg--------ccg---g-----------
Q07816_BCL2L1-04        -------ccg-----------tgg--------ccg---g-----------
Q07816_BCL2L1-03        -------ccg-----------tgg--------ccg---g-----------
Q07816_BCL2L1-02        -------ccg-----------tgg--------ccg---g-----------
Q07816_BCL2L1-01        -------ccg-----------tgg--------ccg---g-----------
G1N5N5_BCL2L1-01        -------ccg-----------tgg--------ccg---g-----------
H3ANS8_BCL2L1-01        ---------------------ttt--------ttt---c-----------
C1BLI0_BCL2L1-01        -------tac-----------tgc--------ttg---c-----------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      -------tgc-----------tgc--------ttt---c-----------
A0A286MU87_BCL2L1-      -------ttc-----------tgc--------ttt---c-----------
C0HAD8_BCL2L1-01        -------ttc-----------tgc--------ttt---c-----------
H3CH49_BCL2L1-01        -------gtc-----------tgg--------cgg---c-----------
A0A345BSW9_BCL2L1-      -------cct-----------tgt--------tcc---c-----------
Q90Z98_BCL2L1-02        -------cct-----------tgc--------tca---c-----------
Q90Z98_BCL2L1-01        -------cct-----------tgc--------tca---c-----------
A0A059PJI5_BCL2L1-      -------cac-----------tct--------tca---c-----------
A0A3B3ZMX9_BCL2L1-      -------ccc-----------tgg--------tca---c-----------
A0A3B3ZMX9_BCL2L1-      -------ccc-----------tgg--------tca---c-----------
D2ITA2_BCL2L1-02        -------cgc-----------tgc--------tga---c-----------
A0A3P8UWG7_BCL2L1-      -------cgc-----------tgg--------tga---c-----------
A0A3B3QRZ2_BCL2L1-      -------cgc-----------tca--------tca---c-----------
A0A3B1JJ42_BCL2L1-      -------ccc-----------tgt--------tca---c-----------
A0A3B4DTL9_BCL2L1-      -------ccc-----------tgg--------tca---c-----------
A0A3P8XYL5_BCL2L1-      -------cgc-----------tgg--------tta---c-----------
B5XAY3_BCL2L1-01        -------ccc-----------tgg--------tca---c-----------
A0A3B3TFR4_BCL2L1-      -------cgc-----------tgg--------tcg---c-----------
A0A3Q3DUT7_BCL2L1-      -------cct-----------tgg--------tga---c-----------
A0A3Q3DUT7_BCL2L1-      -------cct-----------tgg--------tga---c-----------
A0A3Q3DUT7_BCL2L1-      -------cct-----------tgg--------tga---c-----------
W5MG74_BCL2L1-01        -------ctc-----------tgg--------tta---c-----------
A0A3Q3WIW8_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A2U9BY16_BCL2L1-      -------cccccctcctctctctg--------tgg---t-----------
A0A2U9BY16_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A2U9BY16_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A2U9BY16_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A2U9BY16_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A3B5PQJ0_BCL2L1-      -------gcg-----------tgg--------tga---c-----------
A0A3P9N9Y4_BCL2L1-      -------gcg-----------tgg--------tga---c-----------
A0A3B3WI27_BCL2L1-      -------gtg-----------tgg--------tga---c-----------
A0A087X9B7_BCL2L1-      -------gtg-----------tgg--------tga---c-----------
A0A3B3TUS7_BCL2L1-      -------gtg-----------tgg--------tga---c-----------
A0A3Q2FR43_BCL2L1-      -------gcg-----------tgg--------cca---c-----------
A0A3Q2QPL9_BCL2L1-      -------gcg-----------tgg--------tga---c-----------
A0A3Q3B3X5_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3Q0RTF8_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
I3IZK7_BCL2L1-01        -------cgg-----------tgg--------tga---c-----------
A0A3Q4N4B5_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3Q2X557_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3P8P0F1_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3P9D632_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3P9D632_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3B4FNX1_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      -------cgg-----------tgg--------cga---c-----------
A0A3B3IB64_BCL2L1-      -------cgg-----------tgg--------cga---c-----------
A0A3P9JYH1_BCL2L1-      -------cgg-----------tgg--------cga---c-----------
C3VIT1_BCL2L1-01        -------ccg-----------tgg--------tga---c-----------
A0A3B4Z3X2_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3B4Z3X2_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3Q1FR00_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3Q1FR00_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3Q1DHJ3_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3Q1DHJ3_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3Q1DHJ3_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3P8TL99_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3P8TL99_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A219P0Y3_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A3Q3G2E1_BCL2L1-      -------cgc-----------tgg--------tga---c-----------
A0A3Q3G2E1_BCL2L1-      -------cgc-----------tgg--------tga---c-----------
A0A3Q3G2E1_BCL2L1-      -------cgc-----------tgg--------tga---c-----------
A0A3B4V3T1_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A3B4XU17_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A3Q3IVF5_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A3Q3MX20_BCL2L1-      -------cgc-----------tgg--------tga---c-----------
A0A3Q1GZ93_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A3Q1GZ93_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A3Q1GZ93_BCL2L1-      -------ccc-----------tgg--------tga---c-----------
A0A0D6DR75_BCL2L1-      -------cgg-----------tgg--------tga---c-----------
A0A3B3E2W4_BCL2L1-      -------cac-----------ttc--------taa---c-----------
A0A3P9MKK4_BCL2L1-      -------ccc-----------ttt--------taa---c-----------
A0A3P9MKK4_BCL2L1-      -------ccc-----------ttt--------taa---c-----------
A0A3B3I2Q5_BCL2L1-      -------ccc-----------ttt--------taa---c-----------
A0A3B3I2Q5_BCL2L1-      -------ccc-----------ttt--------taa---c-----------
A0A3P9I2N4_BCL2L1-      -------ccc-----------ttt--------taa---c-----------
A0A3P9I2N4_BCL2L1-      -------ccc-----------ttt--------taa---c-----------
A0A3B4BFZ8_BCL2L1-      -------ggt-----------tgc--------tag---c-----------
A0A3P8VMA1_BCL2L1-      -------gcc-----------tgc--------ttg---c-----------
A0A0F7L1T6_BCL2L1-      -------cgc-----------tgc--------tga---t-----------
H2U5I3_BCL2L1-01        -------cgc-----------tgc--------tga---t-----------
G3P7B4_BCL2L1-01        -------cgc-----------tgc--------taa---t-----------
A0A3Q3FUB6_BCL2L1-      -------cgc-----------tgc--------taa---t-----------
A0A3Q3X5M5_BCL2L1-      -------cgc-----------tgc--------taa---t-----------
A0A2U9BIG9_BCL2L1-      -------gga-----------tgc--------tga---c-----------
A0A3Q1JZ46_BCL2L1-      -------tgc-----------tgc--------tca---c-----------
A0A3Q1JZ46_BCL2L1-      -------tgc-----------tgc--------tca---c-----------
A0A3Q3NFM4_BCL2L1-      -------cgc-----------tgc--------taa---c-----------
A0A3Q3NFM4_BCL2L1-      -------cgc-----------tgc--------taa---c-----------
A0A3Q3J5K3_BCL2L1-      -------tgc-----------tgc--------taa---c-----------
A0A3B4V9K8_BCL2L1-      -------caa-----------tgt--------tgg---c-----------
A0A3B4XS24_BCL2L1-      -------cga-----------tgt--------tgg---c-----------
A0A3B5B4X7_BCL2L1-      -------cgc-----------tgc--------taa---c-----------
A0A3Q1EVP6_BCL2L1-      -------tgc-----------tgc--------taa---t-----------
A0A3Q1BQA0_BCL2L1-      -------tgc-----------tgc--------taa---t-----------
A0A3P8U812_BCL2L1-      -------tgc-----------tgc--------taa---t-----------
E6ZFR0_BCL2L1-01        -------cgc-----------tgc--------taa---t-----------
A0A0B4KJI5_BCL2L1-      -------cgc-----------tgc--------taa---t-----------
A0A3Q3BEB7_BCL2L1-      -------cgc-----------tgc--------tgg---c-----------
A0A3Q2C6K4_BCL2L1-      -------ctc-----------tgc--------tcg---g-----------
A0A3Q2NRP4_BCL2L1-      -------ctc-----------tgc--------taa---c-----------
A0A3B5MGS2_BCL2L1-      -------ctc-----------tgc--------tga---c-----------
M4A558_BCL2L1-01        -------ctc-----------tgc--------tga---c-----------
A0A3P9QFB3_BCL2L1-      -------ctc-----------tgc--------tga---c-----------
A0A3B3XN57_BCL2L1-      -------ctc-----------tgc--------tga---c-----------
A0A087YBW4_BCL2L1-      -------ctc-----------tgc--------tga---c-----------
A0A3B3VWI7_BCL2L1-      -------ctc-----------tgc--------tga---c-----------
                                                                          

R4JQR8_BCL2L1-01        -----------------------cgcaa-----tggcg-t----------
A0A346RRN1_BCL2L1-      -----------------------tgccc-----ttgcc-c----------
Q2TAP5_BCL2L1-01        -----------------------tgt-------tttcg-c----------
Q91828_BCL2L1-01        -----------------------tgt-------tttcg-c----------
H9GHK7_BCL2L1-01        -----------------------agtct-----gtctg-a----------
F6WA14_BCL2L1-01        -----------------------tgtag-----tcctg-c----------
G3WKX6_BCL2L1-01        -----------------------tgtag-----tcctg-c----------
A0A452FHY1_BCL2L1-      aactcatagtgactgttcctttcattacagtcattcat-gttttgcacaa
A0A452FHY1_BCL2L1-      gactcagcaggaaggcagctgtctctaaagataccc--------------
A0A3Q1LRT3_BCL2L1-      -----------------------tttggcattttctta-attaaacatat
A0A452E1B1_BCL2L1-      -----------------------tatgg-----ctctg-c----------
W5PSA5_BCL2L1-01        -----------------------tatgg-----ctctg-c----------
G3SPN0_BCL2L1-01        -----------------------agtgggaagttagtc-c----------
H0X6V2_BCL2L1-01        -----------------------agtta----------------------
O35843_BCL2L1-01        -----------------------tggaa-----acaga-aggatcggaag
P53563_BCL2L1-02        -----------------------tgtgg-----ccccg-cagtttcatag
P53563_BCL2L1-03        -----------------------tgtgg-----ccccg-cagtttcatag
Q64373_BCL2L1-01        -----------------------tgtgg-----ttctg-c----------
Q64373_BCL2L1-09        -----------------------tgtgg-----ttctg-c----------
P53563_BCL2L1-01        -----------------------tgtag-----ttctg-c----------
Q9MYW4_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A1U7QU73_BCL2L1-      -----------------------tgtgg-----ttctg-c----------
G3HEA7_BCL2L1-01        -----------------------tgtgg-----ttctg-c----------
G3HEA7_BCL2L1-02        -----------------------tgtgg-----ttctg-c----------
B2Z3Z4_BCL2L1-01        -----------------------tgtgg-----ttctg-c----------
O77737_BCL2L1-01        -----------------------ggtgg-----ttctg-c----------
G1P9D2_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A1S3EPX7_BCL2L1-      -----------------------tgtgg-----ttctg-c----------
A0A286Y5D6_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
M3XA94_BCL2L1-01        -----------------------attg------ttctg-c----------
M3XA94_BCL2L1-03        -----------------------cttggccagcatctg-c----------
M3XA94_BCL2L1-02        -----------------------tctgacca--ctctg-c----------
A0A1U7T4L4_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A1U7T4L4_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
L8J061_BCL2L1-01        -----------------------tgtgg-----ttctg-c----------
Q05KJ0_BCL2L1-02        -----------------------tgtgg-----ttctg-c----------
Q05KJ0_BCL2L1-01        -----------------------tgtgg-----ttctg-c----------
A0A452FWV3_BCL2L1-      -----------------------tgtgg-----ttctg-c----------
Q9MZS7_BCL2L1-01        -----------------------tgtgg-----ttctg-c----------
A0A1S2ZQT6_BCL2L1-      -----------------------cttgg-----ttatg-c----------
A0A3Q2H0F6_BCL2L1-      --------------------actagagg-----ttttt-c----------
A0A287CZ07_BCL2L1-      -----------------------tgtgg-----ttctg-c----------
I3MUP5_BCL2L1-02        -----------------------cgtgg-----ttctg-c----------
I3MUP5_BCL2L1-03        -----------------------cgtgg-----ttctg-c----------
I3MUP5_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A250YD48_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A1L5BWY3_BCL2L1-      -----------------------tgtgg-----ttctg-c----------
A0A3Q2H0F6_BCL2L1-      -----------------------tgtgg-----ttctg-c----------
E2IV76_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A2K6G3C5_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K6G3C5_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2J8VIH3_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2R8Z9D7_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5H963_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5H963_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A096NV05_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A096NV05_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
Q2PFS6_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A2K5M8B1_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5M8B1_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5VPG2_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5YR37_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5YR37_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5VPG2_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A0D9RJZ8_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
I7GKS6_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A2K6QFA2_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K6QFA2_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K6QFA2_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K6UWY8_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
E2IV77_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A2K6UWY8_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5Q6R6_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5Q6R6_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5Q6R6_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
F7IT34_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A2K5EBP4_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A2K5EBP4_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
E2IV75_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
Q76LT7_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
Q8SQ42_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
M3Z2H9_BCL2L1-01        -----------------------cgtgg-----ttctg-c----------
A0A452SDS4_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A384D3U1_BCL2L1-      -----------------------cgtgg-----ttctg-c----------
A0A493TIA6_BCL2L1-      -----------------------cgcac-----ccccc-c----------
A0A452ILL8_BCL2L1-      -----------------------agtgc-----tcctg-c----------
A0A452ILL8_BCL2L1-      -----------------------agtgc-----tcctg-c----------
K7F655_BCL2L1-01        -----------------------cgtgc-----tcctc-c----------
U3JSL7_BCL2L1-01        -----------------------agtgc-----ttctg-c----------
H0Z8G3_BCL2L1-01        -----------------------agtgc-----ttctg-c----------
A0A218USB3_BCL2L1-      -----------------------agtgc-----ttctg-c----------
A0A218USB3_BCL2L1-      -----------------------agtgc-----ttctg-c----------
A0A218USB3_BCL2L1-      -----------------------agtgc-----ttctg-c----------
A0A218USB3_BCL2L1-      -----------------------agtgc-----ttctg-c----------
Q4U2V6_BCL2L1-01        -----------------------agtgc-----ttctg-c----------
Q07816_BCL2L1-04        -----------------------agtgc-----ttctg-c----------
Q07816_BCL2L1-03        -----------------------agtgc-----ttctg-c----------
Q07816_BCL2L1-02        -----------------------agtgc-----ttctg-c----------
Q07816_BCL2L1-01        -----------------------agtgc-----ttctg-c----------
G1N5N5_BCL2L1-01        -----------------------agtgc-----ttctg-c----------
H3ANS8_BCL2L1-01        -----------------------ctttc-----ttctgcg----------
C1BLI0_BCL2L1-01        -----------------------aggag-----tgttg-g----------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      -----------------------aggag-----tgctg-g----------
A0A286MU87_BCL2L1-      -----------------------aggag-----tgctg-g----------
C0HAD8_BCL2L1-01        -----------------------aggag-----tgctg-g----------
H3CH49_BCL2L1-01        -----------------------aggga-----tcgcc-c----------
A0A345BSW9_BCL2L1-      --------------------------tt-----tcttc------------
Q90Z98_BCL2L1-02        -----------------------gggtg-----tcgtc-g----------
Q90Z98_BCL2L1-01        -----------------------gggtg-----tcgtc-g----------
A0A059PJI5_BCL2L1-      -----------------------ggggg-----tggtg-g----------
A0A3B3ZMX9_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3B3ZMX9_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
D2ITA2_BCL2L1-02        -----------------------tgggg-----tgctg-c----------
A0A3P8UWG7_BCL2L1-      -----------------------aggcg-----tggtg-g----------
A0A3B3QRZ2_BCL2L1-      -----------------------tggag-----ttgtt-g----------
A0A3B1JJ42_BCL2L1-      -----------------------aggaa-----ttgtg-g----------
A0A3B4DTL9_BCL2L1-      -----------------------agggg-----ttgtg-g----------
A0A3P8XYL5_BCL2L1-      -----------------------aggag-----ttgtc-g----------
B5XAY3_BCL2L1-01        -----------------------aggag-----tcgtc-g----------
A0A3B3TFR4_BCL2L1-      -----------------------gggag-----cgctg-g----------
A0A3Q3DUT7_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3Q3DUT7_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3Q3DUT7_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
W5MG74_BCL2L1-01        -----------------------ggggc-----tggtg-g----------
A0A3Q3WIW8_BCL2L1-      -----------------------cggag-----tcgtg-g----------
A0A2U9BY16_BCL2L1-      -----------------------ctgtg-----ttgtg-g----------
A0A2U9BY16_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A2U9BY16_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A2U9BY16_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A2U9BY16_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3B5PQJ0_BCL2L1-      -----------------------ggcct-----tcata-g----------
A0A3P9N9Y4_BCL2L1-      -----------------------ggcct-----tcata-g----------
A0A3B3WI27_BCL2L1-      -----------------------ggcct-----tcata-g----------
A0A087X9B7_BCL2L1-      -----------------------ggcct-----tcata-g----------
A0A3B3TUS7_BCL2L1-      -----------------------ggcct-----tcata-g----------
A0A3Q2FR43_BCL2L1-      -----------------------cgccc-----tcata-g----------
A0A3Q2QPL9_BCL2L1-      -----------------------ggcct-----tcata-g----------
A0A3Q3B3X5_BCL2L1-      -----------------------cgcgg-----tggtg-g----------
A0A3Q0RTF8_BCL2L1-      -----------------------cggcg-----tcgtg-g----------
I3IZK7_BCL2L1-01        -----------------------gggcg-----ttgtg-g----------
A0A3Q4N4B5_BCL2L1-      -----------------------aggcg-----tcgtg-g----------
A0A3Q2X557_BCL2L1-      -----------------------aggcg-----ttgtg-g----------
A0A3P8P0F1_BCL2L1-      -----------------------aggcg-----ttgtg-g----------
A0A3P9D632_BCL2L1-      -----------------------aggcg-----ttgtg-g----------
A0A3P9D632_BCL2L1-      -----------------------aggcg-----ttgtg-g----------
A0A3B4FNX1_BCL2L1-      -----------------------aggcg-----ttgtg-g----------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      -----------------------cggcg-----tcctg-g----------
A0A3B3IB64_BCL2L1-      -----------------------cggcg-----tcctg-g----------
A0A3P9JYH1_BCL2L1-      -----------------------cggcg-----tcctg-g----------
C3VIT1_BCL2L1-01        -----------------------cgggg-----tggtg-g----------
A0A3B4Z3X2_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3B4Z3X2_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3Q1FR00_BCL2L1-      -----------------------ggggg-----tggtg-g----------
A0A3Q1FR00_BCL2L1-      -----------------------ggggg-----tggtg-g----------
A0A3Q1DHJ3_BCL2L1-      -----------------------ggggg-----tggtg-g----------
A0A3Q1DHJ3_BCL2L1-      -----------------------ggggg-----tggtg-g----------
A0A3Q1DHJ3_BCL2L1-      -----------------------ggggg-----tggtg-g----------
A0A3P8TL99_BCL2L1-      -----------------------ggggg-----tggtg-g----------
A0A3P8TL99_BCL2L1-      -----------------------ggggg-----tggtg-g----------
A0A219P0Y3_BCL2L1-      -----------------------cggag-----ttgtg-g----------
A0A3Q3G2E1_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3Q3G2E1_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3Q3G2E1_BCL2L1-      -----------------------cgggg-----tcgtg-g----------
A0A3B4V3T1_BCL2L1-      -----------------------cgggg-----ttgtg-g----------
A0A3B4XU17_BCL2L1-      -----------------------cgggg-----ttgtg-g----------
A0A3Q3IVF5_BCL2L1-      -----------------------cggcg-----tcgtg-g----------
A0A3Q3MX20_BCL2L1-      -----------------------tgggg-----tcgtg-g----------
A0A3Q1GZ93_BCL2L1-      -----------------------tgggg-----tcgtg-g----------
A0A3Q1GZ93_BCL2L1-      -----------------------tgggg-----tcgtg-g----------
A0A3Q1GZ93_BCL2L1-      -----------------------tgggg-----tcgtg-g----------
A0A0D6DR75_BCL2L1-      -----------------------gggcg-----ttgtg-g----------
A0A3B3E2W4_BCL2L1-      -----------------------cggac-----tgctg-c----------
A0A3P9MKK4_BCL2L1-      -----------------------tggac-----tgctg-c----------
A0A3P9MKK4_BCL2L1-      -----------------------tggac-----tgctg-c----------
A0A3B3I2Q5_BCL2L1-      -----------------------tggac-----tgctg-c----------
A0A3B3I2Q5_BCL2L1-      -----------------------tggac-----tgctg-c----------
A0A3P9I2N4_BCL2L1-      -----------------------tggac-----tgctg-c----------
A0A3P9I2N4_BCL2L1-      -----------------------tggac-----tgctg-c----------
A0A3B4BFZ8_BCL2L1-      -----------------------tggag-----tgctg-g----------
A0A3P8VMA1_BCL2L1-      -----------------------agcag-----tgttg-a----------
A0A0F7L1T6_BCL2L1-      -----------------------gggag-----ttttg-g----------
H2U5I3_BCL2L1-01        -----------------------gggag-----ttttg-g----------
G3P7B4_BCL2L1-01        -----------------------gggag-----tgctc-g----------
A0A3Q3FUB6_BCL2L1-      -----------------------gggag-----tcgtg-g----------
A0A3Q3X5M5_BCL2L1-      -----------------------gggag-----ttatg-g----------
A0A2U9BIG9_BCL2L1-      -----------------------aggag-----tgctg-a----------
A0A3Q1JZ46_BCL2L1-      -----------------------gggag-----tgctg-t----------
A0A3Q1JZ46_BCL2L1-      -----------------------gggag-----tgctg-t----------
A0A3Q3NFM4_BCL2L1-      -----------------------gggag-----tgctg-a----------
A0A3Q3NFM4_BCL2L1-      -----------------------gggag-----tgctg-a----------
A0A3Q3J5K3_BCL2L1-      -----------------------aggag-----tgctg-g----------
A0A3B4V9K8_BCL2L1-      -----------------------aggag-----tgctg-a----------
A0A3B4XS24_BCL2L1-      -----------------------aggag-----tgctg-a----------
A0A3B5B4X7_BCL2L1-      -----------------------gggag-----tgctg-g----------
A0A3Q1EVP6_BCL2L1-      -----------------------gggag-----tgctg-g----------
A0A3Q1BQA0_BCL2L1-      -----------------------gggag-----ttctg-g----------
A0A3P8U812_BCL2L1-      -----------------------gggag-----ttctg-g----------
E6ZFR0_BCL2L1-01        -----------------------gggag-----ctgtg-g----------
A0A0B4KJI5_BCL2L1-      -----------------------gggag-----ttgtg-c----------
A0A3Q3BEB7_BCL2L1-      -----------------------tgggc-----tgctt-c----------
A0A3Q2C6K4_BCL2L1-      -----------------------cggag-----ttctg-c----------
A0A3Q2NRP4_BCL2L1-      -----------------------cggat-----ttctg-c----------
A0A3B5MGS2_BCL2L1-      -----------------------cggag-----ctctg-c----------
M4A558_BCL2L1-01        -----------------------cggag-----ctctg-c----------
A0A3P9QFB3_BCL2L1-      -----------------------cggag-----ctctg-c----------
A0A3B3XN57_BCL2L1-      -----------------------cggag-----ctctg-c----------
A0A087YBW4_BCL2L1-      -----------------------cggag-----ctctg-c----------
A0A3B3VWI7_BCL2L1-      -----------------------cggag-----ctctg-c----------
                                                                          

R4JQR8_BCL2L1-01        ---t--a-------agt---------------------------------
A0A346RRN1_BCL2L1-      ---t--t-------ggt---------------------------------
Q2TAP5_BCL2L1-01        ---attg-------gtc----------t----------------g-----
Q91828_BCL2L1-01        ---attg-------gtc----------t----------------g-----
H9GHK7_BCL2L1-01        ------a-------cac----------t----------------t-----
F6WA14_BCL2L1-01        ---t--g-------ggg----------t----------------c-----
G3WKX6_BCL2L1-01        ---t--g-------ggg----------t----------------c-----
A0A452FHY1_BCL2L1-      gctt--g-------tgt----------t----------------c-----
A0A452FHY1_BCL2L1-      -ctt--g-------gct----------c----------------a-----
A0A3Q1LRT3_BCL2L1-      atttacc-------aaa----------c----------------a-----
A0A452E1B1_BCL2L1-      ---t--g-------ggc----------t----------------t-----
W5PSA5_BCL2L1-01        ---t--g-------ggc----------t----------------t-----
G3SPN0_BCL2L1-01        ---a--g-------tgt----------t----------------------
H0X6V2_BCL2L1-01        ---t--g-------ggt----------t----------------a-----
O35843_BCL2L1-01        ttca--a-------ggc----------c----------------------
P53563_BCL2L1-02        tttt--g-------ttc----------c----------------a-----
P53563_BCL2L1-03        tttt--g-------ttc----------c----------------a-----
Q64373_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
Q64373_BCL2L1-09        ---t--g-------ggc----------t----------------c-----
P53563_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
Q9MYW4_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A1U7QU73_BCL2L1-      ---t--g-------ggc----------t----------------c-----
G3HEA7_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
G3HEA7_BCL2L1-02        ---t--g-------ggc----------t----------------c-----
B2Z3Z4_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
O77737_BCL2L1-01        ---t--g-------ggt----------t----------------c-----
G1P9D2_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A1S3EPX7_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A286Y5D6_BCL2L1-      ---t--g-------ggc----------t----------------c-----
M3XA94_BCL2L1-01        ---aacc-------aac----------t----------------a-----
M3XA94_BCL2L1-03        ---t--c-------aat----------g----------------a-----
M3XA94_BCL2L1-02        ---a--c-------agc----------t----------------c-----
A0A1U7T4L4_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A1U7T4L4_BCL2L1-      ---t--g-------ggc----------t----------------c-----
L8J061_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
Q05KJ0_BCL2L1-02        ---t--g-------ggc----------t----------------c-----
Q05KJ0_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A452FWV3_BCL2L1-      ---t--g-------ggc----------t----------------c-----
Q9MZS7_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A1S2ZQT6_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q2H0F6_BCL2L1-      ---t------------c----------t----------------c-----
A0A287CZ07_BCL2L1-      ---t--g-------ggc----------t----------------c-----
I3MUP5_BCL2L1-02        ---t--g-------ggc----------t----------------c-----
I3MUP5_BCL2L1-03        ---t--g-------ggc----------t----------------c-----
I3MUP5_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A250YD48_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A1L5BWY3_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q2H0F6_BCL2L1-      ---t--g-------ggc----------t----------------c-----
E2IV76_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A2K6G3C5_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K6G3C5_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2J8VIH3_BCL2L1-      ---t--g-------ggc----------t----------------c-----
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2R8Z9D7_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5H963_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5H963_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A096NV05_BCL2L1-      ---t--a-------ggc----------t----------------c-----
A0A096NV05_BCL2L1-      ---t--a-------ggc----------t----------------c-----
Q2PFS6_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A2K5M8B1_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5M8B1_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5VPG2_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5YR37_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5YR37_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5VPG2_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A0D9RJZ8_BCL2L1-      ---t--g-------ggc----------t----------------c-----
I7GKS6_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A2K6QFA2_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K6QFA2_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K6QFA2_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K6UWY8_BCL2L1-      ---t--g-------ggc----------t----------------c-----
E2IV77_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A2K6UWY8_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5Q6R6_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5Q6R6_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5Q6R6_BCL2L1-      ---t--g-------ggc----------t----------------c-----
F7IT34_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A2K5EBP4_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2K5EBP4_BCL2L1-      ---t--g-------ggc----------t----------------c-----
E2IV75_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
Q76LT7_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
Q8SQ42_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
M3Z2H9_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A452SDS4_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A384D3U1_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A493TIA6_BCL2L1-      ---c----------cgccccctccccct----------------c-----
A0A452ILL8_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A452ILL8_BCL2L1-      ---t--g-------ggc----------t----------------c-----
K7F655_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
U3JSL7_BCL2L1-01        ---t--g-------gga----------t----------------c-----
H0Z8G3_BCL2L1-01        ---t--g-------gga----------t----------------c-----
A0A218USB3_BCL2L1-      ---t--gagcac--ggactcgtgctgct----------------catgtc
A0A218USB3_BCL2L1-      ---t--gagcacgagga----------t----------------tagcat
A0A218USB3_BCL2L1-      ---t--g-------gga----------t----------------c-----
A0A218USB3_BCL2L1-      ---t--g-------gga----------t----------------c-----
Q4U2V6_BCL2L1-01        ---t--g-------gga----------t----------------c-----
Q07816_BCL2L1-04        ---t--g-------gga----------t----------------c-----
Q07816_BCL2L1-03        ---t--g-------gga----------t----------------c-----
Q07816_BCL2L1-02        ---t--g-------gga----------t----------------c-----
Q07816_BCL2L1-01        ---t--g-------gga----------t----------------c-----
G1N5N5_BCL2L1-01        ---t--g-------gga----------t----------------c-----
H3ANS8_BCL2L1-01        ---t--g-------ggg----------tggaaagaaacctcaaac-----
C1BLI0_BCL2L1-01        ---t--c-------ggc----------t----------------c-----
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      ---t--t-------ggc----------a----------------c-----
A0A286MU87_BCL2L1-      ---t--c-------ggc----------a----------------c-----
C0HAD8_BCL2L1-01        ---t--c-------ggc----------a----------------c-----
H3CH49_BCL2L1-01        ---t--c-------ggc----------t----------------c-----
A0A345BSW9_BCL2L1-      ---------------------------a----------------g-----
Q90Z98_BCL2L1-02        ---t--t-------ggg----------g----------------g-----
Q90Z98_BCL2L1-01        ---t--t-------ggg----------g----------------g-----
A0A059PJI5_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3B3ZMX9_BCL2L1-      ---t--g-------ggg----------t----------------c-----
A0A3B3ZMX9_BCL2L1-      ---t--g-------ggg----------t----------------c-----
D2ITA2_BCL2L1-02        ---t--c-------ggg----------g----------------c-----
A0A3P8UWG7_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3B3QRZ2_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3B1JJ42_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3B4DTL9_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3P8XYL5_BCL2L1-      ---t--t-------ggg----------t----------------c-----
B5XAY3_BCL2L1-01        ---t--a-------ggg----------t----------------c-----
A0A3B3TFR4_BCL2L1-      ---t--c-------ggc----------t----------------t-----
A0A3Q3DUT7_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q3DUT7_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q3DUT7_BCL2L1-      ---t--g-------ggc----------t----------------c-----
W5MG74_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A3Q3WIW8_BCL2L1-      ---t--t-------ggc----------t----------------c-----
A0A2U9BY16_BCL2L1-      ---c--a-------gga----------t----------------c-----
A0A2U9BY16_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2U9BY16_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2U9BY16_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A2U9BY16_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3B5PQJ0_BCL2L1-      ---c--c-------ggg----------t----------------c-----
A0A3P9N9Y4_BCL2L1-      ---c--c-------ggg----------t----------------c-----
A0A3B3WI27_BCL2L1-      ---c--c-------ggg----------t----------------c-----
A0A087X9B7_BCL2L1-      ---c--c-------ggg----------t----------------c-----
A0A3B3TUS7_BCL2L1-      ---c--c-------ggg----------t----------------c-----
A0A3Q2FR43_BCL2L1-      ---c--c-------ggc----------t----------------c-----
A0A3Q2QPL9_BCL2L1-      ---c--c-------ggc----------t----------------c-----
A0A3Q3B3X5_BCL2L1-      ---c--g-------ggt----------t----------------c-----
A0A3Q0RTF8_BCL2L1-      ---c--a-------ggt----------g----------------c-----
I3IZK7_BCL2L1-01        ---c--t-------ggt----------g----------------c-----
A0A3Q4N4B5_BCL2L1-      ---c--g-------ggt----------g----------------c-----
A0A3Q2X557_BCL2L1-      ---c--g-------ggt----------g----------------c-----
A0A3P8P0F1_BCL2L1-      ---c--g-------ggt----------g----------------c-----
A0A3P9D632_BCL2L1-      ---c--g-------ggt----------g----------------c-----
A0A3P9D632_BCL2L1-      ---c--g-------ggt----------g----------------c-----
A0A3B4FNX1_BCL2L1-      ---c--g-------ggt----------g----------------c-----
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      ---t--g-------gga----------t----------------c-----
A0A3B3IB64_BCL2L1-      ---t--g-------gga----------t----------------c-----
A0A3P9JYH1_BCL2L1-      ---t--g-------gga----------t----------------c-----
C3VIT1_BCL2L1-01        ---t--g-------ggc----------t----------------c-----
A0A3B4Z3X2_BCL2L1-      ---t--c-------ggt----------t----------------c-----
A0A3B4Z3X2_BCL2L1-      ---t--c-------ggt----------t----------------c-----
A0A3Q1FR00_BCL2L1-      ---t--g-------ggg----------t----------------c-----
A0A3Q1FR00_BCL2L1-      ---t--g-------ggg----------t----------------c-----
A0A3Q1DHJ3_BCL2L1-      ---t--g-------gga----------t----------------c-----
A0A3Q1DHJ3_BCL2L1-      ---t--g-------gga----------t----------------c-----
A0A3Q1DHJ3_BCL2L1-      ---t--g-------gga----------t----------------c-----
A0A3P8TL99_BCL2L1-      ---t--g-------gga----------t----------------c-----
A0A3P8TL99_BCL2L1-      ---t--g-------gga----------t----------------c-----
A0A219P0Y3_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q3G2E1_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q3G2E1_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q3G2E1_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3B4V3T1_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3B4XU17_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q3IVF5_BCL2L1-      ---t--g-------ggc----------t----------------c-----
A0A3Q3MX20_BCL2L1-      ---t--g-------ggt----------t----------------c-----
A0A3Q1GZ93_BCL2L1-      ---t--g-------ggg----------t----------------c-----
A0A3Q1GZ93_BCL2L1-      ---t--g-------ggg----------t----------------c-----
A0A3Q1GZ93_BCL2L1-      ---t--g-------ggg----------t----------------c-----
A0A0D6DR75_BCL2L1-      ---c--t-------ggt----------g----------------c-----
A0A3B3E2W4_BCL2L1-      ---t--t-------ggt----------t----------------t-----
A0A3P9MKK4_BCL2L1-      ---t--t-------ggt----------g----------------t-----
A0A3P9MKK4_BCL2L1-      ---t--t-------ggt----------g----------------t-----
A0A3B3I2Q5_BCL2L1-      ---t--g-------ggt----------g----------------t-----
A0A3B3I2Q5_BCL2L1-      ---t--g-------ggt----------g----------------t-----
A0A3P9I2N4_BCL2L1-      ---t--g-------ggt----------g----------------t-----
A0A3P9I2N4_BCL2L1-      ---t--g-------ggt----------g----------------t-----
A0A3B4BFZ8_BCL2L1-      ---t--t-------gct----------a----------------t-----
A0A3P8VMA1_BCL2L1-      ---t--t-------ggt----------g----------------t-----
A0A0F7L1T6_BCL2L1-      ---t--c-------ggc----------g----------------c-----
H2U5I3_BCL2L1-01        ---t--c-------ggc----------g----------------c-----
G3P7B4_BCL2L1-01        ---t--c-------ggt----------a----------------t-----
A0A3Q3FUB6_BCL2L1-      ---t--t-------ggt----------g----------------t-----
A0A3Q3X5M5_BCL2L1-      ---t--c-------ggt----------g----------------t-----
A0A2U9BIG9_BCL2L1-      ---t--t-------gct----------a----------------t-----
A0A3Q1JZ46_BCL2L1-      ---t--a-------ggt----------g----------------t-----
A0A3Q1JZ46_BCL2L1-      ---t--a-------ggt----------g----------------t-----
A0A3Q3NFM4_BCL2L1-      ---t--a-------ggt----------g----------------t-----
A0A3Q3NFM4_BCL2L1-      ---t--a-------ggt----------g----------------t-----
A0A3Q3J5K3_BCL2L1-      ---t--t-------ggt----------g----------------t-----
A0A3B4V9K8_BCL2L1-      ---t--g-------ggc----------g----------------t-----
A0A3B4XS24_BCL2L1-      ---t--g-------ggc----------g----------------t-----
A0A3B5B4X7_BCL2L1-      ---c--t-------ggt----------g----------------t-----
A0A3Q1EVP6_BCL2L1-      ---c--t-------ggt----------g----------------t-----
A0A3Q1BQA0_BCL2L1-      ---c--t-------ggt----------g----------------t-----
A0A3P8U812_BCL2L1-      ---c--t-------ggt----------g----------------t-----
E6ZFR0_BCL2L1-01        ---t--c-------ggg----------g----------------t-----
A0A0B4KJI5_BCL2L1-      ---t--c-------ggt----------g----------------t-----
A0A3Q3BEB7_BCL2L1-      ---t--c-------ggc----------g----------------t-----
A0A3Q2C6K4_BCL2L1-      ---t--c-------act----------g----------------t-----
A0A3Q2NRP4_BCL2L1-      ---t--c-------gtc----------g----------------t-----
A0A3B5MGS2_BCL2L1-      ---t--c-------gtc----------g----------------t-----
M4A558_BCL2L1-01        ---t--c-------gtc----------g----------------t-----
A0A3P9QFB3_BCL2L1-      ---t--c-------gtc----------a----------------t-----
A0A3B3XN57_BCL2L1-      ---t--c-------gtc----------a----------------t-----
A0A087YBW4_BCL2L1-      ---t--c-------gtc----------a----------------t-----
A0A3B3VWI7_BCL2L1-      ---t--c-------gtc----------a----------------t-----
                                                                          

R4JQR8_BCL2L1-01        ---gc---------------t-------tttctac---------------
A0A346RRN1_BCL2L1-      ---gc---------------t-------ttactac---------------
Q2TAP5_BCL2L1-01        ---ct---------------a-------catgagg---------------
Q91828_BCL2L1-01        ---ct---------------a-------catgagg---------------
H9GHK7_BCL2L1-01        --------------------a-------cattgat---------------
F6WA14_BCL2L1-01        ---cc---------------t-------attcagc---------------
G3WKX6_BCL2L1-01        ---cc---------------t-------gttcagc---------------
A0A452FHY1_BCL2L1-      ---cc---------------t-------tcctttt-------gttaca-g
A0A452FHY1_BCL2L1-      ---cc---------------t-------tcccctc-------tccccatg
A0A3Q1LRT3_BCL2L1-      ---acccagcaattgtac--t-------cttgagc-------atttatct
A0A452E1B1_BCL2L1-      ---gc---------------t-------cttcaac---------------
W5PSA5_BCL2L1-01        ---gc---------------t-------cttcaac---------------
G3SPN0_BCL2L1-01        --------------------t-------cctcacc---------------
H0X6V2_BCL2L1-01        --------------------t-------tct-------------------
O35843_BCL2L1-01        ----c---------------t-------cctcagc---------------
P53563_BCL2L1-02        ---at---------------t-------tctcggc---------------
P53563_BCL2L1-03        ---at---------------t-------tctcggc---------------
Q64373_BCL2L1-01        ---ac---------------t-------cttcagt---------------
Q64373_BCL2L1-09        ---ac---------------t-------cttcagt---------------
P53563_BCL2L1-01        ---ac---------------t-------cttcagt---------------
Q9MYW4_BCL2L1-01        ---cc---------------t-------cttcagc---------------
A0A1U7QU73_BCL2L1-      ---tc---------------t-------cttcagt---------------
G3HEA7_BCL2L1-01        ---tc---------------t-------cttcagt---------------
G3HEA7_BCL2L1-02        ---tc---------------t-------cttcagt---------------
B2Z3Z4_BCL2L1-01        ---tc---------------t-------cttcagt---------------
O77737_BCL2L1-01        ---gc---------------t-------cttcagt---------------
G1P9D2_BCL2L1-01        ---ac---------------t-------cttcagt---------------
A0A1S3EPX7_BCL2L1-      ---gc---------------t-------cttcagt---------------
A0A286Y5D6_BCL2L1-      ---gc---------------t-------cttcagt---------------
M3XA94_BCL2L1-01        ---cccc--------aaaact-------taa-------------------
M3XA94_BCL2L1-03        ---acat---------gaggt-------tattatt-------agatgcag
M3XA94_BCL2L1-02        ---ccgtcccagggcagaagt-------tcccgga-------ggaggggg
A0A1U7T4L4_BCL2L1-      ---gc---------------t-------cttcagt---------------
A0A1U7T4L4_BCL2L1-      ---gc---------------t-------cttcagt---------------
L8J061_BCL2L1-01        ---gc---------------t-------cttcagt---------------
Q05KJ0_BCL2L1-02        ---gc---------------t-------cttcagt---------------
Q05KJ0_BCL2L1-01        ---gc---------------t-------cttcagt---------------
A0A452FWV3_BCL2L1-      ---gc---------------t-------cttcagt---------------
Q9MZS7_BCL2L1-01        ---gc---------------t-------cttcagt---------------
A0A1S2ZQT6_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A3Q2H0F6_BCL2L1-      ---gc---------------t-------cttcagg-------aaatgcca
A0A287CZ07_BCL2L1-      ---ac---------------t-------tttcagt---------------
I3MUP5_BCL2L1-02        ---gc---------------t-------tttcagt---------------
I3MUP5_BCL2L1-03        ---gc---------------t-------tttcagt---------------
I3MUP5_BCL2L1-01        ---gc---------------t-------tttcagt---------------
A0A250YD48_BCL2L1-      ---gc---------------t-------cttcagt---------------
A0A1L5BWY3_BCL2L1-      ---gc---------------t-------cttcagt---------------
A0A3Q2H0F6_BCL2L1-      ---ac---------------t-------cttcagt---------------
E2IV76_BCL2L1-01        ---gc---------------t-------tttcagt---------------
A0A2K6G3C5_BCL2L1-      ---gc---------------t-------cttcagt---------------
A0A2K6G3C5_BCL2L1-      ---gc---------------t-------cttcagt---------------
A0A2J8VIH3_BCL2L1-      ---ac---------------t-------cttcagt---------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2R8Z9D7_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K5H963_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K5H963_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A096NV05_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A096NV05_BCL2L1-      ---ac---------------t-------cttcagt---------------
Q2PFS6_BCL2L1-01        ---ac---------------t-------cttcagt---------------
A0A2K5M8B1_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K5M8B1_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K5VPG2_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K5YR37_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K5YR37_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K5VPG2_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A0D9RJZ8_BCL2L1-      ---ac---------------t-------cttcagt---------------
I7GKS6_BCL2L1-01        ---ac---------------t-------cttcagt---------------
A0A2K6QFA2_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K6QFA2_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K6QFA2_BCL2L1-      ---ac---------------t-------cttcagt---------------
A0A2K6UWY8_BCL2L1-      ---ac---------------t-------ctttagt---------------
E2IV77_BCL2L1-01        ---ac---------------t-------ctttagt---------------
A0A2K6UWY8_BCL2L1-      ---ac---------------t-------ctttagt---------------
A0A2K5Q6R6_BCL2L1-      ---ac---------------t-------ctttagt---------------
A0A2K5Q6R6_BCL2L1-      ---ac---------------t-------ctttagt---------------
A0A2K5Q6R6_BCL2L1-      ---ac---------------t-------ctttagt---------------
F7IT34_BCL2L1-01        ---ac---------------t-------ctttagt---------------
A0A2K5EBP4_BCL2L1-      ---ac---------------t-------ctttagt---------------
A0A2K5EBP4_BCL2L1-      ---ac---------------t-------ctttagt---------------
E2IV75_BCL2L1-01        ---ac---------------t-------ctttagt---------------
Q76LT7_BCL2L1-01        ---gc---------------t-------cttcagt---------------
Q8SQ42_BCL2L1-01        ---ac---------------t-------cttcagt---------------
M3Z2H9_BCL2L1-01        ---ac---------------t-------cttcagt---------------
A0A452SDS4_BCL2L1-      ---gc---------------t-------cttcagt---------------
A0A384D3U1_BCL2L1-      ---gc---------------t-------cttcagt---------------
A0A493TIA6_BCL2L1-      ---cc---------------t-------ccctctctccctccctccctcc
A0A452ILL8_BCL2L1-      ---tc---------------t-------gctgagc---------------
A0A452ILL8_BCL2L1-      ---tc---------------t-------gctgagc---------------
K7F655_BCL2L1-01        ---gc---------------t-------gctgagc---------------
U3JSL7_BCL2L1-01        ---gc---------------t-------gctgagc---------------
H0Z8G3_BCL2L1-01        ---cc---------------t-------gctgagc---------------
A0A218USB3_BCL2L1-      ggacc---------------c-------gctcaga-ccccgcatggggag
A0A218USB3_BCL2L1-      tagcc---------------c-------attgaacgcttcggtttgcagg
A0A218USB3_BCL2L1-      ---cc---------------t-------gctgagc---------------
A0A218USB3_BCL2L1-      ---cc---------------t-------gctgagc---------------
Q4U2V6_BCL2L1-01        ---cc---------------t-------gctgagc---------------
Q07816_BCL2L1-04        ---cc---------------t-------gctgagc---------------
Q07816_BCL2L1-03        ---cc---------------t-------gctgagc---------------
Q07816_BCL2L1-02        ---cc---------------t-------gctgagc---------------
Q07816_BCL2L1-01        ---cc---------------t-------gctgagc---------------
G1N5N5_BCL2L1-01        ---cc---------------t-------gctgagc---------------
H3ANS8_BCL2L1-01        ---tc---------------t-------ttttgcg---------------
C1BLI0_BCL2L1-01        ---tc---------------t-------cattgca---------------
A0A3P8XFS0_BCL2L1-      ----------------------------------g---------------
A0A3P8XFS0_BCL2L1-      ---tc---------------t-------cctcatg---------------
A0A286MU87_BCL2L1-      ---tc---------------t-------catcatg---------------
C0HAD8_BCL2L1-01        ---tc---------------t-------catcatg---------------
H3CH49_BCL2L1-01        ---ct---------------t-------catcgtc---------------
A0A345BSW9_BCL2L1-      ---tt---------------t-------aatcaca---------------
Q90Z98_BCL2L1-02        ---ac---------------t-------cattgca---------------
Q90Z98_BCL2L1-01        ---ac---------------t-------cattgca---------------
A0A059PJI5_BCL2L1-      ---ct---------------t-------catcgct---------------
A0A3B3ZMX9_BCL2L1-      ---ac---------------t-------gctcgcc---------------
A0A3B3ZMX9_BCL2L1-      ---ac---------------t-------gctcgcc---------------
D2ITA2_BCL2L1-02        ---tc---------------t-------gctcgcc---------------
A0A3P8UWG7_BCL2L1-      ---cc---------------t-------gattgcc---------------
A0A3B3QRZ2_BCL2L1-      ---tc---------------t-------cattgca---------------
A0A3B1JJ42_BCL2L1-      ---tc---------------t-------catcgct---------------
A0A3B4DTL9_BCL2L1-      ---cc---------------t-------catcgct---------------
A0A3P8XYL5_BCL2L1-      ---tc---------------t-------tattgct---------------
B5XAY3_BCL2L1-01        ---ac---------------t-------cttcgct---------------
A0A3B3TFR4_BCL2L1-      ---cc---------------t-------catcgcc---------------
A0A3Q3DUT7_BCL2L1-      ---gc---------------t-------catcgcc---------------
A0A3Q3DUT7_BCL2L1-      ---gc---------------t-------catcgcc---------------
A0A3Q3DUT7_BCL2L1-      ---gc---------------t-------catcgcc---------------
W5MG74_BCL2L1-01        ---ct---------------a-------catcgcc---------------
A0A3Q3WIW8_BCL2L1-      ---gc---------------t-------cattgtc---------------
A0A2U9BY16_BCL2L1-      ---cc---------------tttccctaattttct---------------
A0A2U9BY16_BCL2L1-      ---ac---------------t-------gattgcc---------------
A0A2U9BY16_BCL2L1-      ---ac---------------t-------gattgcc---------------
A0A2U9BY16_BCL2L1-      ---ac---------------t-------gattgcc---------------
A0A2U9BY16_BCL2L1-      ---ac---------------t-------gattgcc---------------
A0A3B5PQJ0_BCL2L1-      ---ca---------------t-------cttcgcc---------------
A0A3P9N9Y4_BCL2L1-      ---ca---------------t-------ctttgcc---------------
A0A3B3WI27_BCL2L1-      ---ca---------------t-------cttcgcc---------------
A0A087X9B7_BCL2L1-      ---ca---------------t-------cttcgcc---------------
A0A3B3TUS7_BCL2L1-      ---ca---------------t-------cttcgcc---------------
A0A3Q2FR43_BCL2L1-      ---ca---------------t-------cttcgcc---------------
A0A3Q2QPL9_BCL2L1-      ---ca---------------t-------cttcgtc---------------
A0A3Q3B3X5_BCL2L1-      ---gc---------------t-------cttcgcc---------------
A0A3Q0RTF8_BCL2L1-      ---ac---------------t-------catcgcg---------------
I3IZK7_BCL2L1-01        ---tc---------------t-------tatcgcg---------------
A0A3Q4N4B5_BCL2L1-      ---gc---------------t-------tatcgcg---------------
A0A3Q2X557_BCL2L1-      ---gc---------------t-------tatcgcg---------------
A0A3P8P0F1_BCL2L1-      ---gc---------------t-------tatcgcg---------------
A0A3P9D632_BCL2L1-      ---gc---------------t-------tatcgcg---------------
A0A3P9D632_BCL2L1-      ---gc---------------t-------tatcgcg---------------
A0A3B4FNX1_BCL2L1-      ---gc---------------t-------tatcgcg---------------
G3NJY1_BCL2L1-01        -------------------------------cgtt---------------
A0A3B3DHA1_BCL2L1-      ---ct---------------t-------catcgcc---------------
A0A3B3IB64_BCL2L1-      ---ct---------------t-------cctcgcc---------------
A0A3P9JYH1_BCL2L1-      ---ct---------------t-------cctcgcc---------------
C3VIT1_BCL2L1-01        ---gc---------------t-------gttcgcc---------------
A0A3B4Z3X2_BCL2L1-      ---gc---------------t-------catcgcc---------------
A0A3B4Z3X2_BCL2L1-      ---gc---------------t-------catcgcc---------------
A0A3Q1FR00_BCL2L1-      ---gc---------------t-------catcgcc---------------
A0A3Q1FR00_BCL2L1-      ---gc---------------t-------catcgcc---------------
A0A3Q1DHJ3_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A3Q1DHJ3_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A3Q1DHJ3_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A3P8TL99_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A3P8TL99_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A219P0Y3_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A3Q3G2E1_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A3Q3G2E1_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A3Q3G2E1_BCL2L1-      ---ac---------------t-------catcgcc---------------
A0A3B4V3T1_BCL2L1-      ---ac---------------t-------gattgcc---------------
A0A3B4XU17_BCL2L1-      ---ac---------------t-------gatcgcc---------------
A0A3Q3IVF5_BCL2L1-      ---ac---------------t-------catcatc---------------
A0A3Q3MX20_BCL2L1-      ---ac---------------t-------tattgcc---------------
A0A3Q1GZ93_BCL2L1-      ---ac---------------t-------catagcg---------------
A0A3Q1GZ93_BCL2L1-      ---ac---------------t-------catagcg---------------
A0A3Q1GZ93_BCL2L1-      ---ac---------------t-------catagcg---------------
A0A0D6DR75_BCL2L1-      ---tc---------------t-------tatcgcg---------------
A0A3B3E2W4_BCL2L1-      ---gc---------------t-------cattgcc---------------
A0A3P9MKK4_BCL2L1-      ---gc---------------t-------catcacc---------------
A0A3P9MKK4_BCL2L1-      ---gc---------------t-------catcacc---------------
A0A3B3I2Q5_BCL2L1-      ---gc---------------t-------catcacc---------------
A0A3B3I2Q5_BCL2L1-      ---gc---------------t-------catcacc---------------
A0A3P9I2N4_BCL2L1-      ---gc---------------t-------catcacc---------------
A0A3P9I2N4_BCL2L1-      ---gc---------------t-------catcacc---------------
A0A3B4BFZ8_BCL2L1-      ---gc---------------t-------cattgct---------------
A0A3P8VMA1_BCL2L1-      ---tc---------------t-------gatcact---------------
A0A0F7L1T6_BCL2L1-      ---tt---------------t-------catcgtc---------------
H2U5I3_BCL2L1-01        ---tt---------------t-------catcgtc---------------
G3P7B4_BCL2L1-01        ---gg---------------t-------catggtc---------------
A0A3Q3FUB6_BCL2L1-      ---tt---------------a-------catcgct---------------
A0A3Q3X5M5_BCL2L1-      ---gt---------------t-------cattgct---------------
A0A2U9BIG9_BCL2L1-      ---gt---------------t-------catcgct---------------
A0A3Q1JZ46_BCL2L1-      ---gc---------------t-------cattgct---------------
A0A3Q1JZ46_BCL2L1-      ---gc---------------t-------cattgct---------------
A0A3Q3NFM4_BCL2L1-      ---gc---------------t-------catcgct---------------
A0A3Q3NFM4_BCL2L1-      ---gc---------------t-------catcgct---------------
A0A3Q3J5K3_BCL2L1-      ---gc---------------t-------tgtcgct---------------
A0A3B4V9K8_BCL2L1-      ---gc---------------t-------catcgtt---------------
A0A3B4XS24_BCL2L1-      ---gc---------------t-------catcgtt---------------
A0A3B5B4X7_BCL2L1-      ---gc---------------t-------catcgct---------------
A0A3Q1EVP6_BCL2L1-      ---ac---------------t-------cattgct---------------
A0A3Q1BQA0_BCL2L1-      ---gc---------------t-------cattgct---------------
A0A3P8U812_BCL2L1-      ---gc---------------t-------cattgct---------------
E6ZFR0_BCL2L1-01        ---tc---------------t-------cattgct---------------
A0A0B4KJI5_BCL2L1-      ---cc---------------t-------catcgct---------------
A0A3Q3BEB7_BCL2L1-      ---gc---------------t-------cgtggct---------------
A0A3Q2C6K4_BCL2L1-      ---gc---------------t-------tgttgct---------------
A0A3Q2NRP4_BCL2L1-      ---gc---------------t-------cttcgcc---------------
A0A3B5MGS2_BCL2L1-      ---gt---------------t-------cgtcgct---------------
M4A558_BCL2L1-01        ---gt---------------t-------cgtcgct---------------
A0A3P9QFB3_BCL2L1-      ---gt---------------t-------tatcgct---------------
A0A3B3XN57_BCL2L1-      ---gt---------------t-------tgtcgct---------------
A0A087YBW4_BCL2L1-      ---gt---------------t-------cgtcgct---------------
A0A3B3VWI7_BCL2L1-      ---gt---------------t-------cgtcgct---------------
                                                                          

R4JQR8_BCL2L1-01        atagaacg---------------tga------------------------
A0A346RRN1_BCL2L1-      aaagggta---------------tga------------------------
Q2TAP5_BCL2L1-01        cgccga-----------------tag------------------------
Q91828_BCL2L1-01        cgccga-----------------tag------------------------
H9GHK7_BCL2L1-01        -----------------------tga------------------------
F6WA14_BCL2L1-01        cggaag-----------------tga------------------------
G3WKX6_BCL2L1-01        cggaag-----------------tga------------------------
A0A452FHY1_BCL2L1-      ctatagagaccttacaatt----taa------------------------
A0A452FHY1_BCL2L1-      ctcaag----cctac--------tga------------------------
A0A3Q1LRT3_BCL2L1-      gggaga-----------------tacgcaacattactgtag---------
A0A452E1B1_BCL2L1-      acataa--------------------------------------------
W5PSA5_BCL2L1-01        tgtaag--------------------------------------------
G3SPN0_BCL2L1-01        ctgaca-----------------caa-----------------tggttca
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        tattat-----------------ag-------------------------
P53563_BCL2L1-02        aaagaa-----------------aaacagcctgtgtgtttacttggctta
P53563_BCL2L1-03        aaagaa-----------------aaacagcctgtgtgtttacttggctta
Q64373_BCL2L1-01        cggaag-----------------tga------------------------
Q64373_BCL2L1-09        cggaag-----------------tga------------------------
P53563_BCL2L1-01        cggaag-----------------tga------------------------
Q9MYW4_BCL2L1-01        cggaaa-----------------tga------------------------
A0A1U7QU73_BCL2L1-      cggaag-----------------tga------------------------
G3HEA7_BCL2L1-01        cggaag-----------------tga------------------------
G3HEA7_BCL2L1-02        cggaag-----------------tga------------------------
B2Z3Z4_BCL2L1-01        cggaag-----------------tga------------------------
O77737_BCL2L1-01        cggaaa-----------------tga------------------------
G1P9D2_BCL2L1-01        cggaaa-----------------tga------------------------
A0A1S3EPX7_BCL2L1-      cggaaa-----------------tga------------------------
A0A286Y5D6_BCL2L1-      cggaaa-----------------tga------------------------
M3XA94_BCL2L1-01        ----gc-----------------taa------------------------
M3XA94_BCL2L1-03        ----gt-----------------tag------------------------
M3XA94_BCL2L1-02        cggtgc-----------------tga------------------------
A0A1U7T4L4_BCL2L1-      cggaaa-----------------tga------------------------
A0A1U7T4L4_BCL2L1-      cggaaa-----------------tga------------------------
L8J061_BCL2L1-01        cggaaa-----------------tga------------------------
Q05KJ0_BCL2L1-02        cggaaa-----------------tga------------------------
Q05KJ0_BCL2L1-01        cggaaa-----------------tga------------------------
A0A452FWV3_BCL2L1-      cggaaa-----------------tga------------------------
Q9MZS7_BCL2L1-01        cggaaa-----------------tga------------------------
A0A1S2ZQT6_BCL2L1-      cgaaaa-----------------tga------------------------
A0A3Q2H0F6_BCL2L1-      ttgcaa-----------------tga------------------------
A0A287CZ07_BCL2L1-      cggaaa-----------------tga------------------------
I3MUP5_BCL2L1-02        cggaaa-----------------tga------------------------
I3MUP5_BCL2L1-03        cggaaa-----------------tga------------------------
I3MUP5_BCL2L1-01        cggaaa-----------------tga------------------------
A0A250YD48_BCL2L1-      cggaaa-----------------tga------------------------
A0A1L5BWY3_BCL2L1-      cggaaa-----------------tga------------------------
A0A3Q2H0F6_BCL2L1-      cggaag-----------------tga------------------------
E2IV76_BCL2L1-01        cggaaa-----------------tga------------------------
A0A2K6G3C5_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K6G3C5_BCL2L1-      cggaaa-----------------tga------------------------
A0A2J8VIH3_BCL2L1-      cggaaa-----------------tga------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      cggaaa-----------------tga------------------------
A0A2R8Z9D7_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5H963_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5H963_BCL2L1-      cggaaa-----------------tga------------------------
A0A096NV05_BCL2L1-      cggaaa-----------------tga------------------------
A0A096NV05_BCL2L1-      cggaaa-----------------tga------------------------
Q2PFS6_BCL2L1-01        cggaaa-----------------tga------------------------
A0A2K5M8B1_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5M8B1_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5VPG2_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5YR37_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5YR37_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5VPG2_BCL2L1-      cggaaa-----------------tga------------------------
A0A0D9RJZ8_BCL2L1-      cggaaa-----------------tga------------------------
I7GKS6_BCL2L1-01        cggaaa-----------------tga------------------------
A0A2K6QFA2_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K6QFA2_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K6QFA2_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K6UWY8_BCL2L1-      cggaaa-----------------tga------------------------
E2IV77_BCL2L1-01        cggaaa-----------------tga------------------------
A0A2K6UWY8_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5Q6R6_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5Q6R6_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5Q6R6_BCL2L1-      cggaaa-----------------tga------------------------
F7IT34_BCL2L1-01        cggaaa-----------------tga------------------------
A0A2K5EBP4_BCL2L1-      cggaaa-----------------tga------------------------
A0A2K5EBP4_BCL2L1-      cggaaa-----------------tga------------------------
E2IV75_BCL2L1-01        cggaaa-----------------tga------------------------
Q76LT7_BCL2L1-01        cggaaa-----------------tga------------------------
Q8SQ42_BCL2L1-01        cggaaa-----------------tga------------------------
M3Z2H9_BCL2L1-01        cggaaa-----------------tga------------------------
A0A452SDS4_BCL2L1-      cggaaa-----------------tga------------------------
A0A384D3U1_BCL2L1-      cggaaa-----------------tga------------------------
A0A493TIA6_BCL2L1-      ctccaggcctgggcttt------taa------------------------
A0A452ILL8_BCL2L1-      cgcaag-----------------taa------------------------
A0A452ILL8_BCL2L1-      cgcaag-----------------taa------------------------
K7F655_BCL2L1-01        cgcaag-----------------tag------------------------
U3JSL7_BCL2L1-01        cgcaag-----------------tga------------------------
H0Z8G3_BCL2L1-01        cgcaag-----------------tga------------------------
A0A218USB3_BCL2L1-      cacgaggattagcattagcccattga------------------------
A0A218USB3_BCL2L1-      tggagg-----------------tga------------------------
A0A218USB3_BCL2L1-      cgcaag-----------------tga------------------------
A0A218USB3_BCL2L1-      cgcaag-----------------tga------------------------
Q4U2V6_BCL2L1-01        cgcaag-----------------tga------------------------
Q07816_BCL2L1-04        cgcaag-----------------tgaccccatggttgtgtcccctggcac
Q07816_BCL2L1-03        cgcaag-----------------tga------------------------
Q07816_BCL2L1-02        cgcaag-----------------tga------------------------
Q07816_BCL2L1-01        cgcaag-----------------tga------------------------
G1N5N5_BCL2L1-01        cgcaag-----------------tga------------------------
H3ANS8_BCL2L1-01        caaa-------------------tga------------------------
C1BLI0_BCL2L1-01        aagaaacatcat-----------tga------------------------
A0A3P8XFS0_BCL2L1-      aaaatgcgcaatggacc------tga------------------------
A0A3P8XFS0_BCL2L1-      aagaaacgccag-----------taa------------------------
A0A286MU87_BCL2L1-      aagaaacgccag-----------tga------------------------
C0HAD8_BCL2L1-01        aagaaacgccag-----------tga------------------------
H3CH49_BCL2L1-01        atgagg--------------------------------------------
A0A345BSW9_BCL2L1-      aagagcc-tttg-----------taa------------------------
Q90Z98_BCL2L1-02        cagaaacgcctg-----------tga------------------------
Q90Z98_BCL2L1-01        cagaaacgcctg-----------tga------------------------
A0A059PJI5_BCL2L1-      cagaagcgcctg-----------taa------------------------
A0A3B3ZMX9_BCL2L1-      cagagacgcctg-----------tga------------------------
A0A3B3ZMX9_BCL2L1-      cagagacgcctg-----------tga------------------------
D2ITA2_BCL2L1-02        aagaaacatgtc-----------tag------------------------
A0A3P8UWG7_BCL2L1-      cagaaacgtctc-----------tga------------------------
A0A3B3QRZ2_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3B1JJ42_BCL2L1-      cagaagcgtctg-----------taa------------------------
A0A3B4DTL9_BCL2L1-      cagaagcgtctg-----------taa------------------------
A0A3P8XYL5_BCL2L1-      cagaaacgcctg-----------tga------------------------
B5XAY3_BCL2L1-01        cagaaacgcctg-----------tga------------------------
A0A3B3TFR4_BCL2L1-      aagaaacgccag-----------tga------------------------
A0A3Q3DUT7_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3Q3DUT7_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3Q3DUT7_BCL2L1-      cagaagcgcctg-----------tga------------------------
W5MG74_BCL2L1-01        aagaaacgctta-----------tag------------------------
A0A3Q3WIW8_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A2U9BY16_BCL2L1-      ccactgcacgtggtatt------taa------------------------
A0A2U9BY16_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A2U9BY16_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A2U9BY16_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A2U9BY16_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3B5PQJ0_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3P9N9Y4_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3B3WI27_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A087X9B7_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3B3TUS7_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3Q2FR43_BCL2L1-      cacaaacgcctg-----------tga------------------------
A0A3Q2QPL9_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q3B3X5_BCL2L1-      cagaagcgcctg-----------tga------------------------
A0A3Q0RTF8_BCL2L1-      caaaaacgcctg-----------tga------------------------
I3IZK7_BCL2L1-01        caaaaacgcctg-----------tga------------------------
A0A3Q4N4B5_BCL2L1-      caaaaacgcctg-----------tga------------------------
A0A3Q2X557_BCL2L1-      caaaaacgcctg-----------tga------------------------
A0A3P8P0F1_BCL2L1-      caaaaacgcctg-----------tga------------------------
A0A3P9D632_BCL2L1-      caaaaacgcctg-----------tga------------------------
A0A3P9D632_BCL2L1-      caaaaacgcctg-----------tga------------------------
A0A3B4FNX1_BCL2L1-      caaaaacgcctg-----------tga------------------------
G3NJY1_BCL2L1-01        caga----catt-----------tga------------------------
A0A3B3DHA1_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3B3IB64_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3P9JYH1_BCL2L1-      cagaaacgcctg-----------tga------------------------
C3VIT1_BCL2L1-01        cagaaacgcctg-----------tga------------------------
A0A3B4Z3X2_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3B4Z3X2_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q1FR00_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q1FR00_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q1DHJ3_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q1DHJ3_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q1DHJ3_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3P8TL99_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3P8TL99_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A219P0Y3_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q3G2E1_BCL2L1-      cagaaacgcctg-----------tag------------------------
A0A3Q3G2E1_BCL2L1-      cagaaacgcctg-----------tag------------------------
A0A3Q3G2E1_BCL2L1-      cagaaacgcctg-----------tag------------------------
A0A3B4V3T1_BCL2L1-      caaaagcgcctg-----------tga------------------------
A0A3B4XU17_BCL2L1-      caaaagcgcctg-----------tga------------------------
A0A3Q3IVF5_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q3MX20_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q1GZ93_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q1GZ93_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A3Q1GZ93_BCL2L1-      cagaaacgcctg-----------tga------------------------
A0A0D6DR75_BCL2L1-      caaaaacgcctg-----------tga------------------------
A0A3B3E2W4_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3P9MKK4_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3P9MKK4_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3B3I2Q5_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3B3I2Q5_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3P9I2N4_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3P9I2N4_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3B4BFZ8_BCL2L1-      aagaaatag-----------------------------------------
A0A3P8VMA1_BCL2L1-      aaaaagcat--------------tga------------------------
A0A0F7L1T6_BCL2L1-      aagaaacat--------------tga------------------------
H2U5I3_BCL2L1-01        aagaaacat--------------tga------------------------
G3P7B4_BCL2L1-01        aagaagcgg--------------tga------------------------
A0A3Q3FUB6_BCL2L1-      aagaaacat--------------taa------------------------
A0A3Q3X5M5_BCL2L1-      aagaaacag--------------taa------------------------
A0A2U9BIG9_BCL2L1-      aagaaacag--------------tga------------------------
A0A3Q1JZ46_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3Q1JZ46_BCL2L1-      aagaaacgg--------------tga------------------------
A0A3Q3NFM4_BCL2L1-      aagaaacag--------------tga------------------------
A0A3Q3NFM4_BCL2L1-      aagaaacag--------------tga------------------------
A0A3Q3J5K3_BCL2L1-      aagaaattg--------------tga------------------------
A0A3B4V9K8_BCL2L1-      aagaaacat--------------taa------------------------
A0A3B4XS24_BCL2L1-      aagaaacat--------------taa------------------------
A0A3B5B4X7_BCL2L1-      aagaaacag--------------tga------------------------
A0A3Q1EVP6_BCL2L1-      aagaaacag--------------tga------------------------
A0A3Q1BQA0_BCL2L1-      aagaaacag--------------tga------------------------
A0A3P8U812_BCL2L1-      aagaaacag--------------tga------------------------
E6ZFR0_BCL2L1-01        aagaaacat--------------tga------------------------
A0A0B4KJI5_BCL2L1-      aagaaacag--------------tga------------------------
A0A3Q3BEB7_BCL2L1-      aagaagcgt--------------taa------------------------
A0A3Q2C6K4_BCL2L1-      aagaaacga--------------tga------------------------
A0A3Q2NRP4_BCL2L1-      aagaaacga--------------tga------------------------
A0A3B5MGS2_BCL2L1-      aagaaacga--------------tga------------------------
M4A558_BCL2L1-01        aagaaacga--------------tga------------------------
A0A3P9QFB3_BCL2L1-      aagaaacga--------------tga------------------------
A0A3B3XN57_BCL2L1-      aagaaacga--------------tga------------------------
A0A087YBW4_BCL2L1-      aagaaacga--------------tga------------------------
A0A3B3VWI7_BCL2L1-      aagaaacga--------------tga------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        ccacccaa------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        aaacctag------------------------------------------
P53563_BCL2L1-03        aaacctag------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        caggatggctgcgccttcacacatccaccacgcagctcccgagcaccatc
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
G3WKX6_BCL2L1-01        --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
P53563_BCL2L1-02        --------------------------------------------------
P53563_BCL2L1-03        --------------------------------------------------
Q64373_BCL2L1-01        --------------------------------------------------
Q64373_BCL2L1-09        --------------------------------------------------
P53563_BCL2L1-01        --------------------------------------------------
Q9MYW4_BCL2L1-01        --------------------------------------------------
A0A1U7QU73_BCL2L1-      --------------------------------------------------
G3HEA7_BCL2L1-01        --------------------------------------------------
G3HEA7_BCL2L1-02        --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A1S3EPX7_BCL2L1-      --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
M3XA94_BCL2L1-01        --------------------------------------------------
M3XA94_BCL2L1-03        --------------------------------------------------
M3XA94_BCL2L1-02        --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
A0A1U7T4L4_BCL2L1-      --------------------------------------------------
L8J061_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A1S2ZQT6_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
I3MUP5_BCL2L1-02        --------------------------------------------------
I3MUP5_BCL2L1-03        --------------------------------------------------
I3MUP5_BCL2L1-01        --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2J8VIH3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
A0A096NV05_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
A0A2K5Q6R6_BCL2L1-      --------------------------------------------------
F7IT34_BCL2L1-01        --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
A0A452ILL8_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
U3JSL7_BCL2L1-01        --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
A0A218USB3_BCL2L1-      --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
Q07816_BCL2L1-04        accatcacggggcgctcaccccgctccacggagcttccttcctcgcgccg
Q07816_BCL2L1-03        --------------------------------------------------
Q07816_BCL2L1-02        --------------------------------------------------
Q07816_BCL2L1-01        --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
Q90Z98_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
A0A3Q3DUT7_BCL2L1-      --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A2U9BY16_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q2QPL9_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A3Q3IVF5_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A2U9BIG9_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A3Q3J5K3_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
A0A0B4KJI5_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3Q2NRP4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        -------------------
A0A346RRN1_BCL2L1-      -------------------
Q2TAP5_BCL2L1-01        -------------------
Q91828_BCL2L1-01        -------------------
H9GHK7_BCL2L1-01        -------------------
F6WA14_BCL2L1-01        -------------------
G3WKX6_BCL2L1-01        -------------------
A0A452FHY1_BCL2L1-      -------------------
A0A452FHY1_BCL2L1-      -------------------
A0A3Q1LRT3_BCL2L1-      -------------------
A0A452E1B1_BCL2L1-      -------------------
W5PSA5_BCL2L1-01        -------------------
G3SPN0_BCL2L1-01        -------------------
H0X6V2_BCL2L1-01        -------------------
O35843_BCL2L1-01        -------------------
P53563_BCL2L1-02        -------------------
P53563_BCL2L1-03        -------------------
Q64373_BCL2L1-01        -------------------
Q64373_BCL2L1-09        -------------------
P53563_BCL2L1-01        -------------------
Q9MYW4_BCL2L1-01        -------------------
A0A1U7QU73_BCL2L1-      -------------------
G3HEA7_BCL2L1-01        -------------------
G3HEA7_BCL2L1-02        -------------------
B2Z3Z4_BCL2L1-01        -------------------
O77737_BCL2L1-01        -------------------
G1P9D2_BCL2L1-01        -------------------
A0A1S3EPX7_BCL2L1-      -------------------
A0A286Y5D6_BCL2L1-      -------------------
M3XA94_BCL2L1-01        -------------------
M3XA94_BCL2L1-03        -------------------
M3XA94_BCL2L1-02        -------------------
A0A1U7T4L4_BCL2L1-      -------------------
A0A1U7T4L4_BCL2L1-      -------------------
L8J061_BCL2L1-01        -------------------
Q05KJ0_BCL2L1-02        -------------------
Q05KJ0_BCL2L1-01        -------------------
A0A452FWV3_BCL2L1-      -------------------
Q9MZS7_BCL2L1-01        -------------------
A0A1S2ZQT6_BCL2L1-      -------------------
A0A3Q2H0F6_BCL2L1-      -------------------
A0A287CZ07_BCL2L1-      -------------------
I3MUP5_BCL2L1-02        -------------------
I3MUP5_BCL2L1-03        -------------------
I3MUP5_BCL2L1-01        -------------------
A0A250YD48_BCL2L1-      -------------------
A0A1L5BWY3_BCL2L1-      -------------------
A0A3Q2H0F6_BCL2L1-      -------------------
E2IV76_BCL2L1-01        -------------------
A0A2K6G3C5_BCL2L1-      -------------------
A0A2K6G3C5_BCL2L1-      -------------------
A0A2J8VIH3_BCL2L1-      -------------------
G1RER8_BCL2L1-01