Dataset for CDS BCL2L1 of organism all

[Download (right click)] [Edit] [Sequences] [Repertoires]

383 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      --------------------------------------------------
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      atgtgccccgtgcgcccggccctggcggcgcggactcgccggtttgcggc
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      --------------------------------------------------
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      cgagcgaggggcttcgggggtggggggggctgtgcccggtgcagggggtg
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      --------------------------------------------------
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      cgagggtgaccccgcggttaccgtcacaccgggcccctctcggggctgcc
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------atgagcattgacacaagc------------------
D2ITA2_BCL2L1-02        --------------atgagcattgacacaagc------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------gtt---------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------att---------------------------------
A0A6F9B188_BCL2L1-      --------------atg---------------------------------
A0A4W5R2W6_BCL2L1-      --------------att---------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------att---------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------att---------------------------------
A0A8C7IJ10_BCL2L1-      --------------att---------------------------------
A0A8C8D057_BCL2L1-      --------------att---------------------------------
A0A6F9BJ02_BCL2L1-      --------------atg---------------------------------
A0A4W5NQ40_BCL2L1-      --------------atg---------------------------------
A0A8C7UB69_BCL2L1-      --------------atg---------------------------------
A0A8C7J9N8_BCL2L1-      --------------atg---------------------------------
A0A8C8FJG7_BCL2L1-      --------------atg---------------------------------
B5XAY3_BCL2L1-01        --------------atg---------------------------------
A0A674C337_BCL2L1-      --------------atg---------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------atgttccgacggcacgtgaaggcgtcatattacgta
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      ------atgacaaggaggatcagccagtgcctggaacgctttgcctgcct
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      gtaacccttggcaacgccgcttgcccgcttccgccggccgccgttgggca
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      atagggaggcagggccgagcggacgtaggaggatacgtgcgagcacacac
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      gcctgcctcctccacattctcaacatttgctccgccgcgcacagctccct
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      acgccggcggaggggggcggggggagccgagctctttaacgggcggggcg
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      actcgtgaacacaaagtggatgtgtgacattcttgtggagcttgacagct
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      ctgctgagatctcttccccctgcttgaagccaactaactgctccttttcc
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      ggggcggggctgcctccgcctccgctgcgcttcgggactggcggagcgcg
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ttttgtgcgcaccgagcgacagacggactggagacagcgtcacggagcgg
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      agggcgccattcccggggaggttggtgcctgtagccgggacgggcagggg
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      gccgggccggtccgcagccaccgcagcgccagagccgcctcccgcagccc
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      aggacagcttcccgggaatcccgtgcttttgtttcggttcttgctgggcc
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      gttccatgcatcgcctgcccccttcttggaatgcgactcaccggatgact
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      ggcccggcccggcccggcccgcagccgcctgcccgcacccggtgaggccc
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      tgagctggtttgtcagccttgtgtaggtttggttttcacccccgagcgtc
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      catcgccgagtttccgcgcctggcgctgggatggccgtgcccgaagcgga
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      gggggctccctggggtccaggtcagatgctcccatcggcggtgcagaaga
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      ctgtggatatcagcggaccatggtggtctgagcagagggcagcaggaagg
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A7N4P3X2_BCL2L1-      --------------------------------------------------
A0A8C5YLY6_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
A0A8D2IA38_BCL2L1-      --------------------------------------------------
G3SPN0_BCL2L1-01        --------------------------------------------------
O35843_BCL2L1-01        --------------------------------------------------
Q7TS62_BCL2L1-02        --------------------------------------------------
Q7TS62_BCL2L1-03        --------------------------------------------------
Q5HZH3_BCL2L1-02        --------------------------------------------------
A0A8C6G6C7_BCL2L1-      --------------------------------------------------
Q7TS62_BCL2L1-01        --------------------------------------------------
A0A6I9LMY5_BCL2L1-      --------------------------------------------------
B2Z3Z4_BCL2L1-01        --------------------------------------------------
A0A8C6W748_BCL2L1-      --------------------------------------------------
H0X6V2_BCL2L1-01        --------------------------------------------------
A0A286Y5D6_BCL2L1-      --------------------------------------------------
A0A8D2AGI2_BCL2L1-      --------------------------------------------------
A0A287CZ07_BCL2L1-      --------------------------------------------------
A0A8C9UNM3_BCL2L1-      --------------------------------------------------
A0A8D2I760_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
A0A8C2YUU6_BCL2L1-      --------------------------------------------------
G1P9D2_BCL2L1-01        --------------------------------------------------
A0A8C5NZI4_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A8B9XQH5_BCL2L1-      --------------------------------------------------
Q05KJ0_BCL2L1-01        --------------------------------------------------
Q05KJ0_BCL2L1-02        --------------------------------------------------
A0A8C6DX24_BCL2L1-      --------------------------------------------------
A0A452FWV3_BCL2L1-      --------------------------------------------------
Q9MZS7_BCL2L1-01        --------------------------------------------------
A0A8C3WJH5_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
O77737_BCL2L1-01        --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A8D0J6V8_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A4X1SRM7_BCL2L1-      --------------------------------------------------
A0A8D0XF62_BCL2L1-      --------------------------------------------------
A0A8D1ALD6_BCL2L1-      --------------------------------------------------
A0A4X1SQU7_BCL2L1-      --------------------------------------------------
A0A8C4L2X1_BCL2L1-      --------------------------------------------------
A0A3Q2H0F6_BCL2L1-      --------------------------------------------------
A0A250YD48_BCL2L1-      --------------------------------------------------
A0A1L5BWY3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------------------------------------
A0A8C8YN28_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
E2IV77_BCL2L1-01        --------------------------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
E2IV75_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A6D2VXZ3_BCL2L1-      --------------------------------------------------
G1RER8_BCL2L1-01        --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A7I2V597_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A8I5MVB8_BCL2L1-      --------------------------------------------------
A0A8D2ERY7_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5VPG2_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A5F7ZJK5_BCL2L1-      --------------------------------------------------
A0A0D9RJZ8_BCL2L1-      --------------------------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8B8VBB9_BCL2L1-      --------------------------------------------------
A0A8C6F2V6_BCL2L1-      --------------------------------------------------
A0A8C9BM97_BCL2L1-      --------------------------------------------------
M3Z2H9_BCL2L1-01        --------------------------------------------------
A0A8C7BPR9_BCL2L1-      --------------------------------------------------
A0A5F5XYW0_BCL2L1-      --------------------------------------------------
A0A8C0TGM4_BCL2L1-      --------------------------------------------------
Q76LT7_BCL2L1-01        --------------------------------------------------
Q8SQ42_BCL2L1-01        --------------------------------------------------
A0A673UUI0_BCL2L1-      --------------------------------------------------
A0A452SDS4_BCL2L1-      --------------------------------------------------
A0A384D3U1_BCL2L1-      --------------------------------------------------
A0A8C9D5N1_BCL2L1-      --------------------------------------------------
A0A8C9M2S8_BCL2L1-      --------------------------------------------------
A0A667HK09_BCL2L1-      --------------------------------------------------
A0A3Q1LRT3_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2D608_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A4W2F845_BCL2L1-      --------------------------------------------------
A0A8B9WB42_BCL2L1-      --------------------------------------------------
A0A8C6FN58_BCL2L1-      --------------------------------------------------
A0A452E1B1_BCL2L1-      --------------------------------------------------
W5PSA5_BCL2L1-01        --------------------------------------------------
A0A8B9X9C2_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        --------------------------------------------------
W5MG74_BCL2L1-01        --------------------------------------------------
H9GHK7_BCL2L1-01        --------------------------------------------------
A0A6I8PIR3_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A8D0HVA8_BCL2L1-      --------------------------------------------------
A0A7M4EJG9_BCL2L1-      --------------------------------------------------
A0A670IBZ4_BCL2L1-      --------------------------------------------------
A0A8D0E1K1_BCL2L1-      --------------------------------------------------
A0A8D2L5P2_BCL2L1-      --------------------------------------------------
A0A8C6V6T2_BCL2L1-      agggcaccgcgtcctcctacggtaagcaggacggctgaggctgcagacca
A0A8C5RX62_BCL2L1-      --------------------------------------------------
A0A670Z9Y4_BCL2L1-      --------------------------------------------------
A0A8C8S850_BCL2L1-      --------------------------------------------------
K7F655_BCL2L1-01        --------------------------------------------------
A0A8C0IVL6_BCL2L1-      --------------------------------------------------
A0A8C4W8N7_BCL2L1-      --------------------------------------------------
A0A8C3RIU8_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A8C3IUT0_BCL2L1-      --------------------------------------------------
A0A674J5J7_BCL2L1-      --------------------------------------------------
A0A8B9CUX0_BCL2L1-      --------------------------------------------------
A0A8B9DB39_BCL2L1-      --------------------------------------------------
A0A493TIA6_BCL2L1-      --------------------------------------------------
A0A8C3CGW6_BCL2L1-      --------------------------------------------------
A0A8B9SM69_BCL2L1-      --------------------------------------------------
A0A8B9V5I0_BCL2L1-      --------------------------------------------------
A0A8C7ECQ9_BCL2L1-      --------------------------------------------------
A0A669P0Q7_BCL2L1-      --------------------------------------------------
A0A8C2T2M7_BCL2L1-      --------------------------------------------------
A0A8C9EN38_BCL2L1-      --------------------------------------------------
A0A8C3LRK6_BCL2L1-      --------------------------------------------------
G1N5N5_BCL2L1-01        --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8B9NWH6_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C4JDK2_BCL2L1-      --------------------------------------------------
A0A8C5JFI3_BCL2L1-      --------------------------------------------------
A0A8D2M680_BCL2L1-      --------------------------------------------------
A0A803VLI1_BCL2L1-      --------------------------------------------------
A0A8C5U1E1_BCL2L1-      --------------------------------------------------
A0A8C3U3Q2_BCL2L1-      --------------------------------------------------
A0A8C0U194_BCL2L1-      --------------------------------------------------
H0Z8G3_BCL2L1-01        --------------------------------------------------
Q4U2V6_BCL2L1-01        --------------------------------------------------
A0A8C9NN65_BCL2L1-      --------------------------------------------------
A0A8C3XCF2_BCL2L1-      --------------------------------------------------
A0A8D2NN48_BCL2L1-      --------------------------------------------------
A0A8C0FL84_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8C4TWS5_BCL2L1-      --------------------------------------------------
A0A8C3KQJ2_BCL2L1-      --------------------------------------------------
A0A8C8A4L8_BCL2L1-      --------------------------------------------------
A0A8D0FHG7_BCL2L1-      --------------------------------------------------
A0A8B9N2I0_BCL2L1-      --------------------------------------------------
A0A663ECL2_BCL2L1-      --------------------------------------------------
A0A8C0AYR5_BCL2L1-      --------------------------------------------------
A0A8B9FKI5_BCL2L1-      agagcagggtcgggagctgctgagtgccgatctgtgcgtgctccggacca
A0A672UKR0_BCL2L1-      --------------------------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        ------------------------------------cgaagtcaccccgg
A0A059PJI5_BCL2L1-      --------------------------------------------------
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      --------------------------------------------------
A0A3P8UWG7_BCL2L1-      --------------------------------------------------
A0A345BSW9_BCL2L1-      --------------------------------------------------
B2GRK1_BCL2L1-01        --------------------------------------------------
B2GRK1_BCL2L1-02        --------------------------------------------------
Q90Z98_BCL2L1-01        --------------------------------------------------
A0A672K8R2_BCL2L1-      --------------------------------------------------
A0A8C1JXA4_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A673M4N6_BCL2L1-      --------------------------------------------------
A0A671QPE4_BCL2L1-      --------------------------------------------------
A0A672N8N5_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A671K7W7_BCL2L1-      --------------------------------------------------
A0A673IGS5_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      --------------------------------------------------
A0A3B1JJ42_BCL2L1-      --------------------------------------------------
A0A8B9LKW7_BCL2L1-      --------------------------------------------------
A0A8C9SVL8_BCL2L1-      --------------------------------------------------
A0A8C4CMF6_BCL2L1-      --------------------------------------------------
A0A3B3TFR4_BCL2L1-      --------------------------------------------------
A0A3P8XYL5_BCL2L1-      --------------------------------------------------
A0A6F9B188_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      --------------------------------------------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A6F9BJ02_BCL2L1-      --------------------------------------------------
A0A4W5NQ40_BCL2L1-      --------------------------------------------------
A0A8C7UB69_BCL2L1-      --------------------------------------------------
A0A8C7J9N8_BCL2L1-      --------------------------------------------------
A0A8C8FJG7_BCL2L1-      --------------------------------------------------
B5XAY3_BCL2L1-01        --------------------------------------------------
A0A674C337_BCL2L1-      --------------------------------------------------
A0A8C9SET9_BCL2L1-      --------------------------------------------------
A0A8C5G971_BCL2L1-      --------------------------------------------------
A0A8C5FC81_BCL2L1-      --------------------------------------------------
A0A665VM40_BCL2L1-      --------------------------------------------------
A0A3Q3WIW8_BCL2L1-      --------------------------------------------------
A0A3B5PQJ0_BCL2L1-      --------------------------------------------------
A0A3P9N9Y4_BCL2L1-      --------------------------------------------------
A0A3B3WI27_BCL2L1-      --------------------------------------------------
A0A087X9B7_BCL2L1-      --------------------------------------------------
A0A3B3TUS7_BCL2L1-      --------------------------------------------------
A0A3Q2FR43_BCL2L1-      --------------------------------------------------
A0A3Q3B3X5_BCL2L1-      --------------------------------------------------
A0A667ZHE8_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3G2E1_BCL2L1-      --------------------------------------------------
A0A3Q3MX20_BCL2L1-      --------------------------------------------------
A0A0D6DR75_BCL2L1-      --------------------------------------------------
A0A3Q1GZ93_BCL2L1-      --------------------------------------------------
A0A4W6BQD5_BCL2L1-      --------------------------------------------------
A0A3B4V3T1_BCL2L1-      --------------------------------------------------
A0A3B4XU17_BCL2L1-      --------------------------------------------------
A0A673BZP5_BCL2L1-      --------------------------------------------------
A0A671WXV0_BCL2L1-      --------------------------------------------------
A0A219P0Y3_BCL2L1-      --------------------------------------------------
A0A8C9WU15_BCL2L1-      --------------------------------------------------
A0A1A7ZDF6_BCL2L1-      --------------------------------------------------
A0A8F0MQ26_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A672IDC1_BCL2L1-      --------------------------------------------------
A0A3Q0RTF8_BCL2L1-      --------------------------------------------------
A0A668RI12_BCL2L1-      --------------------------------------------------
I3IZK7_BCL2L1-01        --------------------------------------------------
A0A3Q4N4B5_BCL2L1-      --------------------------------------------------
A0A3Q2X557_BCL2L1-      --------------------------------------------------
A0A3P8P0F1_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3P9D632_BCL2L1-      --------------------------------------------------
A0A3B4FNX1_BCL2L1-      --------------------------------------------------
A0A8C2ZZ68_BCL2L1-      --------------------------------------------------
G3NJY1_BCL2L1-01        --------------------------------------------------
A0A3B3DHA1_BCL2L1-      --------------------------------------------------
A0A3P9JYH1_BCL2L1-      --------------------------------------------------
A0A3B3IB64_BCL2L1-      --------------------------------------------------
A0A8C7YJI1_BCL2L1-      --------------------------------------------------
C3VIT1_BCL2L1-01        --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3B4Z3X2_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      --------------------------------------------------
A0A3Q1FR00_BCL2L1-      cagcctggcacagtgtgtgttcactctaacgcagcgagacggaccagagc
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3Q1DHJ3_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A3P8TL99_BCL2L1-      --------------------------------------------------
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        -------------------------------atg----------------
A0A346RRN1_BCL2L1-      -------------------------------atg----------------
A0A8C4STP1_BCL2L1-      -------------------------------atg----------------
A0A8C4XBF6_BCL2L1-      -------------------------------atg----------------
Q90ZH2_BCL2L1-01        -------------------------------atg----------------
Q2TAP5_BCL2L1-01        -------------------------------atg----------------
Q91828_BCL2L1-01        -------------------------------atg----------------
A0A8C5WFB8_BCL2L1-      -------------------------------atg----------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        -------------------------------atg----------------
A0A7N4P3X2_BCL2L1-      -------------------------------atg----------------
A0A7N4P3X2_BCL2L1-      -------------------------------atg----------------
A0A8C5YLY6_BCL2L1-      -------------------------------ata----------------
A0A8D2IA38_BCL2L1-      -------------------------------atg----------------
A0A8D2IA38_BCL2L1-      -------------------------------atg----------------
G3SPN0_BCL2L1-01        -------------------------------atg----------------
O35843_BCL2L1-01        -------------------------------atg----------------
Q7TS62_BCL2L1-02        -------------------------------atg----------------
Q7TS62_BCL2L1-03        -------------------------------atg----------------
Q5HZH3_BCL2L1-02        -------------------------------atg----------------
A0A8C6G6C7_BCL2L1-      -------------------------------atg----------------
Q7TS62_BCL2L1-01        -------------------------------atg----------------
A0A6I9LMY5_BCL2L1-      -------------------------------atg----------------
B2Z3Z4_BCL2L1-01        -------------------------------atg----------------
A0A8C6W748_BCL2L1-      -------------------------------atg----------------
H0X6V2_BCL2L1-01        -------------------------------atg----------------
A0A286Y5D6_BCL2L1-      -------------------------------atg----------------
A0A8D2AGI2_BCL2L1-      -------------------------------atg----------------
A0A287CZ07_BCL2L1-      -------------------------------atg----------------
A0A8C9UNM3_BCL2L1-      -------------------------------atg----------------
A0A8D2I760_BCL2L1-      -------------------------------atg----------------
A0A8C2YUU6_BCL2L1-      -------------------------------atg----------------
A0A8C2YUU6_BCL2L1-      -------------------------------atg----------------
A0A8C2YUU6_BCL2L1-      -------------------------------atg----------------
G1P9D2_BCL2L1-01        -------------------------------atg----------------
A0A8C5NZI4_BCL2L1-      -------------------------------atg----------------
A0A3Q2H0F6_BCL2L1-      -------------------------------atg----------------
A0A8B9XQH5_BCL2L1-      -------------------------------atg----------------
Q05KJ0_BCL2L1-01        -------------------------------atg----------------
Q05KJ0_BCL2L1-02        -------------------------------atg----------------
A0A8C6DX24_BCL2L1-      -------------------------------atg----------------
A0A452FWV3_BCL2L1-      -------------------------------atg----------------
Q9MZS7_BCL2L1-01        -------------------------------atg----------------
A0A8C3WJH5_BCL2L1-      -------------------------------atg----------------
A0A8D1ALD6_BCL2L1-      -------------------------------atg----------------
A0A4X1SQU7_BCL2L1-      -------------------------------atg----------------
A0A8D0XF62_BCL2L1-      -------------------------------atg----------------
O77737_BCL2L1-01        -------------------------------atg----------------
A0A8D0J6V8_BCL2L1-      -------------------------------atg----------------
A0A8D0J6V8_BCL2L1-      -------------------------------atg----------------
A0A8D0J6V8_BCL2L1-      -------------------------------atg----------------
A0A8D0J6V8_BCL2L1-      -------------------------------atg----------------
A0A8D0J6V8_BCL2L1-      -------------------------------atg----------------
A0A4X1SQU7_BCL2L1-      -------------------------------atg----------------
A0A4X1SQU7_BCL2L1-      -------------------------------atg----------------
A0A4X1SQU7_BCL2L1-      -------------------------------atg----------------
A0A4X1SRM7_BCL2L1-      -------------------------------atg----------------
A0A8D0XF62_BCL2L1-      -------------------------------atg----------------
A0A8D1ALD6_BCL2L1-      -------------------------------atg----------------
A0A4X1SQU7_BCL2L1-      -------------------------------atg----------------
A0A8C4L2X1_BCL2L1-      -------------------------------atg----------------
A0A3Q2H0F6_BCL2L1-      -------------------------------atg----------------
A0A250YD48_BCL2L1-      -------------------------------atg----------------
A0A1L5BWY3_BCL2L1-      -------------------------------atg----------------
A0A8B7FNN3_BCL2L1-      -------------------------------atg----------------
A0A8B7FNN3_BCL2L1-      -------------------------------atg----------------
A0A8B7FNN3_BCL2L1-      -------------------------------atg----------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -------------------------------atg----------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        -------------------------------atg----------------
A0A8C8YN28_BCL2L1-      -------------------------------atg----------------
A0A8I3ZZI7_BCL2L1-      -------------------------------atg----------------
A0A5F7ZJK5_BCL2L1-      -------------------------------atg----------------
A0A2K6UWY8_BCL2L1-      -------------------------------atg----------------
E2IV77_BCL2L1-01        -------------------------------atg----------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      -------------------------------atg----------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -------------------------------atg----------------
E2IV75_BCL2L1-01        -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A6D2VXZ3_BCL2L1-      -------------------------------atg----------------
G1RER8_BCL2L1-01        -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A7I2V597_BCL2L1-      -------------------------------atg----------------
A0A2R8Z9D7_BCL2L1-      -------------------------------atg----------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      -------------------------------atg----------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      -------------------------------atg----------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -------------------------------atg----------------
A0A2K5VPG2_BCL2L1-      -------------------------------atg----------------
A0A8I5MVB8_BCL2L1-      -------------------------------atg----------------
A0A8D2ERY7_BCL2L1-      -------------------------------atg----------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -------------------------------atg----------------
A0A2K5VPG2_BCL2L1-      -------------------------------atg----------------
A0A5F7ZJK5_BCL2L1-      -------------------------------atg----------------
A0A5F7ZJK5_BCL2L1-      -------------------------------atg----------------
A0A5F7ZJK5_BCL2L1-      -------------------------------atg----------------
A0A5F7ZJK5_BCL2L1-      -------------------------------atg----------------
A0A0D9RJZ8_BCL2L1-      -------------------------------atg----------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      -------------------------------atg----------------
A0A2K6QFA2_BCL2L1-      -------------------------------atg----------------
A0A2K5YR37_BCL2L1-      -------------------------------atg----------------
A0A5F5XYW0_BCL2L1-      -------------------------------atg----------------
A0A8C7BPR9_BCL2L1-      -------------------------------atg----------------
A0A5F5XYW0_BCL2L1-      -------------------------------atg----------------
A0A8B8VBB9_BCL2L1-      -------------------------------atg----------------
A0A8C6F2V6_BCL2L1-      -------------------------------atg----------------
A0A8C9BM97_BCL2L1-      -------------------------------atg----------------
M3Z2H9_BCL2L1-01        -------------------------------atg----------------
A0A8C7BPR9_BCL2L1-      -------------------------------atg----------------
A0A5F5XYW0_BCL2L1-      -------------------------------atg----------------
A0A8C0TGM4_BCL2L1-      -------------------------------atg----------------
Q76LT7_BCL2L1-01        -------------------------------atg----------------
Q8SQ42_BCL2L1-01        -------------------------------atg----------------
A0A673UUI0_BCL2L1-      -------------------------------atg----------------
A0A452SDS4_BCL2L1-      -------------------------------atg----------------
A0A384D3U1_BCL2L1-      -------------------------------atg----------------
A0A8C9D5N1_BCL2L1-      -------------------------------atg----------------
A0A8C9M2S8_BCL2L1-      -------------------------------atg----------------
A0A667HK09_BCL2L1-      -------------------------------atg----------------
A0A3Q1LRT3_BCL2L1-      -------------------------------atg----------------
A0A4W2D608_BCL2L1-      -------------------------------atg----------------
A0A4W2D608_BCL2L1-      -------------------------------atg----------------
A0A4W2F845_BCL2L1-      -------------------------------atg----------------
A0A4W2F845_BCL2L1-      -------------------------------atg----------------
A0A8B9WB42_BCL2L1-      -------------------------------atg----------------
A0A8C6FN58_BCL2L1-      -------------------------------atg----------------
A0A452E1B1_BCL2L1-      -------------------------------atg----------------
W5PSA5_BCL2L1-01        -------------------------------atg----------------
A0A8B9X9C2_BCL2L1-      -------------------------aaatttatc----------------
A0A452FHY1_BCL2L1-      -------------------------------atg----------------
A0A452FHY1_BCL2L1-      -------------------------------atg----------------
H3ANS8_BCL2L1-01        ----------------------------aaaatg----------------
W5MG74_BCL2L1-01        ----------------------------aagatg----------------
H9GHK7_BCL2L1-01        -------------------------------atg----------------
A0A6I8PIR3_BCL2L1-      -------------------------------atg----------------
A0A8D0HVA8_BCL2L1-      -------------------------------atg----------------
A0A8D0HVA8_BCL2L1-      -------------------------------atg----------------
A0A8D0HVA8_BCL2L1-      -------------------------------atg----------------
A0A7M4EJG9_BCL2L1-      -------------------------------atg----------------
A0A670IBZ4_BCL2L1-      -------------------------------atg----------------
A0A8D0E1K1_BCL2L1-      -------------------------------atg----------------
A0A8D2L5P2_BCL2L1-      -------------------------------atg----------------
A0A8C6V6T2_BCL2L1-      tggactcactgagacgggcagaggtgtgaaaatg----------------
A0A8C5RX62_BCL2L1-      -------------------------------atg----------------
A0A670Z9Y4_BCL2L1-      -------------------------------atg----------------
A0A8C8S850_BCL2L1-      -------------------------------atg----------------
K7F655_BCL2L1-01        -------------------------------atg----------------
A0A8C0IVL6_BCL2L1-      -------------------------------atg----------------
A0A8C4W8N7_BCL2L1-      -------------------------------atg--------aaatttac
A0A8C3RIU8_BCL2L1-      -------------------------------atg----------------
A0A8C3IUT0_BCL2L1-      -------------------------------atg----------------
A0A8C3IUT0_BCL2L1-      -------------------------------atg----------------
A0A8C3IUT0_BCL2L1-      -------------------------------atg----------------
A0A8C3IUT0_BCL2L1-      -------------------------------atg----------------
A0A674J5J7_BCL2L1-      -------------------------------atg----------------
A0A8B9CUX0_BCL2L1-      -------------------------------atg----------------
A0A8B9DB39_BCL2L1-      -------------------------------atg----------------
A0A493TIA6_BCL2L1-      -------------------------------atg----------------
A0A8C3CGW6_BCL2L1-      -------------------------------atg----------------
A0A8B9SM69_BCL2L1-      -------------------------------atg----------------
A0A8B9V5I0_BCL2L1-      -------------------------------atg----------------
A0A8C7ECQ9_BCL2L1-      -------------------------------atg----------------
A0A669P0Q7_BCL2L1-      -------------------------------atg----------------
A0A8C2T2M7_BCL2L1-      -------------------------------atg----------------
A0A8C9EN38_BCL2L1-      -------------------------------atg----------------
A0A8C3LRK6_BCL2L1-      -------------------------------atg----------------
G1N5N5_BCL2L1-01        -------------------------------atg----------------
A0A8B9NWH6_BCL2L1-      -------------------------------atg----------------
A0A8B9NWH6_BCL2L1-      -------------------------------atg----------------
A0A8C4JDK2_BCL2L1-      -------------------------------atg----------------
A0A8C4JDK2_BCL2L1-      -------------------------------atg----------------
A0A8C5JFI3_BCL2L1-      -------------------------------atg----------------
A0A8D2M680_BCL2L1-      -------------------------------atg----------------
A0A803VLI1_BCL2L1-      -------------------------------atg----------------
A0A8C5U1E1_BCL2L1-      -------------------------------atg----------------
A0A8C3U3Q2_BCL2L1-      -------------------------------atg----------------
A0A8C0U194_BCL2L1-      -------------------------------atg----------------
H0Z8G3_BCL2L1-01        -------------------------------atg----------------
Q4U2V6_BCL2L1-01        -------------------------------atg----------------
A0A8C9NN65_BCL2L1-      -------------------------------atg----------------
A0A8C3XCF2_BCL2L1-      -------------------------------atg----------------
A0A8D2NN48_BCL2L1-      -------------------------------atg----------------
A0A8C0FL84_BCL2L1-      -------------------------------atg----------------
A0A8C0AYR5_BCL2L1-      -------------------------------atg----------------
A0A8C4TWS5_BCL2L1-      -------------------------------atg----------------
A0A8C3KQJ2_BCL2L1-      -------------------------------atg----------------
A0A8C8A4L8_BCL2L1-      -------------------------------atg----------------
A0A8D0FHG7_BCL2L1-      -------------------------------atg----------------
A0A8B9N2I0_BCL2L1-      -------------------------------atg----------------
A0A663ECL2_BCL2L1-      -------------------------------atg----------------
A0A8C0AYR5_BCL2L1-      -------------------------------atg----------------
A0A8B9FKI5_BCL2L1-      tggactcattgagggcgtcccaggtgtgaaaatg----------------
A0A672UKR0_BCL2L1-      -------------------------------atg----------------
A0A3B5K6B9_BCL2L1-      -------------------------------atg----------------
H3CH49_BCL2L1-01        agcaaagtcaaaaggcgcatctacgcagaggatg----------------
A0A059PJI5_BCL2L1-      -------------------------------atg----------------
A0A8C5B4N8_BCL2L1-      -------------------------------atg----------------
D2ITA2_BCL2L1-02        -------------------------------atg----------------
C1BLI0_BCL2L1-01        -------------------------------atg----------------
A0A3B3ZMX9_BCL2L1-      -------------------------------atg----------------
A0A3B3ZMX9_BCL2L1-      -------------------------------atg----------------
A0A667Y1V0_BCL2L1-      -------------------------------atg----------------
A0A3P8XFS0_BCL2L1-      -------------------------------atg----------------
A0A3P8XFS0_BCL2L1-      -------------------------------atg----------------
A0A4W5LYF9_BCL2L1-      -------------------------------atg----------------
A0A6F8ZUL6_BCL2L1-      -------------------------------atg----------------
A0A674C4N2_BCL2L1-      -------------------------------atg----------------
A0A8C7RD80_BCL2L1-      -------------------------------atg----------------
A0A8C7CBC7_BCL2L1-      -------------------------------atg----------------
A0A8C7CBC7_BCL2L1-      -------------------------------atg----------------
A0A8C8GSY4_BCL2L1-      -------------------------------atg----------------
A0A8C8GSY4_BCL2L1-      -------------------------------atg----------------
A0A6F9CY91_BCL2L1-      -------------------------------atg----------------
A0A060XE41_BCL2L1-      -------------------------------atg----------------
A0A286MU87_BCL2L1-      -------------------------------atg----------------
A0A8C8J941_BCL2L1-      -------------------------------atg----------------
A0A8C7FX38_BCL2L1-      -------------------------------atg----------------
A0A4W5JPK5_BCL2L1-      -------------------------------atg----------------
C0HAD8_BCL2L1-01        -------------------------------atg----------------
A0A673Z4J6_BCL2L1-      -------------------------------atg----------------
A0A3B3QRZ2_BCL2L1-      -------------------------------atg----------------
A0A3P8UWG7_BCL2L1-      -------------------------------act----------------
A0A345BSW9_BCL2L1-      -------------------------------atg----------------
B2GRK1_BCL2L1-01        -------------------------------atg----------------
B2GRK1_BCL2L1-02        -------------------------------atg----------------
Q90Z98_BCL2L1-01        -------------------------------atg----------------
A0A672K8R2_BCL2L1-      -------------------------------atg----------------
A0A8C1JXA4_BCL2L1-      -------------------------------atg----------------
A0A673M4N6_BCL2L1-      -------------------------------atg----------------
A0A673M4N6_BCL2L1-      -------------------------------atg----------------
A0A671QPE4_BCL2L1-      -------------------------------atg----------------
A0A672N8N5_BCL2L1-      -------------------------------atg----------------
A0A671K7W7_BCL2L1-      -------------------------------atg----------------
A0A671K7W7_BCL2L1-      -------------------------------atg----------------
A0A673IGS5_BCL2L1-      -------------------------------atg----------------
A0A8C5D4L1_BCL2L1-      -------------------------------atg----------------
A0A8C5D4L1_BCL2L1-      -------------------------------atg----------------
A0A8C5D4L1_BCL2L1-      -------------------------------atg----------------
A0A4W4GHX3_BCL2L1-      -------------------------------atg----------------
A0A3B4DTL9_BCL2L1-      -------------------------------atg----------------
A0A3B1JJ42_BCL2L1-      -------------------------------atg----------------
A0A8B9LKW7_BCL2L1-      -------------------------------atg----------------
A0A8C9SVL8_BCL2L1-      -------------------------------atg----------------
A0A8C4CMF6_BCL2L1-      -------------------------------atg----------------
A0A3B3TFR4_BCL2L1-      -------------------------------atg----------------
A0A3P8XYL5_BCL2L1-      -------------------------------atg----------------
A0A6F9B188_BCL2L1-      -------------------------------atg----------------
A0A4W5R2W6_BCL2L1-      -------------------------------atg----------------
A0A4W5R2W6_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      --------------------------------------------------
A0A674C578_BCL2L1-      -------------------------------atg----------------
A0A8C7IJ10_BCL2L1-      --------------------------------------------------
A0A8C8D057_BCL2L1-      --------------------------------------------------
A0A8C7P574_BCL2L1-      -------------------------------atg----------------
A0A8C7IJ10_BCL2L1-      -------------------------------atg----------------
A0A8C8D057_BCL2L1-      -------------------------------atg----------------
A0A6F9BJ02_BCL2L1-      -------------------------------atg----------------
A0A4W5NQ40_BCL2L1-      -------------------------------atg----------------
A0A8C7UB69_BCL2L1-      -------------------------------atg----------------
A0A8C7J9N8_BCL2L1-      -------------------------------atg----------------
A0A8C8FJG7_BCL2L1-      -------------------------------atg----------------
B5XAY3_BCL2L1-01        -------------------------------atg----------------
A0A674C337_BCL2L1-      -------------------------------atg----------------
A0A8C9SET9_BCL2L1-      -------------------------------atg----------------
A0A8C5G971_BCL2L1-      -------------------------------atg----------------
A0A8C5FC81_BCL2L1-      -------------------------------atggcgcaactggaccccg
A0A665VM40_BCL2L1-      -------------------------------atg----------------
A0A3Q3WIW8_BCL2L1-      -------------------------------atg----------------
A0A3B5PQJ0_BCL2L1-      -------------------------------atg----------------
A0A3P9N9Y4_BCL2L1-      -------------------------------atg----------------
A0A3B3WI27_BCL2L1-      -------------------------------atg----------------
A0A087X9B7_BCL2L1-      -------------------------------atg----------------
A0A3B3TUS7_BCL2L1-      -------------------------------atg----------------
A0A3Q2FR43_BCL2L1-      -------------------------------atg----------------
A0A3Q3B3X5_BCL2L1-      -------------------------------atg----------------
A0A667ZHE8_BCL2L1-      -------------------------------atg----------------
A0A3Q3G2E1_BCL2L1-      -------------------------------atg----------------
A0A3Q3G2E1_BCL2L1-      -------------------------------atg----------------
A0A3Q3G2E1_BCL2L1-      -------------------------------atg----------------
A0A3Q3MX20_BCL2L1-      -------------------------------atg----------------
A0A0D6DR75_BCL2L1-      -------------------------------atg----------------
A0A3Q1GZ93_BCL2L1-      -------------------------------atg----------------
A0A4W6BQD5_BCL2L1-      -------------------------------atg----------------
A0A3B4V3T1_BCL2L1-      -------------------------------atg----------------
A0A3B4XU17_BCL2L1-      -------------------------------atg----------------
A0A673BZP5_BCL2L1-      -------------------------------atg----------------
A0A671WXV0_BCL2L1-      -------------------------------atg----------------
A0A219P0Y3_BCL2L1-      -------------------------------atg----------------
A0A8C9WU15_BCL2L1-      -------------------------------atg----------------
A0A1A7ZDF6_BCL2L1-      -------------------------------atg----------------
A0A8F0MQ26_BCL2L1-      -------------------------------atg----------------
A0A672IDC1_BCL2L1-      -------------------------------atg----------------
A0A672IDC1_BCL2L1-      -------------------------------atg----------------
A0A3Q0RTF8_BCL2L1-      -------------------------------atg----------------
A0A668RI12_BCL2L1-      -------------------------------atg----------------
I3IZK7_BCL2L1-01        -------------------------------atg----------------
A0A3Q4N4B5_BCL2L1-      -------------------------------atg----------------
A0A3Q2X557_BCL2L1-      -------------------------------atg----------------
A0A3P8P0F1_BCL2L1-      -------------------------------atg----------------
A0A3P9D632_BCL2L1-      -------------------------------atg----------------
A0A3P9D632_BCL2L1-      -------------------------------atg----------------
A0A3B4FNX1_BCL2L1-      -------------------------------atg----------------
A0A8C2ZZ68_BCL2L1-      -------------------------------atg----------------
G3NJY1_BCL2L1-01        -------------------------------atg----------------
A0A3B3DHA1_BCL2L1-      -------------------------------atg----------------
A0A3P9JYH1_BCL2L1-      -------------------------------atg----------------
A0A3B3IB64_BCL2L1-      -------------------------------atg----------------
A0A8C7YJI1_BCL2L1-      -------------------------------atg----------------
C3VIT1_BCL2L1-01        -------------------------------atg----------------
A0A3B4Z3X2_BCL2L1-      -------------------------------atg----------------
A0A3B4Z3X2_BCL2L1-      -------------------------------atg----------------
A0A3Q1FR00_BCL2L1-      -------------------------------atg----------------
A0A3Q1FR00_BCL2L1-      cacgaggacggaaaacacattggcacgcaacatg----------------
A0A3Q1DHJ3_BCL2L1-      -------------------------------atg----------------
A0A3Q1DHJ3_BCL2L1-      -------------------------------atg----------------
A0A3Q1DHJ3_BCL2L1-      -------------------------------atg----------------
A0A3P8TL99_BCL2L1-      -------------------------------atg----------------
A0A3P8TL99_BCL2L1-      -------------------------------atg----------------
A0A8C6UPI9_BCL2L1-      ----------------------------ataatg----------------
A0A3B4BFZ8_BCL2L1-      -------------------------------atg----------------
A0A3B3E2W4_BCL2L1-      -------------------------------atg----------------
A0A3P9MKK4_BCL2L1-      -------------------------------atg----------------
A0A3P9MKK4_BCL2L1-      -------------------------------atg----------------
A0A3B3I2Q5_BCL2L1-      -------------------------------atg----------------
A0A3B3I2Q5_BCL2L1-      -------------------------------atg----------------
A0A3P9I2N4_BCL2L1-      -------------------------------atg----------------
A0A3P9I2N4_BCL2L1-      -------------------------------atg----------------
A0A8C7XSQ2_BCL2L1-      -------------------------------atg----------------
A0A8C7XSQ2_BCL2L1-      -------------------------------atg----------------
A0A3P8VMA1_BCL2L1-      -------------------------------atg----------------
A0A3Q2C6K4_BCL2L1-      -------------------------------atg----------------
A0A3B5MGS2_BCL2L1-      -------------------------------atg----------------
M4A558_BCL2L1-01        -------------------------------atg----------------
A0A3P9QFB3_BCL2L1-      -------------------------------atg----------------
A0A3B3XN57_BCL2L1-      -------------------------------atg----------------
A0A087YBW4_BCL2L1-      -------------------------------atg----------------
A0A3B3VWI7_BCL2L1-      -------------------------------atg----------------
A0A1A8A2S0_BCL2L1-      -------------------------------atg----------------
A0A672JL90_BCL2L1-      -------------------------------atg----------------
A0A672Z262_BCL2L1-      -------------------------------atg----------------
A0A3Q3BEB7_BCL2L1-      -------------------------------atg----------------
A0A0F7L1T6_BCL2L1-      -------------------------------atg----------------
H2U5I3_BCL2L1-01        -------------------------------atg----------------
A0A8C2ZH46_BCL2L1-      -------------------------------atg----------------
G3P7B4_BCL2L1-01        -------------------------------atg----------------
A0A3Q3FUB6_BCL2L1-      -------------------------------atg----------------
A0A3Q3X5M5_BCL2L1-      -------------------------------atg----------------
A0A665VSD7_BCL2L1-      -------------------------------atg----------------
A0A8D3CTR5_BCL2L1-      -------------------------------atg----------------
A0A3Q1JZ46_BCL2L1-      ----------------------atggaagaaatg----------------
A0A3B5B4X7_BCL2L1-      ----------------------atggaaataatg----------------
A0A3Q1EVP6_BCL2L1-      -------------------------------atg----------------
A0A6G7K5D7_BCL2L1-      -------------------------------atg----------------
A0A3Q1BQA0_BCL2L1-      -------------------------------atg----------------
A0A3P8U812_BCL2L1-      -------------------------------atg----------------
A0A3Q3NFM4_BCL2L1-      -------------------------------atg----------------
A0A4W6EST2_BCL2L1-      -------------------------------atg----------------
A0A3B4V9K8_BCL2L1-      -------------------------------atg----------------
A0A3B4XS24_BCL2L1-      -------------------------------atg----------------
A0A510BW31_BCL2L1-      -------------------------------atg----------------
A0A8D0AAQ8_BCL2L1-      ----------------------atggaaataatg----------------
A0A8C4IRU9_BCL2L1-      -------------------------------atg----------------
E6ZFR0_BCL2L1-01        -------------------------------atg----------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------cc-----------------------ctac-------
A0A8C4XBF6_BCL2L1-      --------------tc-----------------------ttac-------
Q90ZH2_BCL2L1-01        --------------ga-----------------------gggc-------
Q2TAP5_BCL2L1-01        --------------ga-----------------------gggc-------
Q91828_BCL2L1-01        --------------ga-----------------------gggc-------
A0A8C5WFB8_BCL2L1-      ---------------------------------------gaag-------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------------tc-----------------------gcac-------
A0A7N4P3X2_BCL2L1-      --------------tc-----------------------tcac-------
A0A7N4P3X2_BCL2L1-      --------------ccagaaccagcatttttgcccaggatttc-------
A0A8C5YLY6_BCL2L1-      --------------ga-----------------------gagttgtggta
A0A8D2IA38_BCL2L1-      --------------cg-----------------------gcagtctggct
A0A8D2IA38_BCL2L1-      --------------cg-----------------------gcagtctggct
G3SPN0_BCL2L1-01        --------------tc-----------------------tcag-------
O35843_BCL2L1-01        --------------tc-----------------------tcag-------
Q7TS62_BCL2L1-02        --------------tc-----------------------tcag-------
Q7TS62_BCL2L1-03        --------------tc-----------------------tcag-------
Q5HZH3_BCL2L1-02        --------------tc-----------------------tcag-------
A0A8C6G6C7_BCL2L1-      --------------tc-----------------------tcag-------
Q7TS62_BCL2L1-01        --------------tc-----------------------tcag-------
A0A6I9LMY5_BCL2L1-      --------------tc-----------------------tcag-------
B2Z3Z4_BCL2L1-01        --------------tc-----------------------tcag-------
A0A8C6W748_BCL2L1-      --------------tc-----------------------tcag-------
H0X6V2_BCL2L1-01        --------------tc-----------------------tcag-------
A0A286Y5D6_BCL2L1-      --------------tc-----------------------tcaa-------
A0A8D2AGI2_BCL2L1-      --------------tc-----------------------tcag-------
A0A287CZ07_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C9UNM3_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D2I760_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C2YUU6_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C2YUU6_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C2YUU6_BCL2L1-      --------------tc-----------------------tcag-------
G1P9D2_BCL2L1-01        --------------tc-----------------------tcag-------
A0A8C5NZI4_BCL2L1-      --------------tc-----------------------tcag-------
A0A3Q2H0F6_BCL2L1-      --------------tc-----------------------tcag-------
A0A8B9XQH5_BCL2L1-      --------------tc-----------------------tcag-------
Q05KJ0_BCL2L1-01        --------------tc-----------------------tcag-------
Q05KJ0_BCL2L1-02        --------------tc-----------------------tcag-------
A0A8C6DX24_BCL2L1-      --------------tc-----------------------tcag-------
A0A452FWV3_BCL2L1-      --------------tc-----------------------tcag-------
Q9MZS7_BCL2L1-01        --------------tc-----------------------tcag-------
A0A8C3WJH5_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D1ALD6_BCL2L1-      --------------tc-----------------------tcag-------
A0A4X1SQU7_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D0XF62_BCL2L1-      --------------tc-----------------------tcag-------
O77737_BCL2L1-01        --------------tc-----------------------tcag-------
A0A8D0J6V8_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D0J6V8_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D0J6V8_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D0J6V8_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D0J6V8_BCL2L1-      --------------tc-----------------------tcag-------
A0A4X1SQU7_BCL2L1-      --------------tc-----------------------tcag-------
A0A4X1SQU7_BCL2L1-      --------------tc-----------------------tcag-------
A0A4X1SQU7_BCL2L1-      --------------tc-----------------------tcag-------
A0A4X1SRM7_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D0XF62_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D1ALD6_BCL2L1-      --------------tc-----------------------tcag-------
A0A4X1SQU7_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C4L2X1_BCL2L1-      --------------tc-----------------------tcag-------
A0A3Q2H0F6_BCL2L1-      --------------tc-----------------------tcag-------
A0A250YD48_BCL2L1-      --------------tc-----------------------tcag-------
A0A1L5BWY3_BCL2L1-      --------------tc-----------------------tcag-------
A0A8B7FNN3_BCL2L1-      --------------tc-----------------------tcag-------
A0A8B7FNN3_BCL2L1-      --------------tc-----------------------tcag-------
A0A8B7FNN3_BCL2L1-      --------------tc-----------------------tcag-------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------tc-----------------------tcag-------
A0A8C8YN28_BCL2L1-      --------------tc-----------------------tcag-------
A0A8I3ZZI7_BCL2L1-      --------------tc-----------------------tcag-------
A0A5F7ZJK5_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K6UWY8_BCL2L1-      --------------tc-----------------------tcag-------
E2IV77_BCL2L1-01        --------------tc-----------------------tcag-------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------tc-----------------------tcag-------
E2IV75_BCL2L1-01        --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A6D2VXZ3_BCL2L1-      --------------tc-----------------------tcag-------
G1RER8_BCL2L1-01        --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A7I2V597_BCL2L1-      --------------tc-----------------------tcag-------
A0A2R8Z9D7_BCL2L1-      --------------tc-----------------------tcag-------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K5VPG2_BCL2L1-      --------------tc-----------------------tcag-------
A0A8I5MVB8_BCL2L1-      --------------tc-----------------------tcag-------
A0A8D2ERY7_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K5VPG2_BCL2L1-      --------------tc-----------------------tcag-------
A0A5F7ZJK5_BCL2L1-      --------------tc-----------------------tcag-------
A0A5F7ZJK5_BCL2L1-      --------------tc-----------------------tcag-------
A0A5F7ZJK5_BCL2L1-      --------------tc-----------------------tcag-------
A0A5F7ZJK5_BCL2L1-      --------------tc-----------------------tcag-------
A0A0D9RJZ8_BCL2L1-      --------------tc-----------------------tcag-------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K6QFA2_BCL2L1-      --------------tc-----------------------tcag-------
A0A2K5YR37_BCL2L1-      --------------tc-----------------------tcag-------
A0A5F5XYW0_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C7BPR9_BCL2L1-      --------------tc-----------------------tcag-------
A0A5F5XYW0_BCL2L1-      --------------tc-----------------------tcag-------
A0A8B8VBB9_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C6F2V6_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C9BM97_BCL2L1-      --------------tc-----------------------tcag-------
M3Z2H9_BCL2L1-01        --------------tc-----------------------tcag-------
A0A8C7BPR9_BCL2L1-      --------------tc-----------------------tcag-------
A0A5F5XYW0_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C0TGM4_BCL2L1-      --------------tc-----------------------tcag-------
Q76LT7_BCL2L1-01        --------------tc-----------------------tcag-------
Q8SQ42_BCL2L1-01        --------------tc-----------------------tcag-------
A0A673UUI0_BCL2L1-      --------------tc-----------------------tcag-------
A0A452SDS4_BCL2L1-      --------------tc-----------------------tcag-------
A0A384D3U1_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C9D5N1_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C9M2S8_BCL2L1-      --------------tc-----------------------tcag-------
A0A667HK09_BCL2L1-      --------------tc-----------------------tcag-------
A0A3Q1LRT3_BCL2L1-      --------------tc-----------------------tcag-------
A0A4W2D608_BCL2L1-      --------------tc-----------------------tcag-------
A0A4W2D608_BCL2L1-      --------------tc-----------------------tcag-------
A0A4W2F845_BCL2L1-      --------------tc-----------------------tcag-------
A0A4W2F845_BCL2L1-      --------------tc-----------------------tcag-------
A0A8B9WB42_BCL2L1-      --------------tc-----------------------tcag-------
A0A8C6FN58_BCL2L1-      --------------tc-----------------------tcag-------
A0A452E1B1_BCL2L1-      --------------tc-----------------------tcag-------
W5PSA5_BCL2L1-01        --------------tc-----------------------tcag-------
A0A8B9X9C2_BCL2L1-      --------------tt-----------------------acagggaaagg
A0A452FHY1_BCL2L1-      --------------tc-----------------------tcag-------
A0A452FHY1_BCL2L1-      --------------tc-----------------------tcag-------
H3ANS8_BCL2L1-01        --------------tc-----------------------cttc-------
W5MG74_BCL2L1-01        --------------tc-----------------------atac-------
H9GHK7_BCL2L1-01        --------------tc-----------------------gagc-------
A0A6I8PIR3_BCL2L1-      --------------tc-----------------------tctg-------
A0A8D0HVA8_BCL2L1-      --------------tt-----------------------gagt-------
A0A8D0HVA8_BCL2L1-      --------------tt-----------------------gagt-------
A0A8D0HVA8_BCL2L1-      --------------tt-----------------------gagt-------
A0A7M4EJG9_BCL2L1-      --------------tc-----------------------gagc-------
A0A670IBZ4_BCL2L1-      --------------tc-----------------------acgc-------
A0A8D0E1K1_BCL2L1-      --------------tc-----------------------gagc-------
A0A8D2L5P2_BCL2L1-      --------------tc-----------------------gagc-------
A0A8C6V6T2_BCL2L1-      --------------tc-----------------------gagc-------
A0A8C5RX62_BCL2L1-      --------------tc-----------------------gagc-------
A0A670Z9Y4_BCL2L1-      --------------tc-----------------------gagc-------
A0A8C8S850_BCL2L1-      --------------tc-----------------------gaac-------
K7F655_BCL2L1-01        --------------tc-----------------------gaac-------
A0A8C0IVL6_BCL2L1-      --------------tc-----------------------gaac-------
A0A8C4W8N7_BCL2L1-      aagagcaaagccttct-----------------------caac-------
A0A8C3RIU8_BCL2L1-      --------------tc-----------------------gaac-------
A0A8C3IUT0_BCL2L1-      --------------tc-----------------------aaac-------
A0A8C3IUT0_BCL2L1-      --------------tc-----------------------aaac-------
A0A8C3IUT0_BCL2L1-      --------------tc-----------------------aaac-------
A0A8C3IUT0_BCL2L1-      --------------tc-----------------------aaac-------
A0A674J5J7_BCL2L1-      --------------tc-----------------------gaac-------
A0A8B9CUX0_BCL2L1-      --------------tc-----------------------cggc-------
A0A8B9DB39_BCL2L1-      --------------tc-----------------------cggc-------
A0A493TIA6_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C3CGW6_BCL2L1-      --------------tc-----------------------cagc-------
A0A8B9SM69_BCL2L1-      --------------tc-----------------------cagc-------
A0A8B9V5I0_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C7ECQ9_BCL2L1-      --------------tc-----------------------cagc-------
A0A669P0Q7_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C2T2M7_BCL2L1-      --------------tc-----------------------cggc-------
A0A8C9EN38_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C3LRK6_BCL2L1-      --------------tc-----------------------cagc-------
G1N5N5_BCL2L1-01        --------------tc-----------------------cagc-------
A0A8B9NWH6_BCL2L1-      --------------tc-----------------------cagc-------
A0A8B9NWH6_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C4JDK2_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C4JDK2_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C5JFI3_BCL2L1-      --------------ta-----------------------cagc-------
A0A8D2M680_BCL2L1-      --------------ta-----------------------cagc-------
A0A803VLI1_BCL2L1-      --------------ta-----------------------cagc-------
A0A8C5U1E1_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C3U3Q2_BCL2L1-      --------------ta-----------------------cagc-------
A0A8C0U194_BCL2L1-      --------------ta-----------------------cagc-------
H0Z8G3_BCL2L1-01        --------------ta-----------------------cagc-------
Q4U2V6_BCL2L1-01        --------------tc-----------------------cagc-------
A0A8C9NN65_BCL2L1-      --------------ta-----------------------cagc-------
A0A8C3XCF2_BCL2L1-      --------------ta-----------------------cagc-------
A0A8D2NN48_BCL2L1-      --------------ta-----------------------cagc-------
A0A8C0FL84_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C0AYR5_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C4TWS5_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C3KQJ2_BCL2L1-      --------------tc-----------------------caac-------
A0A8C8A4L8_BCL2L1-      --------------tc-----------------------cagc-------
A0A8D0FHG7_BCL2L1-      --------------tc-----------------------cagc-------
A0A8B9N2I0_BCL2L1-      --------------tc-----------------------cagc-------
A0A663ECL2_BCL2L1-      --------------tc-----------------------cagc-------
A0A8C0AYR5_BCL2L1-      --------------tc-----------------------cagc-------
A0A8B9FKI5_BCL2L1-      --------------tc-----------------------cagc-------
A0A672UKR0_BCL2L1-      --------------tc-----------------------cagc-------
A0A3B5K6B9_BCL2L1-      --------------tc-----------------------tca--------
H3CH49_BCL2L1-01        --------------tc-----------------------tct--------
A0A059PJI5_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C5B4N8_BCL2L1-      --------------tc-----------------------gatc-------
D2ITA2_BCL2L1-02        --------------tc-----------------------gatc-------
C1BLI0_BCL2L1-01        --------------tc-----------------------ttac-------
A0A3B3ZMX9_BCL2L1-      --------------tc-----------------------cct--------
A0A3B3ZMX9_BCL2L1-      --------------tc-----------------------cct--------
A0A667Y1V0_BCL2L1-      --------------tc-----------------------atac-------
A0A3P8XFS0_BCL2L1-      --------------tc-----------------------ttac-------
A0A3P8XFS0_BCL2L1-      --------------tc-----------------------ttac-------
A0A4W5LYF9_BCL2L1-      --------------tc-----------------------ttac-------
A0A6F8ZUL6_BCL2L1-      --------------tc-----------------------ttac-------
A0A674C4N2_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C7RD80_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C7CBC7_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C7CBC7_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C8GSY4_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C8GSY4_BCL2L1-      --------------tc-----------------------ttac-------
A0A6F9CY91_BCL2L1-      --------------tc-----------------------ttac-------
A0A060XE41_BCL2L1-      --------------tc-----------------------ttac-------
A0A286MU87_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C8J941_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C7FX38_BCL2L1-      --------------tc-----------------------ttac-------
A0A4W5JPK5_BCL2L1-      --------------tc-----------------------ttac-------
C0HAD8_BCL2L1-01        --------------tc-----------------------ttac-------
A0A673Z4J6_BCL2L1-      --------------tc-----------------------ttac-------
A0A3B3QRZ2_BCL2L1-      --------------tc-----------------------ttac-------
A0A3P8UWG7_BCL2L1-      --------ttgacctt-----------------------taat-------
A0A345BSW9_BCL2L1-      --------------tc-----------------------ttac-------
B2GRK1_BCL2L1-01        --------------tc-----------------------ttac-------
B2GRK1_BCL2L1-02        --------------tc-----------------------ttac-------
Q90Z98_BCL2L1-01        --------------tc-----------------------ttac-------
A0A672K8R2_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C1JXA4_BCL2L1-      --------------tc-----------------------ttac-------
A0A673M4N6_BCL2L1-      --------------tc-----------------------ttac-------
A0A673M4N6_BCL2L1-      --------------tc-----------------------ttac-------
A0A671QPE4_BCL2L1-      --------------tc-----------------------ttac-------
A0A672N8N5_BCL2L1-      --------------tc-----------------------ttac-------
A0A671K7W7_BCL2L1-      --------------tc-----------------------ttac-------
A0A671K7W7_BCL2L1-      --------------tc-----------------------ttac-------
A0A673IGS5_BCL2L1-      --------------tc-----------------------ttac-------
A0A8C5D4L1_BCL2L1-      --------------gc-----------------------gccc-------
A0A8C5D4L1_BCL2L1-      --------------gc-----------------------gccc-------
A0A8C5D4L1_BCL2L1-      --------------gc-----------------------gccc-------
A0A4W4GHX3_BCL2L1-      --------------tc-----------------------gtac-------
A0A3B4DTL9_BCL2L1-      --------------tc-----------------------ttac-------
A0A3B1JJ42_BCL2L1-      --------------tc-----------------------gtac-------
A0A8B9LKW7_BCL2L1-      --------------tc-----------------------gtac-------
A0A8C9SVL8_BCL2L1-      --------------tc-----------------------gtac-------
A0A8C4CMF6_BCL2L1-      --------------tc-----------------------ctac-------
A0A3B3TFR4_BCL2L1-      --------------tc-----------------------ctac-------
A0A3P8XYL5_BCL2L1-      --------------ac-----------------------ttac-------
A0A6F9B188_BCL2L1-      --------------ac-----------------------ttac-------
A0A4W5R2W6_BCL2L1-      --------------ac-----------------------ttac-------
A0A4W5R2W6_BCL2L1-      --------------at-----------------------gtgt-------
A0A674C578_BCL2L1-      --------------at-----------------------gtgt-------
A0A674C578_BCL2L1-      --------------ac-----------------------ttac-------
A0A8C7IJ10_BCL2L1-      --------------at-----------------------gtgt-------
A0A8C8D057_BCL2L1-      --------------at-----------------------gtgt-------
A0A8C7P574_BCL2L1-      --------------ac-----------------------ttac-------
A0A8C7IJ10_BCL2L1-      --------------ac-----------------------ttac-------
A0A8C8D057_BCL2L1-      --------------ac-----------------------ttac-------
A0A6F9BJ02_BCL2L1-      --------------ac-----------------------ttac-------
A0A4W5NQ40_BCL2L1-      --------------ac-----------------------ttac-------
A0A8C7UB69_BCL2L1-      --------------ac-----------------------ttac-------
A0A8C7J9N8_BCL2L1-      --------------ac-----------------------ttac-------
A0A8C8FJG7_BCL2L1-      --------------ac-----------------------ttac-------
B5XAY3_BCL2L1-01        --------------ac-----------------------ttac-------
A0A674C337_BCL2L1-      --------------ac-----------------------ttac-------
A0A8C9SET9_BCL2L1-      --------------tc-----------------------ctac-------
A0A8C5G971_BCL2L1-      --------------ac-----------------------tca--------
A0A8C5FC81_BCL2L1-      cccgccccttggtttc-----------------------cca--------
A0A665VM40_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q3WIW8_BCL2L1-      --------------tc-----------------------tgt--------
A0A3B5PQJ0_BCL2L1-      --------------tc-----------------------acg--------
A0A3P9N9Y4_BCL2L1-      --------------tc-----------------------acg--------
A0A3B3WI27_BCL2L1-      --------------tc-----------------------acg--------
A0A087X9B7_BCL2L1-      --------------tc-----------------------acg--------
A0A3B3TUS7_BCL2L1-      --------------tc-----------------------acg--------
A0A3Q2FR43_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q3B3X5_BCL2L1-      --------------tc-----------------------tca--------
A0A667ZHE8_BCL2L1-      --------------tc-----------------------cca--------
A0A3Q3G2E1_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q3G2E1_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q3G2E1_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q3MX20_BCL2L1-      --------------tc-----------------------tca--------
A0A0D6DR75_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q1GZ93_BCL2L1-      --------------tc-----------------------tca--------
A0A4W6BQD5_BCL2L1-      --------------tc-----------------------tca--------
A0A3B4V3T1_BCL2L1-      --------------tc-----------------------tca--------
A0A3B4XU17_BCL2L1-      --------------tc-----------------------tca--------
A0A673BZP5_BCL2L1-      --------------tc-----------------------tca--------
A0A671WXV0_BCL2L1-      --------------tc-----------------------aca--------
A0A219P0Y3_BCL2L1-      --------------tg-----------------------tca--------
A0A8C9WU15_BCL2L1-      --------------tc-----------------------tca--------
A0A1A7ZDF6_BCL2L1-      --------------tc-----------------------tca--------
A0A8F0MQ26_BCL2L1-      --------------ac-----------------------tca--------
A0A672IDC1_BCL2L1-      --------------tc-----------------------tga--------
A0A672IDC1_BCL2L1-      --------------tc-----------------------tga--------
A0A3Q0RTF8_BCL2L1-      --------------tc-----------------------tca--------
A0A668RI12_BCL2L1-      --------------tc-----------------------tca--------
I3IZK7_BCL2L1-01        --------------tc-----------------------tca--------
A0A3Q4N4B5_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q2X557_BCL2L1-      --------------tc-----------------------tca--------
A0A3P8P0F1_BCL2L1-      --------------tc-----------------------tca--------
A0A3P9D632_BCL2L1-      --------------tc-----------------------tca--------
A0A3P9D632_BCL2L1-      --------------tc-----------------------tca--------
A0A3B4FNX1_BCL2L1-      --------------tc-----------------------tca--------
A0A8C2ZZ68_BCL2L1-      --------------tc-----------------------tca--------
G3NJY1_BCL2L1-01        --------------tc-----------------------tca--------
A0A3B3DHA1_BCL2L1-      --------------tc-----------------------ccg--------
A0A3P9JYH1_BCL2L1-      --------------tc-----------------------ccg--------
A0A3B3IB64_BCL2L1-      --------------tc-----------------------ccg--------
A0A8C7YJI1_BCL2L1-      --------------tc-----------------------ccg--------
C3VIT1_BCL2L1-01        --------------tc-----------------------tca--------
A0A3B4Z3X2_BCL2L1-      --------------tc-----------------------tca--------
A0A3B4Z3X2_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q1FR00_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q1FR00_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q1DHJ3_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q1DHJ3_BCL2L1-      --------------tc-----------------------tca--------
A0A3Q1DHJ3_BCL2L1-      --------------tc-----------------------tca--------
A0A3P8TL99_BCL2L1-      --------------tc-----------------------tca--------
A0A3P8TL99_BCL2L1-      --------------tc-----------------------tca--------
A0A8C6UPI9_BCL2L1-      --------------tc-----------------------tcac-------
A0A3B4BFZ8_BCL2L1-      --------------tc-----------------------tccc-------
A0A3B3E2W4_BCL2L1-      --------------tc-----------------------ccac-------
A0A3P9MKK4_BCL2L1-      --------------tc-----------------------ccac-------
A0A3P9MKK4_BCL2L1-      --------------ac-----------------------taag-------
A0A3B3I2Q5_BCL2L1-      --------------tc-----------------------ccac-------
A0A3B3I2Q5_BCL2L1-      --------------ac-----------------------taag-------
A0A3P9I2N4_BCL2L1-      --------------tc-----------------------ccac-------
A0A3P9I2N4_BCL2L1-      --------------ac-----------------------taag-------
A0A8C7XSQ2_BCL2L1-      --------------tc-----------------------ccac-------
A0A8C7XSQ2_BCL2L1-      --------------ac-----------------------taag-------
A0A3P8VMA1_BCL2L1-      --------------tc-----------------------gtgc-------
A0A3Q2C6K4_BCL2L1-      --------------tc-----------------------atac-------
A0A3B5MGS2_BCL2L1-      --------------gc-----------------------ctac-------
M4A558_BCL2L1-01        --------------gc-----------------------ctac-------
A0A3P9QFB3_BCL2L1-      --------------tc-----------------------ctac-------
A0A3B3XN57_BCL2L1-      --------------tc-----------------------ctac-------
A0A087YBW4_BCL2L1-      --------------tc-----------------------ctac-------
A0A3B3VWI7_BCL2L1-      --------------tc-----------------------ctac-------
A0A1A8A2S0_BCL2L1-      --------------cc-----------------------acac-------
A0A672JL90_BCL2L1-      --------------tc-----------------------gtcc-------
A0A672Z262_BCL2L1-      --------------tc-----------------------gcac-------
A0A3Q3BEB7_BCL2L1-      --------------tc-----------------------acac-------
A0A0F7L1T6_BCL2L1-      --------------tc-----------------------gtat-------
H2U5I3_BCL2L1-01        --------------tc-----------------------gtat-------
A0A8C2ZH46_BCL2L1-      --------------tc-----------------------caac-------
G3P7B4_BCL2L1-01        --------------gc-----------------------gaac-------
A0A3Q3FUB6_BCL2L1-      --------------tc-----------------------atac-------
A0A3Q3X5M5_BCL2L1-      --------------tc-----------------------gcac-------
A0A665VSD7_BCL2L1-      --------------tc-----------------------gtac-------
A0A8D3CTR5_BCL2L1-      --------------tc-----------------------ggac-------
A0A3Q1JZ46_BCL2L1-      --------------tc-----------------------gaac-------
A0A3B5B4X7_BCL2L1-      --------------tc-----------------------gtac-------
A0A3Q1EVP6_BCL2L1-      --------------tc-----------------------gtgc-------
A0A6G7K5D7_BCL2L1-      --------------tc-----------------------gtac-------
A0A3Q1BQA0_BCL2L1-      --------------tc-----------------------gtac-------
A0A3P8U812_BCL2L1-      --------------tc-----------------------gtac-------
A0A3Q3NFM4_BCL2L1-      --------------tc-----------------------gtac-------
A0A4W6EST2_BCL2L1-      --------------tc-----------------------gtac-------
A0A3B4V9K8_BCL2L1-      --------------tc-----------------------gtac-------
A0A3B4XS24_BCL2L1-      --------------tc-----------------------gtac-------
A0A510BW31_BCL2L1-      --------------tc-----------------------gtac-------
A0A8D0AAQ8_BCL2L1-      --------------tt-----------------------gtac-------
A0A8C4IRU9_BCL2L1-      --------------tc-----------------------gtac-------
E6ZFR0_BCL2L1-01        --------------tc-----------------------gtac-------
                                                                          

R4JQR8_BCL2L1-01        --------aac---------------------cagtttagttcaagatat
A0A346RRN1_BCL2L1-      --------aac---------------------cagtacagttcacgttat
A0A8C4STP1_BCL2L1-      --------agcaa-------------------caaa-----------gag
A0A8C4XBF6_BCL2L1-      --------agcaa-------------------caga-----------gag
Q90ZH2_BCL2L1-01        --------agcag-------------------taga-----------gat
Q2TAP5_BCL2L1-01        --------agcag-------------------taga-----------gat
Q91828_BCL2L1-01        --------agcag-------------------taga-----------gat
A0A8C5WFB8_BCL2L1-      ------gtggaaa-------------------taag-----------aac
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        --------agtaa-------------------ccgg-----------gag
A0A7N4P3X2_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A7N4P3X2_BCL2L1-      --------agaa----------------------ga-----------gag
A0A8C5YLY6_BCL2L1-      ggacaggaaggaa-------------------cctg-----------gaa
A0A8D2IA38_BCL2L1-      gg------aggaa-------------------cctg-----------gaa
A0A8D2IA38_BCL2L1-      gg------aggaa-------------------cctg-----------gaa
G3SPN0_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
O35843_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
Q7TS62_BCL2L1-02        --------agcaa-------------------ccgg-----------gag
Q7TS62_BCL2L1-03        --------agcaa-------------------ccgg-----------gag
Q5HZH3_BCL2L1-02        --------agcaa-------------------ccgg-----------gag
A0A8C6G6C7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
Q7TS62_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A6I9LMY5_BCL2L1-      --------agcaa-------------------ccgg-----------gag
B2Z3Z4_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A8C6W748_BCL2L1-      --------agcaa-------------------ccgg-----------gag
H0X6V2_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A286Y5D6_BCL2L1-      --------agcaa-------------------ctgg-----------gag
A0A8D2AGI2_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A287CZ07_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8C9UNM3_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D2I760_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8C2YUU6_BCL2L1-      --------agcaa-------------------ctgg-----------gag
A0A8C2YUU6_BCL2L1-      --------agcaa-------------------ctgg-----------gag
A0A8C2YUU6_BCL2L1-      --------agcaa-------------------ctgg-----------gag
G1P9D2_BCL2L1-01        --------agcaa-------------------ccgg-----------gaa
A0A8C5NZI4_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A3Q2H0F6_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8B9XQH5_BCL2L1-      --------agtaa-------------------ccgg-----------gag
Q05KJ0_BCL2L1-01        --------agtaa-------------------ccgg-----------gag
Q05KJ0_BCL2L1-02        --------agtaa-------------------ccgg-----------gag
A0A8C6DX24_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A452FWV3_BCL2L1-      --------agcaa-------------------ccgg-----------gag
Q9MZS7_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A8C3WJH5_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D1ALD6_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A4X1SQU7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D0XF62_BCL2L1-      --------agcaa-------------------ccgg-----------gag
O77737_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A8D0J6V8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D0J6V8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D0J6V8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D0J6V8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D0J6V8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A4X1SQU7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A4X1SQU7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A4X1SQU7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A4X1SRM7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D0XF62_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D1ALD6_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A4X1SQU7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8C4L2X1_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A3Q2H0F6_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A250YD48_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A1L5BWY3_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8B7FNN3_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8B7FNN3_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8B7FNN3_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A8C8YN28_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8I3ZZI7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A5F7ZJK5_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K6UWY8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
E2IV77_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------agcaa-------------------ccgg-----------gag
E2IV75_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A6D2VXZ3_BCL2L1-      --------agcaa-------------------ccgg-----------gag
G1RER8_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A7I2V597_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2R8Z9D7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K5VPG2_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8I5MVB8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8D2ERY7_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K5VPG2_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A5F7ZJK5_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A5F7ZJK5_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A5F7ZJK5_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A5F7ZJK5_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A0D9RJZ8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K6QFA2_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A2K5YR37_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A5F5XYW0_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8C7BPR9_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A5F5XYW0_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8B8VBB9_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8C6F2V6_BCL2L1-      --------agcaa-------------------tcgg-----------gag
A0A8C9BM97_BCL2L1-      --------agcaa-------------------tcgg-----------gag
M3Z2H9_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A8C7BPR9_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A5F5XYW0_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8C0TGM4_BCL2L1-      --------agcaa-------------------ccgg-----------gag
Q76LT7_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
Q8SQ42_BCL2L1-01        --------agcaa-------------------ccgg-----------gag
A0A673UUI0_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A452SDS4_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A384D3U1_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8C9D5N1_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A8C9M2S8_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A667HK09_BCL2L1-      --------agcaa-------------------ccgg-----------gag
A0A3Q1LRT3_BCL2L1-      --------agcaa-------------------tcgg-----------gaa
A0A4W2D608_BCL2L1-      --------agcaa-------------------tcgg-----------gaa
A0A4W2D608_BCL2L1-      --------agcaa-------------------tcgg-----------gaa
A0A4W2F845_BCL2L1-      --------agcaa-------------------tcgg-----------gaa
A0A4W2F845_BCL2L1-      --------agcaa-------------------tcgg-----------gaa
A0A8B9WB42_BCL2L1-      --------agcaa-------------------tcgg-----------gaa
A0A8C6FN58_BCL2L1-      --------agcaa-------------------ctgg-----------gaa
A0A452E1B1_BCL2L1-      --------agcaa-------------------ccgg-----------gaa
W5PSA5_BCL2L1-01        --------agcaa-------------------ccgg-----------gaa
A0A8B9X9C2_BCL2L1-      gg---tatagcaa-------------------ccga-----------cgg
A0A452FHY1_BCL2L1-      --------agcaa-------------------ccga-----------gag
A0A452FHY1_BCL2L1-      --------agcaa-------------------ccga-----------gag
H3ANS8_BCL2L1-01        --------aa----------------------cagg-----------ttg
W5MG74_BCL2L1-01        --------agcaa-------------------caga-----------gac
H9GHK7_BCL2L1-01        --------agtaa-------------------ccga-----------gcg
A0A6I8PIR3_BCL2L1-      --------cggaa-------------------ctac-----------gac
A0A8D0HVA8_BCL2L1-      --------ggcaa-------------------ccga-----------gcg
A0A8D0HVA8_BCL2L1-      --------ggcaa-------------------ccga-----------gcg
A0A8D0HVA8_BCL2L1-      --------ggcaa-------------------ccga-----------gcg
A0A7M4EJG9_BCL2L1-      --------agcaa-------------------ccgg-----------gaa
A0A670IBZ4_BCL2L1-      --------aataa-------------------cagg-----------gcg
A0A8D0E1K1_BCL2L1-      --------gggaa-------------------ccgc-----------gcg
A0A8D2L5P2_BCL2L1-      --------agaaa-------------------cagg-----------gcg
A0A8C6V6T2_BCL2L1-      --------ggcaa-------------------ccgg-----------tcc
A0A8C5RX62_BCL2L1-      --------ggcaa-------------------ccgg-----------tcc
A0A670Z9Y4_BCL2L1-      --------ggcaa-------------------ccgg-----------tcc
A0A8C8S850_BCL2L1-      --------actaa-------------------cagg-----------gaa
K7F655_BCL2L1-01        --------actaa-------------------cagg-----------gaa
A0A8C0IVL6_BCL2L1-      --------actaa-------------------cagg-----------gaa
A0A8C4W8N7_BCL2L1-      --------acacagttctcaattggagctcctcaggagaggatataagaa
A0A8C3RIU8_BCL2L1-      --------actaa-------------------cagg-----------gaa
A0A8C3IUT0_BCL2L1-      --------actaa-------------------cagg-----------gag
A0A8C3IUT0_BCL2L1-      --------actaa-------------------cagg-----------gag
A0A8C3IUT0_BCL2L1-      --------actaa-------------------cagg-----------gag
A0A8C3IUT0_BCL2L1-      --------actaa-------------------cagg-----------gag
A0A674J5J7_BCL2L1-      --------actaa-------------------cagg-----------gaa
A0A8B9CUX0_BCL2L1-      --------agcaa-------------------ccgg-----------gac
A0A8B9DB39_BCL2L1-      --------agcaa-------------------ccgg-----------gac
A0A493TIA6_BCL2L1-      --------ggcaa-------------------ccgg-----------gag
A0A8C3CGW6_BCL2L1-      --------ggcaa-------------------ccgg-----------gag
A0A8B9SM69_BCL2L1-      --------ggcaa-------------------ccgg-----------gag
A0A8B9V5I0_BCL2L1-      --------ggcaa-------------------ccgg-----------gag
A0A8C7ECQ9_BCL2L1-      --------agtaa-------------------ccgg-----------gaa
A0A669P0Q7_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8C2T2M7_BCL2L1-      --------agtaa-------------------ccgg-----------gac
A0A8C9EN38_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8C3LRK6_BCL2L1-      --------agaaa-------------------ccgg-----------gag
G1N5N5_BCL2L1-01        --------agtaa-------------------ccgg-----------gag
A0A8B9NWH6_BCL2L1-      --------agtaa-------------------ccgg-----------gaa
A0A8B9NWH6_BCL2L1-      --------agtaa-------------------ccgg-----------gaa
A0A8C4JDK2_BCL2L1-      --------agtaa-------------------ccgg-----------gaa
A0A8C4JDK2_BCL2L1-      --------agtaa-------------------ccgg-----------gaa
A0A8C5JFI3_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8D2M680_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A803VLI1_BCL2L1-      --------agtaa-------------------tcgg-----------gag
A0A8C5U1E1_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8C3U3Q2_BCL2L1-      --------agtaa-------------------tcgg-----------gcg
A0A8C0U194_BCL2L1-      --------agtaa-------------------tcgg-----------gag
H0Z8G3_BCL2L1-01        --------agtaa-------------------ccgg-----------gag
Q4U2V6_BCL2L1-01        --------agtaa-------------------ccgg-----------gag
A0A8C9NN65_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8C3XCF2_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8D2NN48_BCL2L1-      --------agtaa-------------------ccgg-----------gmg
A0A8C0FL84_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8C0AYR5_BCL2L1-      --------agtaa-------------------tcgg-----------gag
A0A8C4TWS5_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8C3KQJ2_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8C8A4L8_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8D0FHG7_BCL2L1-      --------agtaa-------------------ccgg-----------gag
A0A8B9N2I0_BCL2L1-      --------agtaa-------------------tcgg-----------gag
A0A663ECL2_BCL2L1-      --------agtaa-------------------tcgg-----------gag
A0A8C0AYR5_BCL2L1-      --------agtaa-------------------tcgg-----------gag
A0A8B9FKI5_BCL2L1-      --------agcaa-------------------ccgg-----------gcg
A0A672UKR0_BCL2L1-      --------agcaa-------------------ccgg-----------gcg
A0A3B5K6B9_BCL2L1-      ----------aaa-------------------caga-----------gaa
H3CH49_BCL2L1-01        ----------aaa-------------------caga-----------gaa
A0A059PJI5_BCL2L1-      --------tacaa-------------------caga-----------gaa
A0A8C5B4N8_BCL2L1-      --------agtaa-------------------caga-----------gaa
D2ITA2_BCL2L1-02        --------agtaa-------------------caga-----------gaa
C1BLI0_BCL2L1-01        --------agtaa-------------------ccgt-----------gag
A0A3B3ZMX9_BCL2L1-      ----------caa-------------------caga-----------gaa
A0A3B3ZMX9_BCL2L1-      ----------caa-------------------caga-----------gaa
A0A667Y1V0_BCL2L1-      --------agtaa-------------------caga-----------gaa
A0A3P8XFS0_BCL2L1-      --------agtaa-------------------tagg-----------gaa
A0A3P8XFS0_BCL2L1-      --------agtaa-------------------tagg-----------gaa
A0A4W5LYF9_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A6F8ZUL6_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A674C4N2_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A8C7RD80_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A8C7CBC7_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A8C7CBC7_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A8C8GSY4_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A8C8GSY4_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A6F9CY91_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A060XE41_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A286MU87_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A8C8J941_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A8C7FX38_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A4W5JPK5_BCL2L1-      --------agtaa-------------------cagg-----------gaa
C0HAD8_BCL2L1-01        --------agtaa-------------------cagg-----------gaa
A0A673Z4J6_BCL2L1-      --------agtaa-------------------cagg-----------gaa
A0A3B3QRZ2_BCL2L1-      --------agcaa-------------------caga-----------gaa
A0A3P8UWG7_BCL2L1-      --------attaa-------------------caga-----------aaa
A0A345BSW9_BCL2L1-      --------tataa-------------------caga-----------gaa
B2GRK1_BCL2L1-01        --------tataa-------------------ccga-----------gaa
B2GRK1_BCL2L1-02        --------tataa-------------------ccga-----------gaa
Q90Z98_BCL2L1-01        --------tataa-------------------ccga-----------gaa
A0A672K8R2_BCL2L1-      --------tataa-------------------ccga-----------gaa
A0A8C1JXA4_BCL2L1-      --------tataa-------------------caga-----------gaa
A0A673M4N6_BCL2L1-      --------tatca-------------------ccaa-----------gaa
A0A673M4N6_BCL2L1-      --------tatca-------------------ccaa-----------gaa
A0A671QPE4_BCL2L1-      --------tataa-------------------ccga-----------gaa
A0A672N8N5_BCL2L1-      --------tataa-------------------ccga-----------gaa
A0A671K7W7_BCL2L1-      --------tataa-------------------ccga-----------gaa
A0A671K7W7_BCL2L1-      --------tataa-------------------ccga-----------gaa
A0A673IGS5_BCL2L1-      --------tatca-------------------ccaa-----------gaa
A0A8C5D4L1_BCL2L1-      --------gtcaa-------------------caga-----------gaa
A0A8C5D4L1_BCL2L1-      --------gtcaa-------------------caga-----------gaa
A0A8C5D4L1_BCL2L1-      --------gtcaa-------------------caga-----------gaa
A0A4W4GHX3_BCL2L1-      --------tacaa-------------------caga-----------gaa
A0A3B4DTL9_BCL2L1-      --------tacaa-------------------caga-----------gaa
A0A3B1JJ42_BCL2L1-      --------tataa-------------------ccga-----------gaa
A0A8B9LKW7_BCL2L1-      --------tataa-------------------ccga-----------gaa
A0A8C9SVL8_BCL2L1-      --------agcaa-------------------cagg-----------gaa
A0A8C4CMF6_BCL2L1-      --------agcaa-------------------caga-----------gag
A0A3B3TFR4_BCL2L1-      --------agcaa-------------------tagg-----------gag
A0A3P8XYL5_BCL2L1-      --------aacaa-------------------caaa-----------gaa
A0A6F9B188_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A4W5R2W6_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A4W5R2W6_BCL2L1-      --------attaa-------------------ccta--------cctgaa
A0A674C578_BCL2L1-      --------attaa-------------------ccta--------tctgaa
A0A674C578_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A8C7IJ10_BCL2L1-      --------attaa-------------------ccta--------cctgaa
A0A8C8D057_BCL2L1-      --------attaa-------------------ccta--------cctgaa
A0A8C7P574_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A8C7IJ10_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A8C8D057_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A6F9BJ02_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A4W5NQ40_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A8C7UB69_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A8C7J9N8_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A8C8FJG7_BCL2L1-      --------aacaa-------------------caga-----------gaa
B5XAY3_BCL2L1-01        --------aacaa-------------------caga-----------gaa
A0A674C337_BCL2L1-      --------aacaa-------------------caga-----------gaa
A0A8C9SET9_BCL2L1-      --------agcaa-------------------caga-----------gag
A0A8C5G971_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A8C5FC81_BCL2L1-      ----------gaa-------------------ccgc-----------gag
A0A665VM40_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q3WIW8_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3B5PQJ0_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3P9N9Y4_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3B3WI27_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A087X9B7_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3B3TUS7_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q2FR43_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A3Q3B3X5_BCL2L1-      ----------aaa-------------------caaa-----------gaa
A0A667ZHE8_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q3G2E1_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q3G2E1_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q3G2E1_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q3MX20_BCL2L1-      ----------aaa-------------------cagg-----------gaa
A0A0D6DR75_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q1GZ93_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A4W6BQD5_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3B4V3T1_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3B4XU17_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A673BZP5_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A671WXV0_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A219P0Y3_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A8C9WU15_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A1A7ZDF6_BCL2L1-      ----------aaa-------------------ccaa-----------gaa
A0A8F0MQ26_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A672IDC1_BCL2L1-      ----------gaa-------------------ccgg-----------gag
A0A672IDC1_BCL2L1-      ----------gaa-------------------ccgg-----------gag
A0A3Q0RTF8_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A668RI12_BCL2L1-      ----------aaa-------------------caga-----------gaa
I3IZK7_BCL2L1-01        ----------aaa-------------------caga-----------gaa
A0A3Q4N4B5_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q2X557_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3P8P0F1_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3P9D632_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3P9D632_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3B4FNX1_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A8C2ZZ68_BCL2L1-      ----------aaa-------------------caga-----------gag
G3NJY1_BCL2L1-01        ----------aaa-------------------caga-----------gaa
A0A3B3DHA1_BCL2L1-      ----------caa-------------------caga-----------gaa
A0A3P9JYH1_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A3B3IB64_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A8C7YJI1_BCL2L1-      ----------gaa-------------------caga-----------gaa
C3VIT1_BCL2L1-01        ----------aaa-------------------caga-----------gaa
A0A3B4Z3X2_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3B4Z3X2_BCL2L1-      ----------aaa-------------------caga-----------gaa
A0A3Q1FR00_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A3Q1FR00_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A3Q1DHJ3_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A3Q1DHJ3_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A3Q1DHJ3_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A3P8TL99_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A3P8TL99_BCL2L1-      ----------gaa-------------------caga-----------gaa
A0A8C6UPI9_BCL2L1-      --------agtaa-------------------tcga-----------gag
A0A3B4BFZ8_BCL2L1-      --------agtaa-------------------ccga-----------gag
A0A3B3E2W4_BCL2L1-      --------tgtaa-------------------ccga-----------gag
A0A3P9MKK4_BCL2L1-      --------tgtaa-------------------caga-----------gag
A0A3P9MKK4_BCL2L1-      --------tggaa-------------------gaaa-----------tca
A0A3B3I2Q5_BCL2L1-      --------tgtaa-------------------caga-----------gag
A0A3B3I2Q5_BCL2L1-      --------tggaa-------------------gaaa-----------tca
A0A3P9I2N4_BCL2L1-      --------tgtaa-------------------cagg-----------gag
A0A3P9I2N4_BCL2L1-      --------tggaa-------------------gaaa-----------tca
A0A8C7XSQ2_BCL2L1-      --------tgtaa-------------------caga-----------gag
A0A8C7XSQ2_BCL2L1-      --------tggaa-------------------gaaa-----------tca
A0A3P8VMA1_BCL2L1-      --------agtaa-------------------caga-----------gaa
A0A3Q2C6K4_BCL2L1-      --------agtaa-------------------caga-----------gaa
A0A3B5MGS2_BCL2L1-      --------agcaa-------------------caga-----------gaa
M4A558_BCL2L1-01        --------agcaa-------------------caga-----------gaa
A0A3P9QFB3_BCL2L1-      --------agcaa-------------------caga-----------gaa
A0A3B3XN57_BCL2L1-      --------agcaa-------------------caga-----------gaa
A0A087YBW4_BCL2L1-      --------agcaa-------------------caga-----------gaa
A0A3B3VWI7_BCL2L1-      --------agcaa-------------------caga-----------gaa
A0A1A8A2S0_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A672JL90_BCL2L1-      --------agcaa-------------------ccga-----------gag
A0A672Z262_BCL2L1-      --------agtaa-------------------cagg-----------gag
A0A3Q3BEB7_BCL2L1-      --------agcaa-------------------caga-----------gat
A0A0F7L1T6_BCL2L1-      --------aacaa-------------------caga-----------gag
H2U5I3_BCL2L1-01        --------aacaa-------------------caga-----------gag
A0A8C2ZH46_BCL2L1-      --------atcaa-------------------caga-----------gag
G3P7B4_BCL2L1-01        --------attaa-------------------cagg-----------gag
A0A3Q3FUB6_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A3Q3X5M5_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A665VSD7_BCL2L1-      --------agcaa-------------------caga-----------gag
A0A8D3CTR5_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A3Q1JZ46_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A3B5B4X7_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A3Q1EVP6_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A6G7K5D7_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A3Q1BQA0_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A3P8U812_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A3Q3NFM4_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A4W6EST2_BCL2L1-      --------agcaa-------------------caga-----------gag
A0A3B4V9K8_BCL2L1-      --------agcaa-------------------caga-----------gag
A0A3B4XS24_BCL2L1-      --------agcaa-------------------caga-----------gag
A0A510BW31_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A8D0AAQ8_BCL2L1-      --------agtaa-------------------caga-----------gag
A0A8C4IRU9_BCL2L1-      --------agtaa-------------------caga-----------gag
E6ZFR0_BCL2L1-01        --------agtaa-------------------caga-----------gag
                                                                          

R4JQR8_BCL2L1-01        ttag--------tggcag--------------------------------
A0A346RRN1_BCL2L1-      ttag--------tggtcg--------------------------------
A0A8C4STP1_BCL2L1-      ctag--------ttgaag--------------------------------
A0A8C4XBF6_BCL2L1-      cttg--------ttgaag--------------------------------
Q90ZH2_BCL2L1-01        ctgg--------tggaga--------------------------------
Q2TAP5_BCL2L1-01        ctgg--------tggaga--------------------------------
Q91828_BCL2L1-01        ctgg--------tggaga--------------------------------
A0A8C5WFB8_BCL2L1-      ctcg--------tgcaaa--------------------------------
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        ctgg--------tgattg--------------------------------
A0A7N4P3X2_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7N4P3X2_BCL2L1-      ctgt--------caagca--------------------------------
A0A8C5YLY6_BCL2L1-      ctag--------tgatgg--------------------------------
A0A8D2IA38_BCL2L1-      ctag--------tgatcg--------------------------------
A0A8D2IA38_BCL2L1-      ctag--------tgatcg--------------------------------
G3SPN0_BCL2L1-01        ctgg--------tggttg--------------------------------
O35843_BCL2L1-01        ctgg--------tggtcg--------------------------------
Q7TS62_BCL2L1-02        ctgg--------tggttg--------------------------------
Q7TS62_BCL2L1-03        ctgg--------tggttg--------------------------------
Q5HZH3_BCL2L1-02        ctgg--------tggtcg--------------------------------
A0A8C6G6C7_BCL2L1-      ctgg--------tggtcg--------------------------------
Q7TS62_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A6I9LMY5_BCL2L1-      ctgg--------tggttg--------------------------------
B2Z3Z4_BCL2L1-01        ctag--------tggttg--------------------------------
A0A8C6W748_BCL2L1-      ctgg--------tggttg--------------------------------
H0X6V2_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A286Y5D6_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D2AGI2_BCL2L1-      ctgg--------tggttg--------------------------------
A0A287CZ07_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C9UNM3_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D2I760_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C2YUU6_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C2YUU6_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C2YUU6_BCL2L1-      ctgg--------tggttg--------------------------------
G1P9D2_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A8C5NZI4_BCL2L1-      ctgg--------tggttg--------------------------------
A0A3Q2H0F6_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8B9XQH5_BCL2L1-      ctgg--------tggttg--------------------------------
Q05KJ0_BCL2L1-01        ctgg--------tggttg--------------------------------
Q05KJ0_BCL2L1-02        ctgg--------tggttg--------------------------------
A0A8C6DX24_BCL2L1-      ctgg--------tggttg--------------------------------
A0A452FWV3_BCL2L1-      ctgg--------tggttg--------------------------------
Q9MZS7_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A8C3WJH5_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D1ALD6_BCL2L1-      ctgg--------tggttg--------------------------------
A0A4X1SQU7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D0XF62_BCL2L1-      ctgg--------tggttg--------------------------------
O77737_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A8D0J6V8_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D0J6V8_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D0J6V8_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D0J6V8_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D0J6V8_BCL2L1-      ctgg--------tggttg--------------------------------
A0A4X1SQU7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A4X1SQU7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A4X1SQU7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A4X1SRM7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D0XF62_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D1ALD6_BCL2L1-      ctgg--------tggttg--------------------------------
A0A4X1SQU7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C4L2X1_BCL2L1-      ctgg--------tggttg--------------------------------
A0A3Q2H0F6_BCL2L1-      ctgg--------tggttg--------------------------------
A0A250YD48_BCL2L1-      ctgg--------tggttg--------------------------------
A0A1L5BWY3_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8B7FNN3_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8B7FNN3_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8B7FNN3_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A8C8YN28_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8I3ZZI7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A5F7ZJK5_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2K6UWY8_BCL2L1-      ctgg--------tggttg--------------------------------
E2IV77_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ctgg--------tggttg--------------------------------
E2IV75_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A6D2VXZ3_BCL2L1-      ctgg--------tggttg--------------------------------
G1RER8_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A7I2V597_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2R8Z9D7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ctag--------tggttg--------------------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      ctag--------tggttg--------------------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2K5VPG2_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8I5MVB8_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8D2ERY7_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2K5VPG2_BCL2L1-      ctgg--------tggttg--------------------------------
A0A5F7ZJK5_BCL2L1-      ctgg--------tggttg--------------------------------
A0A5F7ZJK5_BCL2L1-      ctgg--------tggttg--------------------------------
A0A5F7ZJK5_BCL2L1-      ctgg--------tggttg--------------------------------
A0A5F7ZJK5_BCL2L1-      ctgg--------tggttg--------------------------------
A0A0D9RJZ8_BCL2L1-      ctgg--------tggttg--------------------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2K6QFA2_BCL2L1-      ctgg--------tggttg--------------------------------
A0A2K5YR37_BCL2L1-      ctgg--------tggttg--------------------------------
A0A5F5XYW0_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C7BPR9_BCL2L1-      ctgg--------tggttg--------------------------------
A0A5F5XYW0_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8B8VBB9_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C6F2V6_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C9BM97_BCL2L1-      ctgg--------tggttg--------------------------------
M3Z2H9_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A8C7BPR9_BCL2L1-      ctgg--------tggttg--------------------------------
A0A5F5XYW0_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C0TGM4_BCL2L1-      ctgg--------tggttg--------------------------------
Q76LT7_BCL2L1-01        ctgg--------tggttg--------------------------------
Q8SQ42_BCL2L1-01        ctgg--------tggttg--------------------------------
A0A673UUI0_BCL2L1-      ctgg--------tggtcg--------------------------------
A0A452SDS4_BCL2L1-      ctgg--------tggttg--------------------------------
A0A384D3U1_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C9D5N1_BCL2L1-      ctgg--------tggttg--------------------------------
A0A8C9M2S8_BCL2L1-      ctgg--------tggttg--------------------------------
A0A667HK09_BCL2L1-      ctgg--------tggttg--------------------------------
A0A3Q1LRT3_BCL2L1-      ctag--------tggttg--------------------------------
A0A4W2D608_BCL2L1-      ctag--------tggttg--------------------------------
A0A4W2D608_BCL2L1-      ctag--------tggttg--------------------------------
A0A4W2F845_BCL2L1-      ctag--------tggttg--------------------------------
A0A4W2F845_BCL2L1-      ctag--------tggttg--------------------------------
A0A8B9WB42_BCL2L1-      ctag--------tggttg--------------------------------
A0A8C6FN58_BCL2L1-      ctag--------tggttg--------------------------------
A0A452E1B1_BCL2L1-      ctag--------tggttg--------------------------------
W5PSA5_BCL2L1-01        ctag--------tggttg--------------------------------
A0A8B9X9C2_BCL2L1-      ctgg--------tggttg--------------------------------
A0A452FHY1_BCL2L1-      ctgg--------tggttg--------------------------------
A0A452FHY1_BCL2L1-      ctgg--------tggttg--------------------------------
H3ANS8_BCL2L1-01        ctgg--------tggtgg--------------------------------
W5MG74_BCL2L1-01        ctcg--------tcgtct--------------------------------
H9GHK7_BCL2L1-01        ctcg--------tggtgg--------------------------------
A0A6I8PIR3_BCL2L1-      ctgg--------tgagag--------------------------------
A0A8D0HVA8_BCL2L1-      ctag--------tcgttg--------------------------------
A0A8D0HVA8_BCL2L1-      ctag--------tcgttg--------------------------------
A0A8D0HVA8_BCL2L1-      ctag--------tcgttg--------------------------------
A0A7M4EJG9_BCL2L1-      ttag--------tgattg--------------------------------
A0A670IBZ4_BCL2L1-      ctcg--------tggtag--------------------------------
A0A8D0E1K1_BCL2L1-      ctcg--------tcatag--------------------------------
A0A8D2L5P2_BCL2L1-      cttg--------tgacag--------------------------------
A0A8C6V6T2_BCL2L1-      ctgg--------tggtgg--------------------------------
A0A8C5RX62_BCL2L1-      ctgg--------tggtgg--------------------------------
A0A670Z9Y4_BCL2L1-      ctgg--------tggtgg--------------------------------
A0A8C8S850_BCL2L1-      ttag--------tgattg--------------------------------
K7F655_BCL2L1-01        ttag--------tgattg--------------------------------
A0A8C0IVL6_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C4W8N7_BCL2L1-      ctagcccaagcctgtttgctttcagaagctggtccgataggggcggtgaa
A0A8C3RIU8_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C3IUT0_BCL2L1-      ttag--------tgactg--------------------------------
A0A8C3IUT0_BCL2L1-      ttag--------tgactg--------------------------------
A0A8C3IUT0_BCL2L1-      ttag--------tgactg--------------------------------
A0A8C3IUT0_BCL2L1-      ttag--------tgactg--------------------------------
A0A674J5J7_BCL2L1-      ttag--------tgactg--------------------------------
A0A8B9CUX0_BCL2L1-      ctgg--------tgattg--------------------------------
A0A8B9DB39_BCL2L1-      ctgg--------tgattg--------------------------------
A0A493TIA6_BCL2L1-      ctgg--------tgatcg--------------------------------
A0A8C3CGW6_BCL2L1-      ctgg--------tgatcg--------------------------------
A0A8B9SM69_BCL2L1-      ctgg--------tgatcg--------------------------------
A0A8B9V5I0_BCL2L1-      ctgg--------tgatcg--------------------------------
A0A8C7ECQ9_BCL2L1-      ttag--------tgattg--------------------------------
A0A669P0Q7_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C2T2M7_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C9EN38_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C3LRK6_BCL2L1-      ttag--------tgattg--------------------------------
G1N5N5_BCL2L1-01        ttag--------tgattg--------------------------------
A0A8B9NWH6_BCL2L1-      ttag--------tgattg--------------------------------
A0A8B9NWH6_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C4JDK2_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C4JDK2_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C5JFI3_BCL2L1-      ttag--------tgattg--------------------------------
A0A8D2M680_BCL2L1-      ttag--------tgattg--------------------------------
A0A803VLI1_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C5U1E1_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C3U3Q2_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C0U194_BCL2L1-      ttag--------tgattg--------------------------------
H0Z8G3_BCL2L1-01        ttag--------tgattg--------------------------------
Q4U2V6_BCL2L1-01        ttag--------tgattg--------------------------------
A0A8C9NN65_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C3XCF2_BCL2L1-      ttag--------tgattg--------------------------------
A0A8D2NN48_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C0FL84_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C0AYR5_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C4TWS5_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C3KQJ2_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C8A4L8_BCL2L1-      ttag--------tgattg--------------------------------
A0A8D0FHG7_BCL2L1-      ttag--------tgattg--------------------------------
A0A8B9N2I0_BCL2L1-      ttag--------tgattg--------------------------------
A0A663ECL2_BCL2L1-      ttag--------tgattg--------------------------------
A0A8C0AYR5_BCL2L1-      ttag--------tgattg--------------------------------
A0A8B9FKI5_BCL2L1-      ttag--------tgattg--------------------------------
A0A672UKR0_BCL2L1-      ttag--------tgattg--------------------------------
A0A3B5K6B9_BCL2L1-      ctgg--------tcattt--------------------------------
H3CH49_BCL2L1-01        ctgg--------tcattt--------------------------------
A0A059PJI5_BCL2L1-      cttg--------tcgtgt--------------------------------
A0A8C5B4N8_BCL2L1-      ctgg--------tgttct--------------------------------
D2ITA2_BCL2L1-02        ctgg--------tgttct--------------------------------
C1BLI0_BCL2L1-01        ctgg--------tggtgt--------------------------------
A0A3B3ZMX9_BCL2L1-      ctgg--------tggaat--------------------------------
A0A3B3ZMX9_BCL2L1-      ctgg--------tggaat--------------------------------
A0A667Y1V0_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3P8XFS0_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A3P8XFS0_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A4W5LYF9_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A6F8ZUL6_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A674C4N2_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A8C7RD80_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A8C7CBC7_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A8C7CBC7_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A8C8GSY4_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A8C8GSY4_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A6F9CY91_BCL2L1-      ctgg--------tagtgt--------------------------------
A0A060XE41_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A286MU87_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A8C8J941_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A8C7FX38_BCL2L1-      ctgg--------tagtgt--------------------------------
A0A4W5JPK5_BCL2L1-      ctgg--------tggtgt--------------------------------
C0HAD8_BCL2L1-01        ctgg--------tggtgt--------------------------------
A0A673Z4J6_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A3B3QRZ2_BCL2L1-      ctgg--------tgatgg--------------------------------
A0A3P8UWG7_BCL2L1-      ctgg--------tggtcg--------------------------------
A0A345BSW9_BCL2L1-      ctag--------tggtat--------------------------------
B2GRK1_BCL2L1-01        ctgg--------tggtat--------------------------------
B2GRK1_BCL2L1-02        ctgg--------tggtat--------------------------------
Q90Z98_BCL2L1-01        ctgg--------tggtat--------------------------------
A0A672K8R2_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C1JXA4_BCL2L1-      ctgg--------tggtat--------------------------------
A0A673M4N6_BCL2L1-      ctgg--------tggtat--------------------------------
A0A673M4N6_BCL2L1-      ctgg--------tggtat--------------------------------
A0A671QPE4_BCL2L1-      ctgg--------tggtat--------------------------------
A0A672N8N5_BCL2L1-      ctgg--------tggtat--------------------------------
A0A671K7W7_BCL2L1-      ctgg--------tggtat--------------------------------
A0A671K7W7_BCL2L1-      ctgg--------tggtat--------------------------------
A0A673IGS5_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C5D4L1_BCL2L1-      cttg--------tgaagt--------------------------------
A0A8C5D4L1_BCL2L1-      cttg--------tgaagt--------------------------------
A0A8C5D4L1_BCL2L1-      cttg--------tgaagt--------------------------------
A0A4W4GHX3_BCL2L1-      ctgg--------tcatgt--------------------------------
A0A3B4DTL9_BCL2L1-      ctgg--------ttgtgt--------------------------------
A0A3B1JJ42_BCL2L1-      ttag--------tggtgt--------------------------------
A0A8B9LKW7_BCL2L1-      ttag--------tggtgt--------------------------------
A0A8C9SVL8_BCL2L1-      ctgg--------tgaagt--------------------------------
A0A8C4CMF6_BCL2L1-      ctgg--------ttgtgt--------------------------------
A0A3B3TFR4_BCL2L1-      ctgg--------tagagt--------------------------------
A0A3P8XYL5_BCL2L1-      ctgg--------tggcat--------------------------------
A0A6F9B188_BCL2L1-      ctgg--------tggttt--------------------------------
A0A4W5R2W6_BCL2L1-      ctgg--------tggtat--------------------------------
A0A4W5R2W6_BCL2L1-      ctgg--------tggtat--------------------------------
A0A674C578_BCL2L1-      ctgg--------tggtat--------------------------------
A0A674C578_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C7IJ10_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C8D057_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C7P574_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C7IJ10_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C8D057_BCL2L1-      ctgg--------tggtat--------------------------------
A0A6F9BJ02_BCL2L1-      ctgg--------tggaat--------------------------------
A0A4W5NQ40_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C7UB69_BCL2L1-      ctag--------tggtat--------------------------------
A0A8C7J9N8_BCL2L1-      ctgg--------tggtat--------------------------------
A0A8C8FJG7_BCL2L1-      ctgg--------tggtat--------------------------------
B5XAY3_BCL2L1-01        ctgg--------tggtgt--------------------------------
A0A674C337_BCL2L1-      ctgg--------tggtgt--------------------------------
A0A8C9SET9_BCL2L1-      ctgg--------tggagt--------------------------------
A0A8C5G971_BCL2L1-      ctgg--------ttgtgt--------------------------------
A0A8C5FC81_BCL2L1-      ctgg--------tgctgt--------------------------------
A0A665VM40_BCL2L1-      ctgg--------ttgttt--------------------------------
A0A3Q3WIW8_BCL2L1-      ctgg--------tggctt--------------------------------
A0A3B5PQJ0_BCL2L1-      ctgg--------tgcttt--------------------------------
A0A3P9N9Y4_BCL2L1-      ctgg--------tgcttt--------------------------------
A0A3B3WI27_BCL2L1-      ctgg--------tgcttt--------------------------------
A0A087X9B7_BCL2L1-      ctgg--------tgcttt--------------------------------
A0A3B3TUS7_BCL2L1-      ctag--------tgcttt--------------------------------
A0A3Q2FR43_BCL2L1-      ctgg--------tccttt--------------------------------
A0A3Q3B3X5_BCL2L1-      ctgg--------tgcttt--------------------------------
A0A667ZHE8_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3Q3G2E1_BCL2L1-      ctag--------tggttt--------------------------------
A0A3Q3G2E1_BCL2L1-      ctag--------tggttt--------------------------------
A0A3Q3G2E1_BCL2L1-      ctag--------tggttt--------------------------------
A0A3Q3MX20_BCL2L1-      ctgg--------tggttt--------------------------------
A0A0D6DR75_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3Q1GZ93_BCL2L1-      ctgg--------tggttt--------------------------------
A0A4W6BQD5_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3B4V3T1_BCL2L1-      ctgg--------tcgttt--------------------------------
A0A3B4XU17_BCL2L1-      ctgg--------tcgttt--------------------------------
A0A673BZP5_BCL2L1-      ctgg--------tggttt--------------------------------
A0A671WXV0_BCL2L1-      ctgg--------tggttt--------------------------------
A0A219P0Y3_BCL2L1-      ctgg--------tggttt--------------------------------
A0A8C9WU15_BCL2L1-      ctgg--------tggctt--------------------------------
A0A1A7ZDF6_BCL2L1-      ctag--------ttcttt--------------------------------
A0A8F0MQ26_BCL2L1-      ctgg--------tgattt--------------------------------
A0A672IDC1_BCL2L1-      ctgg--------tcgttt--------------------------------
A0A672IDC1_BCL2L1-      ctgg--------tcgttt--------------------------------
A0A3Q0RTF8_BCL2L1-      ctgg--------tgcttt--------------------------------
A0A668RI12_BCL2L1-      ctgg--------tgcttt--------------------------------
I3IZK7_BCL2L1-01        ctgg--------tgcttt--------------------------------
A0A3Q4N4B5_BCL2L1-      cttg--------tgcttt--------------------------------
A0A3Q2X557_BCL2L1-      cttg--------tgcttt--------------------------------
A0A3P8P0F1_BCL2L1-      cttg--------tgcttt--------------------------------
A0A3P9D632_BCL2L1-      cttg--------tgcttt--------------------------------
A0A3P9D632_BCL2L1-      cttg--------tgcttt--------------------------------
A0A3B4FNX1_BCL2L1-      cttg--------tgcttt--------------------------------
A0A8C2ZZ68_BCL2L1-      ctgg--------tggtct--------------------------------
G3NJY1_BCL2L1-01        ctgg--------tggttt--------------------------------
A0A3B3DHA1_BCL2L1-      ctgg--------ttgttt--------------------------------
A0A3P9JYH1_BCL2L1-      ctgg--------ttgttt--------------------------------
A0A3B3IB64_BCL2L1-      ctgg--------ttgttt--------------------------------
A0A8C7YJI1_BCL2L1-      ctgg--------ttgttt--------------------------------
C3VIT1_BCL2L1-01        ctgg--------tggttt--------------------------------
A0A3B4Z3X2_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3B4Z3X2_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3Q1FR00_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3Q1FR00_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3Q1DHJ3_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3Q1DHJ3_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3Q1DHJ3_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3P8TL99_BCL2L1-      ctgg--------tggttt--------------------------------
A0A3P8TL99_BCL2L1-      ctgg--------tggttt--------------------------------
A0A8C6UPI9_BCL2L1-      ctgg--------ttgagt--------------------------------
A0A3B4BFZ8_BCL2L1-      ctgg--------ttgaat--------------------------------
A0A3B3E2W4_BCL2L1-      ctgg--------tgcagt--------------------------------
A0A3P9MKK4_BCL2L1-      ctgg--------tccggt--------------------------------
A0A3P9MKK4_BCL2L1-      tgg-----------------------------------------------
A0A3B3I2Q5_BCL2L1-      ctgg--------tccggt--------------------------------
A0A3B3I2Q5_BCL2L1-      tgg-----------------------------------------------
A0A3P9I2N4_BCL2L1-      ctgg--------ttcggt--------------------------------
A0A3P9I2N4_BCL2L1-      tgg-----------------------------------------------
A0A8C7XSQ2_BCL2L1-      ctgg--------ttcggt--------------------------------
A0A8C7XSQ2_BCL2L1-      tgg-----------------------------------------------
A0A3P8VMA1_BCL2L1-      ttgg--------ttaagt--------------------------------
A0A3Q2C6K4_BCL2L1-      ctgg--------tagagt--------------------------------
A0A3B5MGS2_BCL2L1-      ctgg--------tggagt--------------------------------
M4A558_BCL2L1-01        ctgg--------tggagt--------------------------------
A0A3P9QFB3_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3B3XN57_BCL2L1-      ctgg--------tggagt--------------------------------
A0A087YBW4_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3B3VWI7_BCL2L1-      ctgg--------tggagt--------------------------------
A0A1A8A2S0_BCL2L1-      ctgg--------tggagt--------------------------------
A0A672JL90_BCL2L1-      ctgg--------tggagt--------------------------------
A0A672Z262_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3Q3BEB7_BCL2L1-      ctgg--------tgcagt--------------------------------
A0A0F7L1T6_BCL2L1-      ctgg--------tggagc--------------------------------
H2U5I3_BCL2L1-01        ctgg--------tggagc--------------------------------
A0A8C2ZH46_BCL2L1-      ctgg--------tggagt--------------------------------
G3P7B4_BCL2L1-01        ctgg--------tggagt--------------------------------
A0A3Q3FUB6_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3Q3X5M5_BCL2L1-      ctgg--------tggagt--------------------------------
A0A665VSD7_BCL2L1-      ctgg--------tggagt--------------------------------
A0A8D3CTR5_BCL2L1-      ctgg--------tcgagt--------------------------------
A0A3Q1JZ46_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3B5B4X7_BCL2L1-      ctag--------tggagt--------------------------------
A0A3Q1EVP6_BCL2L1-      ctgg--------tggagt--------------------------------
A0A6G7K5D7_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3Q1BQA0_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3P8U812_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3Q3NFM4_BCL2L1-      ctgg--------tggagt--------------------------------
A0A4W6EST2_BCL2L1-      ctag--------tggagt--------------------------------
A0A3B4V9K8_BCL2L1-      ctgg--------tggagt--------------------------------
A0A3B4XS24_BCL2L1-      ctgg--------tggagt--------------------------------
A0A510BW31_BCL2L1-      ctgg--------tggagt--------------------------------
A0A8D0AAQ8_BCL2L1-      ctgg--------tggagt--------------------------------
A0A8C4IRU9_BCL2L1-      ctgg--------tggagt--------------------------------
E6ZFR0_BCL2L1-01        ctgg--------tggagt--------------------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------actttat-----------------------
A0A346RRN1_BCL2L1-      --------------------attttgt-----------------------
A0A8C4STP1_BCL2L1-      --------------------attttataag--------------------
A0A8C4XBF6_BCL2L1-      --------------------attttatcag--------------------
Q90ZH2_BCL2L1-01        --------------------agtttgttag--------------------
Q2TAP5_BCL2L1-01        --------------------agtttgttag--------------------
Q91828_BCL2L1-01        --------------------agtttgttag--------------------
A0A8C5WFB8_BCL2L1-      --------------------attttgtatg--------------------
A0A4X2KZ04_BCL2L1-      ----------------------------cc--------------------
F6WA14_BCL2L1-01        --------------------actttctttc--------------------
A0A7N4P3X2_BCL2L1-      --------------------actttctttc--------------------
A0A7N4P3X2_BCL2L1-      --------------------gatcccagac--------------------
A0A8C5YLY6_BCL2L1-      --------------------actttctgtc--------------------
A0A8D2IA38_BCL2L1-      --------------------actttctgtc--------------------
A0A8D2IA38_BCL2L1-      --------------------actttctgtc--------------------
G3SPN0_BCL2L1-01        --------------------actttctctc--------------------
O35843_BCL2L1-01        --------------------actttctctc--------------------
Q7TS62_BCL2L1-02        --------------------actttctctc--------------------
Q7TS62_BCL2L1-03        --------------------actttctctc--------------------
Q5HZH3_BCL2L1-02        --------------------actttctctc--------------------
A0A8C6G6C7_BCL2L1-      --------------------actttctctc--------------------
Q7TS62_BCL2L1-01        --------------------actttctctc--------------------
A0A6I9LMY5_BCL2L1-      --------------------actttctctc--------------------
B2Z3Z4_BCL2L1-01        --------------------actttctctc--------------------
A0A8C6W748_BCL2L1-      --------------------actttctctc--------------------
H0X6V2_BCL2L1-01        --------------------actttatctc--------------------
A0A286Y5D6_BCL2L1-      --------------------actttctctc--------------------
A0A8D2AGI2_BCL2L1-      --------------------actttctctc--------------------
A0A287CZ07_BCL2L1-      --------------------actttctctc--------------------
A0A8C9UNM3_BCL2L1-      --------------------actttctctc--------------------
A0A8D2I760_BCL2L1-      --------------------actttctctc--------------------
A0A8C2YUU6_BCL2L1-      --------------------actttctctc--------------------
A0A8C2YUU6_BCL2L1-      --------------------actttctctc--------------------
A0A8C2YUU6_BCL2L1-      --------------------actttctctc--------------------
G1P9D2_BCL2L1-01        --------------------actttctctc--------------------
A0A8C5NZI4_BCL2L1-      --------------------actttctcac--------------------
A0A3Q2H0F6_BCL2L1-      --------------------actttctctc--------------------
A0A8B9XQH5_BCL2L1-      --------------------actttctctc--------------------
Q05KJ0_BCL2L1-01        --------------------actttctctc--------------------
Q05KJ0_BCL2L1-02        --------------------actttctctc--------------------
A0A8C6DX24_BCL2L1-      --------------------actttctctc--------------------
A0A452FWV3_BCL2L1-      --------------------actttctctc--------------------
Q9MZS7_BCL2L1-01        --------------------actttctctc--------------------
A0A8C3WJH5_BCL2L1-      --------------------actttctctc--------------------
A0A8D1ALD6_BCL2L1-      --------------------actttctctc--------------------
A0A4X1SQU7_BCL2L1-      --------------------actttctctc--------------------
A0A8D0XF62_BCL2L1-      --------------------actttctctc--------------------
O77737_BCL2L1-01        --------------------actttctctc--------------------
A0A8D0J6V8_BCL2L1-      --------------------actttctctc--------------------
A0A8D0J6V8_BCL2L1-      --------------------actttctctc--------------------
A0A8D0J6V8_BCL2L1-      --------------------actttctctc--------------------
A0A8D0J6V8_BCL2L1-      --------------------actttctctc--------------------
A0A8D0J6V8_BCL2L1-      --------------------actttctctc--------------------
A0A4X1SQU7_BCL2L1-      --------------------actttctctc--------------------
A0A4X1SQU7_BCL2L1-      --------------------actttctctc--------------------
A0A4X1SQU7_BCL2L1-      --------------------actttctctc--------------------
A0A4X1SRM7_BCL2L1-      --------------------actttctctc--------------------
A0A8D0XF62_BCL2L1-      --------------------actttctctc--------------------
A0A8D1ALD6_BCL2L1-      --------------------actttctctc--------------------
A0A4X1SQU7_BCL2L1-      --------------------actttctctc--------------------
A0A8C4L2X1_BCL2L1-      --------------------actttctctc--------------------
A0A3Q2H0F6_BCL2L1-      --------------------actttctctc--------------------
A0A250YD48_BCL2L1-      --------------------actttctctc--------------------
A0A1L5BWY3_BCL2L1-      --------------------actttctctc--------------------
A0A8B7FNN3_BCL2L1-      --------------------actttctctc--------------------
A0A8B7FNN3_BCL2L1-      --------------------actttctctc--------------------
A0A8B7FNN3_BCL2L1-      --------------------actttctctc--------------------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --------------------actttctctc--------------------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --------------------actttctctc--------------------
A0A8C8YN28_BCL2L1-      --------------------actttctctc--------------------
A0A8I3ZZI7_BCL2L1-      --------------------actttctctc--------------------
A0A5F7ZJK5_BCL2L1-      --------------------actttctctc--------------------
A0A2K6UWY8_BCL2L1-      --------------------actttctctc--------------------
E2IV77_BCL2L1-01        --------------------actttctctc--------------------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --------------------actttctctc--------------------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --------------------actttctctc--------------------
E2IV75_BCL2L1-01        --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A6D2VXZ3_BCL2L1-      --------------------actttctctc--------------------
G1RER8_BCL2L1-01        --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A7I2V597_BCL2L1-      --------------------actttctctc--------------------
A0A2R8Z9D7_BCL2L1-      --------------------actttctctc--------------------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --------------------actttctctc--------------------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      --------------------actttctctc--------------------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------actttctctc--------------------
A0A2K5VPG2_BCL2L1-      --------------------actttctctc--------------------
A0A8I5MVB8_BCL2L1-      --------------------actttctctc--------------------
A0A8D2ERY7_BCL2L1-      --------------------actttctctc--------------------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --------------------actttctctc--------------------
A0A2K5VPG2_BCL2L1-      --------------------actttctctc--------------------
A0A5F7ZJK5_BCL2L1-      --------------------actttctctc--------------------
A0A5F7ZJK5_BCL2L1-      --------------------actttctctc--------------------
A0A5F7ZJK5_BCL2L1-      --------------------actttctctc--------------------
A0A5F7ZJK5_BCL2L1-      --------------------actttctctc--------------------
A0A0D9RJZ8_BCL2L1-      --------------------actttctctc--------------------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --------------------actttctctc--------------------
A0A2K6QFA2_BCL2L1-      --------------------actttctctc--------------------
A0A2K5YR37_BCL2L1-      --------------------actttctctc--------------------
A0A5F5XYW0_BCL2L1-      --------------------actttctctc--------------------
A0A8C7BPR9_BCL2L1-      --------------------actttctctc--------------------
A0A5F5XYW0_BCL2L1-      --------------------actttctctc--------------------
A0A8B8VBB9_BCL2L1-      --------------------actttctctc--------------------
A0A8C6F2V6_BCL2L1-      --------------------actttctctc--------------------
A0A8C9BM97_BCL2L1-      --------------------actttctctc--------------------
M3Z2H9_BCL2L1-01        --------------------actttctctc--------------------
A0A8C7BPR9_BCL2L1-      --------------------actttctctc--------------------
A0A5F5XYW0_BCL2L1-      --------------------actttctctc--------------------
A0A8C0TGM4_BCL2L1-      --------------------actttctctc--------------------
Q76LT7_BCL2L1-01        --------------------actttctctc--------------------
Q8SQ42_BCL2L1-01        --------------------actttctctc--------------------
A0A673UUI0_BCL2L1-      --------------------actttctctc--------------------
A0A452SDS4_BCL2L1-      --------------------actttctctc--------------------
A0A384D3U1_BCL2L1-      --------------------actttctctc--------------------
A0A8C9D5N1_BCL2L1-      --------------------actttctctc--------------------
A0A8C9M2S8_BCL2L1-      --------------------actttctctc--------------------
A0A667HK09_BCL2L1-      --------------------actttctctc--------------------
A0A3Q1LRT3_BCL2L1-      --------------------actttctctc--------------------
A0A4W2D608_BCL2L1-      --------------------actttctctc--------------------
A0A4W2D608_BCL2L1-      --------------------actttctctc--------------------
A0A4W2F845_BCL2L1-      --------------------actttctctc--------------------
A0A4W2F845_BCL2L1-      --------------------actttctctc--------------------
A0A8B9WB42_BCL2L1-      --------------------actttctctc--------------------
A0A8C6FN58_BCL2L1-      --------------------actttctctc--------------------
A0A452E1B1_BCL2L1-      --------------------actttctctc--------------------
W5PSA5_BCL2L1-01        --------------------actttctctc--------------------
A0A8B9X9C2_BCL2L1-      --------------------actttctctc--------------------
A0A452FHY1_BCL2L1-      --------------------actttctctc--------------------
A0A452FHY1_BCL2L1-      --------------------actttctctc--------------------
H3ANS8_BCL2L1-01        --------------------accatatatc--------------------
W5MG74_BCL2L1-01        --------------------actacatcaa--------------------
H9GHK7_BCL2L1-01        --------------------acttcctttc--------------------
A0A6I8PIR3_BCL2L1-      --------------------acttcgtctc--------------------
A0A8D0HVA8_BCL2L1-      --------------------actttatatc--------------------
A0A8D0HVA8_BCL2L1-      --------------------actttatatc--------------------
A0A8D0HVA8_BCL2L1-      --------------------actttatatc--------------------
A0A7M4EJG9_BCL2L1-      --------------------actttatatc--------------------
A0A670IBZ4_BCL2L1-      --------------------actttgtttc--------------------
A0A8D0E1K1_BCL2L1-      --------------------actttatctc--------------------
A0A8D2L5P2_BCL2L1-      --------------------acttcatttc--------------------
A0A8C6V6T2_BCL2L1-      --------------------acttcattgc--------------------
A0A8C5RX62_BCL2L1-      --------------------acttcattgc--------------------
A0A670Z9Y4_BCL2L1-      --------------------acttcattgc--------------------
A0A8C8S850_BCL2L1-      --------------------actttatatc--------------------
K7F655_BCL2L1-01        --------------------acttcctctc--------------------
A0A8C0IVL6_BCL2L1-      --------------------actttctctc--------------------
A0A8C4W8N7_BCL2L1-      ctgagatttcccaggccagagctttctcccagcagctactctagaggatt
A0A8C3RIU8_BCL2L1-      --------------------actttctctc--------------------
A0A8C3IUT0_BCL2L1-      --------------------actttctctc--------------------
A0A8C3IUT0_BCL2L1-      --------------------actttctctc--------------------
A0A8C3IUT0_BCL2L1-      --------------------actttctctc--------------------
A0A8C3IUT0_BCL2L1-      --------------------actttctctc--------------------
A0A674J5J7_BCL2L1-      --------------------actttctctc--------------------
A0A8B9CUX0_BCL2L1-      --------------------actttgtttc--------------------
A0A8B9DB39_BCL2L1-      --------------------actttgtttc--------------------
A0A493TIA6_BCL2L1-      --------------------actttgtctc--------------------
A0A8C3CGW6_BCL2L1-      --------------------actttgtcgc--------------------
A0A8B9SM69_BCL2L1-      --------------------actttgtctc--------------------
A0A8B9V5I0_BCL2L1-      --------------------actttgtctc--------------------
A0A8C7ECQ9_BCL2L1-      --------------------actttgtttc--------------------
A0A669P0Q7_BCL2L1-      --------------------actttgtttc--------------------
A0A8C2T2M7_BCL2L1-      --------------------actttgtttc--------------------
A0A8C9EN38_BCL2L1-      --------------------actttgtttc--------------------
A0A8C3LRK6_BCL2L1-      --------------------actttgtttc--------------------
G1N5N5_BCL2L1-01        --------------------actttgtttc--------------------
A0A8B9NWH6_BCL2L1-      --------------------actttgtttc--------------------
A0A8B9NWH6_BCL2L1-      --------------------actttgtttc--------------------
A0A8C4JDK2_BCL2L1-      --------------------actttgtttc--------------------
A0A8C4JDK2_BCL2L1-      --------------------actttgtttc--------------------
A0A8C5JFI3_BCL2L1-      --------------------actttgtttc--------------------
A0A8D2M680_BCL2L1-      --------------------actttgtttc--------------------
A0A803VLI1_BCL2L1-      --------------------actttgtttc--------------------
A0A8C5U1E1_BCL2L1-      --------------------actttgtttc--------------------
A0A8C3U3Q2_BCL2L1-      --------------------actttgtttc--------------------
A0A8C0U194_BCL2L1-      --------------------actttgtttc--------------------
H0Z8G3_BCL2L1-01        --------------------actttgtttc--------------------
Q4U2V6_BCL2L1-01        --------------------actttgtttc--------------------
A0A8C9NN65_BCL2L1-      --------------------actttgtttc--------------------
A0A8C3XCF2_BCL2L1-      --------------------actttgtttc--------------------
A0A8D2NN48_BCL2L1-      --------------------actttgtttc--------------------
A0A8C0FL84_BCL2L1-      --------------------actttgtttc--------------------
A0A8C0AYR5_BCL2L1-      --------------------actttgtttc--------------------
A0A8C4TWS5_BCL2L1-      --------------------actttgtttc--------------------
A0A8C3KQJ2_BCL2L1-      --------------------actttgtttc--------------------
A0A8C8A4L8_BCL2L1-      --------------------actttgtttc--------------------
A0A8D0FHG7_BCL2L1-      --------------------actttgtttc--------------------
A0A8B9N2I0_BCL2L1-      --------------------actttgtttc--------------------
A0A663ECL2_BCL2L1-      --------------------actttgtttc--------------------
A0A8C0AYR5_BCL2L1-      --------------------actttgtttc--------------------
A0A8B9FKI5_BCL2L1-      --------------------actttgtgtc--------------------
A0A672UKR0_BCL2L1-      --------------------actttgtgtc--------------------
A0A3B5K6B9_BCL2L1-      --------------------tctatattaa--------------------
H3CH49_BCL2L1-01        --------------------tctacattaa--------------------
A0A059PJI5_BCL2L1-      --------------------acttcatcaa--------------------
A0A8C5B4N8_BCL2L1-      --------------------tcttcctaag--------------------
D2ITA2_BCL2L1-02        --------------------tcttcctaag--------------------
C1BLI0_BCL2L1-01        --------------------tcttcataag--------------------
A0A3B3ZMX9_BCL2L1-      --------------------tctacatcca--------------------
A0A3B3ZMX9_BCL2L1-      --------------------tctacatcca--------------------
A0A667Y1V0_BCL2L1-      --------------------tctttataaa--------------------
A0A3P8XFS0_BCL2L1-      --------------------tttttataaa--------------------
A0A3P8XFS0_BCL2L1-      --------------------tttttataaa--------------------
A0A4W5LYF9_BCL2L1-      --------------------tttttataag--------------------
A0A6F8ZUL6_BCL2L1-      --------------------tttttataag--------------------
A0A674C4N2_BCL2L1-      --------------------tttttataag--------------------
A0A8C7RD80_BCL2L1-      --------------------tttttataag--------------------
A0A8C7CBC7_BCL2L1-      --------------------tttttataag--------------------
A0A8C7CBC7_BCL2L1-      --------------------tttttataag--------------------
A0A8C8GSY4_BCL2L1-      --------------------tttttataag--------------------
A0A8C8GSY4_BCL2L1-      --------------------tttttataag--------------------
A0A6F9CY91_BCL2L1-      --------------------tttttataag--------------------
A0A060XE41_BCL2L1-      --------------------tttttataag--------------------
A0A286MU87_BCL2L1-      --------------------tttttataag--------------------
A0A8C8J941_BCL2L1-      --------------------tttttataag--------------------
A0A8C7FX38_BCL2L1-      --------------------tttttataag--------------------
A0A4W5JPK5_BCL2L1-      --------------------tttttataag--------------------
C0HAD8_BCL2L1-01        --------------------tttttataag--------------------
A0A673Z4J6_BCL2L1-      --------------------tttttataag--------------------
A0A3B3QRZ2_BCL2L1-      --------------------acttcataac--------------------
A0A3P8UWG7_BCL2L1-      --------------------actacataca--------------------
A0A345BSW9_BCL2L1-      --------------------tttttattaa--------------------
B2GRK1_BCL2L1-01        --------------------tttttatcaa--------------------
B2GRK1_BCL2L1-02        --------------------tttttatcaa--------------------
Q90Z98_BCL2L1-01        --------------------tttttatcaa--------------------
A0A672K8R2_BCL2L1-      --------------------tttttattaa--------------------
A0A8C1JXA4_BCL2L1-      --------------------tttttattaa--------------------
A0A673M4N6_BCL2L1-      --------------------tttttattaa--------------------
A0A673M4N6_BCL2L1-      --------------------tttttattaa--------------------
A0A671QPE4_BCL2L1-      --------------------tttttattaa--------------------
A0A672N8N5_BCL2L1-      --------------------tttttattaa--------------------
A0A671K7W7_BCL2L1-      --------------------tttttattaa--------------------
A0A671K7W7_BCL2L1-      --------------------tttttattaa--------------------
A0A673IGS5_BCL2L1-      --------------------tttttattaa--------------------
A0A8C5D4L1_BCL2L1-      --------------------tttttttgtg--------------------
A0A8C5D4L1_BCL2L1-      --------------------tttttttgtg--------------------
A0A8C5D4L1_BCL2L1-      --------------------tttttttgtg--------------------
A0A4W4GHX3_BCL2L1-      --------------------actatatcag--------------------
A0A3B4DTL9_BCL2L1-      --------------------actttatcaa--------------------
A0A3B1JJ42_BCL2L1-      --------------------actttattaa--------------------
A0A8B9LKW7_BCL2L1-      --------------------actttattaa--------------------
A0A8C9SVL8_BCL2L1-      --------------------tttatataag--------------------
A0A8C4CMF6_BCL2L1-      --------------------attacatcaa--------------------
A0A3B3TFR4_BCL2L1-      --------------------actttgtcag--------------------
A0A3P8XYL5_BCL2L1-      --------------------actatattac--------------------
A0A6F9B188_BCL2L1-      --------------------actatattac--------------------
A0A4W5R2W6_BCL2L1-      --------------------actatattac--------------------
A0A4W5R2W6_BCL2L1-      --------------------actatattac--------------------
A0A674C578_BCL2L1-      --------------------actatattac--------------------
A0A674C578_BCL2L1-      --------------------actatattac--------------------
A0A8C7IJ10_BCL2L1-      --------------------actatattac--------------------
A0A8C8D057_BCL2L1-      --------------------actatattac--------------------
A0A8C7P574_BCL2L1-      --------------------actatattac--------------------
A0A8C7IJ10_BCL2L1-      --------------------actatattac--------------------
A0A8C8D057_BCL2L1-      --------------------actatattac--------------------
A0A6F9BJ02_BCL2L1-      --------------------actatattac--------------------
A0A4W5NQ40_BCL2L1-      --------------------actatattac--------------------
A0A8C7UB69_BCL2L1-      --------------------actatatcac--------------------
A0A8C7J9N8_BCL2L1-      --------------------actatatcac--------------------
A0A8C8FJG7_BCL2L1-      --------------------actatatcac--------------------
B5XAY3_BCL2L1-01        --------------------actatattac--------------------
A0A674C337_BCL2L1-      --------------------actatattac--------------------
A0A8C9SET9_BCL2L1-      --------------------tctacgtcag--------------------
A0A8C5G971_BCL2L1-      --------------------tctacatcac--------------------
A0A8C5FC81_BCL2L1-      --------------------tctacatcac--------------------
A0A665VM40_BCL2L1-      --------------------tctacataaa--------------------
A0A3Q3WIW8_BCL2L1-      --------------------actacataaa--------------------
A0A3B5PQJ0_BCL2L1-      --------------------tctacattaa--------------------
A0A3P9N9Y4_BCL2L1-      --------------------tctacattaa--------------------
A0A3B3WI27_BCL2L1-      --------------------tctacattaa--------------------
A0A087X9B7_BCL2L1-      --------------------tctacattaa--------------------
A0A3B3TUS7_BCL2L1-      --------------------tctacattaa--------------------
A0A3Q2FR43_BCL2L1-      --------------------tctacattaa--------------------
A0A3Q3B3X5_BCL2L1-      --------------------tctatattat--------------------
A0A667ZHE8_BCL2L1-      --------------------tctacataac--------------------
A0A3Q3G2E1_BCL2L1-      --------------------tctacataac--------------------
A0A3Q3G2E1_BCL2L1-      --------------------tctacataac--------------------
A0A3Q3G2E1_BCL2L1-      --------------------tctacataac--------------------
A0A3Q3MX20_BCL2L1-      --------------------tctacataaa--------------------
A0A0D6DR75_BCL2L1-      --------------------actacataac--------------------
A0A3Q1GZ93_BCL2L1-      --------------------tctacataac--------------------
A0A4W6BQD5_BCL2L1-      --------------------tctacataaa--------------------
A0A3B4V3T1_BCL2L1-      --------------------tctacataaa--------------------
A0A3B4XU17_BCL2L1-      --------------------tctacataaa--------------------
A0A673BZP5_BCL2L1-      --------------------tctacataaa--------------------
A0A671WXV0_BCL2L1-      --------------------tctacataaa--------------------
A0A219P0Y3_BCL2L1-      --------------------gctacataaa--------------------
A0A8C9WU15_BCL2L1-      --------------------tctacataaa--------------------
A0A1A7ZDF6_BCL2L1-      --------------------tctatattag--------------------
A0A8F0MQ26_BCL2L1-      --------------------tctatataaa--------------------
A0A672IDC1_BCL2L1-      --------------------tctacatcac--------------------
A0A672IDC1_BCL2L1-      --------------------tctacatcac--------------------
A0A3Q0RTF8_BCL2L1-      --------------------tctacataac--------------------
A0A668RI12_BCL2L1-      --------------------tctacataag--------------------
I3IZK7_BCL2L1-01        --------------------tctacataag--------------------
A0A3Q4N4B5_BCL2L1-      --------------------tctacataag--------------------
A0A3Q2X557_BCL2L1-      --------------------tctacataag--------------------
A0A3P8P0F1_BCL2L1-      --------------------tctacataag--------------------
A0A3P9D632_BCL2L1-      --------------------tctacataag--------------------
A0A3P9D632_BCL2L1-      --------------------tctacataag--------------------
A0A3B4FNX1_BCL2L1-      --------------------tctacataag--------------------
A0A8C2ZZ68_BCL2L1-      --------------------tctacataaa--------------------
G3NJY1_BCL2L1-01        --------------------tctacataaa--------------------
A0A3B3DHA1_BCL2L1-      --------------------tctacgtgaa--------------------
A0A3P9JYH1_BCL2L1-      --------------------tctacgtgaa--------------------
A0A3B3IB64_BCL2L1-      --------------------tctacgtgaa--------------------
A0A8C7YJI1_BCL2L1-      --------------------tctacgtgaa--------------------
C3VIT1_BCL2L1-01        --------------------tctacataaa--------------------
A0A3B4Z3X2_BCL2L1-      --------------------actacataaa--------------------
A0A3B4Z3X2_BCL2L1-      --------------------actacataaa--------------------
A0A3Q1FR00_BCL2L1-      --------------------tctacataaa--------------------
A0A3Q1FR00_BCL2L1-      --------------------tctacataaa--------------------
A0A3Q1DHJ3_BCL2L1-      --------------------tctacataaa--------------------
A0A3Q1DHJ3_BCL2L1-      --------------------tctacataaa--------------------
A0A3Q1DHJ3_BCL2L1-      --------------------tctacataaa--------------------
A0A3P8TL99_BCL2L1-      --------------------tctacataaa--------------------
A0A3P8TL99_BCL2L1-      --------------------tctacataaa--------------------
A0A8C6UPI9_BCL2L1-      --------------------tcttcctaag--------------------
A0A3B4BFZ8_BCL2L1-      --------------------tcttcataag--------------------
A0A3B3E2W4_BCL2L1-      --------------------tctatttagg--------------------
A0A3P9MKK4_BCL2L1-      --------------------tctatttagc--------------------
A0A3P9MKK4_BCL2L1-      ----------------------catctgac--------------------
A0A3B3I2Q5_BCL2L1-      --------------------tctatttagc--------------------
A0A3B3I2Q5_BCL2L1-      ----------------------catctgac--------------------
A0A3P9I2N4_BCL2L1-      --------------------tctatttagc--------------------
A0A3P9I2N4_BCL2L1-      ----------------------catctgac--------------------
A0A8C7XSQ2_BCL2L1-      --------------------tctatttagc--------------------
A0A8C7XSQ2_BCL2L1-      ----------------------catctgac--------------------
A0A3P8VMA1_BCL2L1-      --------------------tctttttagg--------------------
A0A3Q2C6K4_BCL2L1-      --------------------tctatataag--------------------
A0A3B5MGS2_BCL2L1-      --------------------tctacataag--------------------
M4A558_BCL2L1-01        --------------------tctacataag--------------------
A0A3P9QFB3_BCL2L1-      --------------------tctacataag--------------------
A0A3B3XN57_BCL2L1-      --------------------tctacataag--------------------
A0A087YBW4_BCL2L1-      --------------------tctacataag--------------------
A0A3B3VWI7_BCL2L1-      --------------------tctacataag--------------------
A0A1A8A2S0_BCL2L1-      --------------------actacatcag--------------------
A0A672JL90_BCL2L1-      --------------------tctttttaag--------------------
A0A672Z262_BCL2L1-      --------------------tcttcatatg--------------------
A0A3Q3BEB7_BCL2L1-      --------------------tctacataag--------------------
A0A0F7L1T6_BCL2L1-      --------------------acttcttaag--------------------
H2U5I3_BCL2L1-01        --------------------acttcttaag--------------------
A0A8C2ZH46_BCL2L1-      --------------------tcttcataag--------------------
G3P7B4_BCL2L1-01        --------------------tcttcctaag--------------------
A0A3Q3FUB6_BCL2L1-      --------------------tcttcataag--------------------
A0A3Q3X5M5_BCL2L1-      --------------------tctttataag--------------------
A0A665VSD7_BCL2L1-      --------------------tcttcataca--------------------
A0A8D3CTR5_BCL2L1-      --------------------tcttcatcgg--------------------
A0A3Q1JZ46_BCL2L1-      --------------------tcttcataat--------------------
A0A3B5B4X7_BCL2L1-      --------------------tctttataag--------------------
A0A3Q1EVP6_BCL2L1-      --------------------tctttataag--------------------
A0A6G7K5D7_BCL2L1-      --------------------tctttgtaag--------------------
A0A3Q1BQA0_BCL2L1-      --------------------tctttgtaag--------------------
A0A3P8U812_BCL2L1-      --------------------tctttgtaag--------------------
A0A3Q3NFM4_BCL2L1-      --------------------tctttattag--------------------
A0A4W6EST2_BCL2L1-      --------------------tctttataag--------------------
A0A3B4V9K8_BCL2L1-      --------------------tcttcataag--------------------
A0A3B4XS24_BCL2L1-      --------------------tcttcataag--------------------
A0A510BW31_BCL2L1-      --------------------tctttgtaag--------------------
A0A8D0AAQ8_BCL2L1-      --------------------tctttataag--------------------
A0A8C4IRU9_BCL2L1-      --------------------tctttataag--------------------
E6ZFR0_BCL2L1-01        --------------------tctttataag--------------------
                                                                          

R4JQR8_BCL2L1-01        ------------------------------taatg---------------
A0A346RRN1_BCL2L1-      ------------------------------gaacg---------------
A0A8C4STP1_BCL2L1-      ------------------------------ctata----a----------
A0A8C4XBF6_BCL2L1-      ------------------------------ctaca----a----------
Q90ZH2_BCL2L1-01        ------------------------------taaga----a----------
Q2TAP5_BCL2L1-01        ------------------------------taaga----a----------
Q91828_BCL2L1-01        ------------------------------taaga----a----------
A0A8C5WFB8_BCL2L1-      ------------------------------taaga----a----------
A0A4X2KZ04_BCL2L1-      ------------------------------tcaaa---------------
F6WA14_BCL2L1-01        ------------------------------ttaca----a----------
A0A7N4P3X2_BCL2L1-      ------------------------------ttaca----a----------
A0A7N4P3X2_BCL2L1-      ------------------------------tcagagagca----------
A0A8C5YLY6_BCL2L1-      ------------------------------ctaca----a----------
A0A8D2IA38_BCL2L1-      ------------------------------ctaca----a----------
A0A8D2IA38_BCL2L1-      ------------------------------ctaca----a----------
G3SPN0_BCL2L1-01        ------------------------------ctaca----a----------
O35843_BCL2L1-01        ------------------------------ctaca----a----------
Q7TS62_BCL2L1-02        ------------------------------ctaca----a----------
Q7TS62_BCL2L1-03        ------------------------------ctaca----a----------
Q5HZH3_BCL2L1-02        ------------------------------ctaca----a----------
A0A8C6G6C7_BCL2L1-      ------------------------------ctaca----a----------
Q7TS62_BCL2L1-01        ------------------------------ctaca----a----------
A0A6I9LMY5_BCL2L1-      ------------------------------ctaca----a----------
B2Z3Z4_BCL2L1-01        ------------------------------ctaca----a----------
A0A8C6W748_BCL2L1-      ------------------------------gtaca----a----------
H0X6V2_BCL2L1-01        ------------------------------ctaca----a----------
A0A286Y5D6_BCL2L1-      ------------------------------ctaca----a----------
A0A8D2AGI2_BCL2L1-      ------------------------------ctaca----a----------
A0A287CZ07_BCL2L1-      ------------------------------ctaca----a----------
A0A8C9UNM3_BCL2L1-      ------------------------------ctaca----a----------
A0A8D2I760_BCL2L1-      ------------------------------ctaca----a----------
A0A8C2YUU6_BCL2L1-      ------------------------------ctaca----a----------
A0A8C2YUU6_BCL2L1-      ------------------------------ctaca----a----------
A0A8C2YUU6_BCL2L1-      ------------------------------ctaca----a----------
G1P9D2_BCL2L1-01        ------------------------------ctaca----a----------
A0A8C5NZI4_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q2H0F6_BCL2L1-      ------------------------------ctaca----a----------
A0A8B9XQH5_BCL2L1-      ------------------------------ttaca----a----------
Q05KJ0_BCL2L1-01        ------------------------------ttaca----a----------
Q05KJ0_BCL2L1-02        ------------------------------ttaca----a----------
A0A8C6DX24_BCL2L1-      ------------------------------ttaca----a----------
A0A452FWV3_BCL2L1-      ------------------------------ttaca----a----------
Q9MZS7_BCL2L1-01        ------------------------------ttaca----a----------
A0A8C3WJH5_BCL2L1-      ------------------------------ctaca----a----------
A0A8D1ALD6_BCL2L1-      ------------------------------ctaca----a----------
A0A4X1SQU7_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0XF62_BCL2L1-      ------------------------------ctaca----a----------
O77737_BCL2L1-01        ------------------------------ctaca----a----------
A0A8D0J6V8_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0J6V8_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0J6V8_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0J6V8_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0J6V8_BCL2L1-      ------------------------------ctaca----a----------
A0A4X1SQU7_BCL2L1-      ------------------------------ctaca----a----------
A0A4X1SQU7_BCL2L1-      ------------------------------ctaca----a----------
A0A4X1SQU7_BCL2L1-      ------------------------------ctaca----a----------
A0A4X1SRM7_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0XF62_BCL2L1-      ------------------------------ctaca----a----------
A0A8D1ALD6_BCL2L1-      ------------------------------ctaca----a----------
A0A4X1SQU7_BCL2L1-      ------------------------------ctaca----a----------
A0A8C4L2X1_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q2H0F6_BCL2L1-      ------------------------------ctaca----a----------
A0A250YD48_BCL2L1-      ------------------------------ctaca----a----------
A0A1L5BWY3_BCL2L1-      ------------------------------ctaca----a----------
A0A8B7FNN3_BCL2L1-      ------------------------------ctaca----a----------
A0A8B7FNN3_BCL2L1-      ------------------------------ctaca----a----------
A0A8B7FNN3_BCL2L1-      ------------------------------ctaca----a----------
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      ------------------------------ctaca----a----------
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        ------------------------------ctaca----a----------
A0A8C8YN28_BCL2L1-      ------------------------------ctaca----a----------
A0A8I3ZZI7_BCL2L1-      ------------------------------ctaca----a----------
A0A5F7ZJK5_BCL2L1-      ------------------------------ctaca----a----------
A0A2K6UWY8_BCL2L1-      ------------------------------ctaca----a----------
E2IV77_BCL2L1-01        ------------------------------ctaca----a----------
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      ------------------------------ctaca----a----------
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      ------------------------------ctaca----a----------
E2IV75_BCL2L1-01        ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A6D2VXZ3_BCL2L1-      ------------------------------ctaca----a----------
G1RER8_BCL2L1-01        ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A7I2V597_BCL2L1-      ------------------------------ctaca----a----------
A0A2R8Z9D7_BCL2L1-      ------------------------------ctaca----a----------
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      ------------------------------ctaca----a----------
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      ------------------------------ctaca----a----------
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      ------------------------------ctaca----a----------
A0A2K5VPG2_BCL2L1-      ------------------------------ctaca----a----------
A0A8I5MVB8_BCL2L1-      ------------------------------ctaca----a----------
A0A8D2ERY7_BCL2L1-      ------------------------------ctaca----a----------
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      ------------------------------ctaca----a----------
A0A2K5VPG2_BCL2L1-      ------------------------------ctaca----a----------
A0A5F7ZJK5_BCL2L1-      ------------------------------ctaca----a----------
A0A5F7ZJK5_BCL2L1-      ------------------------------ctaca----a----------
A0A5F7ZJK5_BCL2L1-      ------------------------------ctaca----a----------
A0A5F7ZJK5_BCL2L1-      ------------------------------ctaca----a----------
A0A0D9RJZ8_BCL2L1-      ------------------------------ctaca----a----------
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      ------------------------------ctaca----a----------
A0A2K6QFA2_BCL2L1-      ------------------------------ctaca----a----------
A0A2K5YR37_BCL2L1-      ------------------------------ctaca----a----------
A0A5F5XYW0_BCL2L1-      ------------------------------ctaca----a----------
A0A8C7BPR9_BCL2L1-      ------------------------------ctaca----a----------
A0A5F5XYW0_BCL2L1-      ------------------------------ctaca----a----------
A0A8B8VBB9_BCL2L1-      ------------------------------ctaca----a----------
A0A8C6F2V6_BCL2L1-      ------------------------------ctaca----a----------
A0A8C9BM97_BCL2L1-      ------------------------------ctaca----a----------
M3Z2H9_BCL2L1-01        ------------------------------ctaca----a----------
A0A8C7BPR9_BCL2L1-      ------------------------------ctaca----a----------
A0A5F5XYW0_BCL2L1-      ------------------------------ctaca----a----------
A0A8C0TGM4_BCL2L1-      ------------------------------ctaca----a----------
Q76LT7_BCL2L1-01        ------------------------------ctaca----a----------
Q8SQ42_BCL2L1-01        ------------------------------ctaca----a----------
A0A673UUI0_BCL2L1-      ------------------------------ctaca----a----------
A0A452SDS4_BCL2L1-      ------------------------------ctaca----a----------
A0A384D3U1_BCL2L1-      ------------------------------ctaca----a----------
A0A8C9D5N1_BCL2L1-      ------------------------------ctaca----a----------
A0A8C9M2S8_BCL2L1-      ------------------------------ctaca----a----------
A0A667HK09_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q1LRT3_BCL2L1-      ------------------------------ttaca----a----------
A0A4W2D608_BCL2L1-      ------------------------------ttaca----a----------
A0A4W2D608_BCL2L1-      ------------------------------ttaca----a----------
A0A4W2F845_BCL2L1-      ------------------------------ttaca----a----------
A0A4W2F845_BCL2L1-      ------------------------------ttaca----a----------
A0A8B9WB42_BCL2L1-      ------------------------------ttaca----a----------
A0A8C6FN58_BCL2L1-      ------------------------------ttaca----a----------
A0A452E1B1_BCL2L1-      ------------------------------ttaca----a----------
W5PSA5_BCL2L1-01        ------------------------------ttaca----a----------
A0A8B9X9C2_BCL2L1-      ------------------------------ttaca----a----------
A0A452FHY1_BCL2L1-      ------------------------------ttaca----a----------
A0A452FHY1_BCL2L1-      ------------------------------ttaca----a----------
H3ANS8_BCL2L1-01        ------------------------------ccaga----a----------
W5MG74_BCL2L1-01        ------------------------------ctata----a----------
H9GHK7_BCL2L1-01        ------------------------------ctaca----a----------
A0A6I8PIR3_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0HVA8_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0HVA8_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0HVA8_BCL2L1-      ------------------------------ctaca----a----------
A0A7M4EJG9_BCL2L1-      ------------------------------ctaca----a----------
A0A670IBZ4_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0E1K1_BCL2L1-      ------------------------------ctaca----a----------
A0A8D2L5P2_BCL2L1-      ------------------------------ctaca----a----------
A0A8C6V6T2_BCL2L1-      ------------------------------ctaca----a----------
A0A8C5RX62_BCL2L1-      ------------------------------ctaca----a----------
A0A670Z9Y4_BCL2L1-      ------------------------------ctaca----a----------
A0A8C8S850_BCL2L1-      ------------------------------ctaca----a----------
K7F655_BCL2L1-01        ------------------------------ctaca----a----------
A0A8C0IVL6_BCL2L1-      ------------------------------ctaca----a----------
A0A8C4W8N7_BCL2L1-      gtctgctcagggttcagatgtttgccttgactcca----gaggagagcag
A0A8C3RIU8_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3IUT0_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3IUT0_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3IUT0_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3IUT0_BCL2L1-      ------------------------------ctaca----a----------
A0A674J5J7_BCL2L1-      ------------------------------ctaca----a----------
A0A8B9CUX0_BCL2L1-      ------------------------------ctaca----a----------
A0A8B9DB39_BCL2L1-      ------------------------------ctaca----a----------
A0A493TIA6_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3CGW6_BCL2L1-      ------------------------------ctaca----a----------
A0A8B9SM69_BCL2L1-      ------------------------------ctaca----a----------
A0A8B9V5I0_BCL2L1-      ------------------------------ctaca----a----------
A0A8C7ECQ9_BCL2L1-      ------------------------------ctaca----a----------
A0A669P0Q7_BCL2L1-      ------------------------------ctaca----a----------
A0A8C2T2M7_BCL2L1-      ------------------------------ctaca----a----------
A0A8C9EN38_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3LRK6_BCL2L1-      ------------------------------ctaca----a----------
G1N5N5_BCL2L1-01        ------------------------------ctaca----a----------
A0A8B9NWH6_BCL2L1-      ------------------------------ctaca----a----------
A0A8B9NWH6_BCL2L1-      ------------------------------ctaca----a----------
A0A8C4JDK2_BCL2L1-      ------------------------------ctaca----a----------
A0A8C4JDK2_BCL2L1-      ------------------------------ctaca----a----------
A0A8C5JFI3_BCL2L1-      ------------------------------ctaca----a----------
A0A8D2M680_BCL2L1-      ------------------------------ctaca----a----------
A0A803VLI1_BCL2L1-      ------------------------------ttaca----a----------
A0A8C5U1E1_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3U3Q2_BCL2L1-      ------------------------------ctaca----a----------
A0A8C0U194_BCL2L1-      ------------------------------ctaca----a----------
H0Z8G3_BCL2L1-01        ------------------------------ctaca----a----------
Q4U2V6_BCL2L1-01        ------------------------------ctaca----a----------
A0A8C9NN65_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3XCF2_BCL2L1-      ------------------------------ctaca----a----------
A0A8D2NN48_BCL2L1-      ------------------------------ctaca----a----------
A0A8C0FL84_BCL2L1-      ------------------------------ctaca----a----------
A0A8C0AYR5_BCL2L1-      ------------------------------ctaca----a----------
A0A8C4TWS5_BCL2L1-      ------------------------------ctaca----a----------
A0A8C3KQJ2_BCL2L1-      ------------------------------ctaca----a----------
A0A8C8A4L8_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0FHG7_BCL2L1-      ------------------------------ctaca----a----------
A0A8B9N2I0_BCL2L1-      ------------------------------ctaca----a----------
A0A663ECL2_BCL2L1-      ------------------------------ctaca----a----------
A0A8C0AYR5_BCL2L1-      ------------------------------ctaca----a----------
A0A8B9FKI5_BCL2L1-      ------------------------------ctaca----a----------
A0A672UKR0_BCL2L1-      ------------------------------ctaca----a----------
A0A3B5K6B9_BCL2L1-      ------------------------------gtaca----a----------
H3CH49_BCL2L1-01        ------------------------------ataca----a----------
A0A059PJI5_BCL2L1-      ------------------------------gtaca----a----------
A0A8C5B4N8_BCL2L1-      ------------------------------ccata----a----------
D2ITA2_BCL2L1-02        ------------------------------ccata----a----------
C1BLI0_BCL2L1-01        ------------------------------ctata----a----------
A0A3B3ZMX9_BCL2L1-      ------------------------------gtaca----a----------
A0A3B3ZMX9_BCL2L1-      ------------------------------gtaca----a----------
A0A667Y1V0_BCL2L1-      ------------------------------ctata----a----------
A0A3P8XFS0_BCL2L1-      ------------------------------ctata----a----------
A0A3P8XFS0_BCL2L1-      ------------------------------ctata----a----------
A0A4W5LYF9_BCL2L1-      ------------------------------ctata----a----------
A0A6F8ZUL6_BCL2L1-      ------------------------------ctata----a----------
A0A674C4N2_BCL2L1-      ------------------------------ctata----a----------
A0A8C7RD80_BCL2L1-      ------------------------------ctata----a----------
A0A8C7CBC7_BCL2L1-      ------------------------------ctata----a----------
A0A8C7CBC7_BCL2L1-      ------------------------------ctata----a----------
A0A8C8GSY4_BCL2L1-      ------------------------------ctata----a----------
A0A8C8GSY4_BCL2L1-      ------------------------------ctata----a----------
A0A6F9CY91_BCL2L1-      ------------------------------ctata----g----------
A0A060XE41_BCL2L1-      ------------------------------ctata----g----------
A0A286MU87_BCL2L1-      ------------------------------ctata----g----------
A0A8C8J941_BCL2L1-      ------------------------------ctata----g----------
A0A8C7FX38_BCL2L1-      ------------------------------ctata----g----------
A0A4W5JPK5_BCL2L1-      ------------------------------ctata----g----------
C0HAD8_BCL2L1-01        ------------------------------ctata----g----------
A0A673Z4J6_BCL2L1-      ------------------------------ctata----g----------
A0A3B3QRZ2_BCL2L1-      ------------------------------gtata----a----------
A0A3P8UWG7_BCL2L1-      ------------------------------gtata----a----------
A0A345BSW9_BCL2L1-      ------------------------------atata----a----------
B2GRK1_BCL2L1-01        ------------------------------atata----a----------
B2GRK1_BCL2L1-02        ------------------------------atata----a----------
Q90Z98_BCL2L1-01        ------------------------------atata----a----------
A0A672K8R2_BCL2L1-      ------------------------------ataca----a----------
A0A8C1JXA4_BCL2L1-      ------------------------------atata----a----------
A0A673M4N6_BCL2L1-      ------------------------------atata----a----------
A0A673M4N6_BCL2L1-      ------------------------------atata----a----------
A0A671QPE4_BCL2L1-      ------------------------------atata----a----------
A0A672N8N5_BCL2L1-      ------------------------------atata----a----------
A0A671K7W7_BCL2L1-      ------------------------------atata----a----------
A0A671K7W7_BCL2L1-      ------------------------------atata----a----------
A0A673IGS5_BCL2L1-      ------------------------------atata----a----------
A0A8C5D4L1_BCL2L1-      ------------------------------ccacc----g----------
A0A8C5D4L1_BCL2L1-      ------------------------------ccacc----g----------
A0A8C5D4L1_BCL2L1-      ------------------------------ccacc----g----------
A0A4W4GHX3_BCL2L1-      ------------------------------gtaca----a----------
A0A3B4DTL9_BCL2L1-      ------------------------------gtaca----a----------
A0A3B1JJ42_BCL2L1-      ------------------------------gtaca----a----------
A0A8B9LKW7_BCL2L1-      ------------------------------gtaca----a----------
A0A8C9SVL8_BCL2L1-      ------------------------------ctata----a----------
A0A8C4CMF6_BCL2L1-      ------------------------------ctata----a----------
A0A3B3TFR4_BCL2L1-      ------------------------------ctata----a----------
A0A3P8XYL5_BCL2L1-      ------------------------------ctata----a----------
A0A6F9B188_BCL2L1-      ------------------------------ctata----a----------
A0A4W5R2W6_BCL2L1-      ------------------------------ctata----a----------
A0A4W5R2W6_BCL2L1-      ------------------------------ctata----a----------
A0A674C578_BCL2L1-      ------------------------------ctata----a----------
A0A674C578_BCL2L1-      ------------------------------ctata----a----------
A0A8C7IJ10_BCL2L1-      ------------------------------ctata----a----------
A0A8C8D057_BCL2L1-      ------------------------------ctata----a----------
A0A8C7P574_BCL2L1-      ------------------------------ctata----a----------
A0A8C7IJ10_BCL2L1-      ------------------------------ctata----a----------
A0A8C8D057_BCL2L1-      ------------------------------ctata----a----------
A0A6F9BJ02_BCL2L1-      ------------------------------ctata----a----------
A0A4W5NQ40_BCL2L1-      ------------------------------ctata----a----------
A0A8C7UB69_BCL2L1-      ------------------------------ctata----a----------
A0A8C7J9N8_BCL2L1-      ------------------------------ctata----a----------
A0A8C8FJG7_BCL2L1-      ------------------------------ctata----a----------
B5XAY3_BCL2L1-01        ------------------------------ctata----a----------
A0A674C337_BCL2L1-      ------------------------------ctata----a----------
A0A8C9SET9_BCL2L1-      ------------------------------ctaca----a----------
A0A8C5G971_BCL2L1-      ------------------------------ataca----a----------
A0A8C5FC81_BCL2L1-      ------------------------------gcaca----a----------
A0A665VM40_BCL2L1-      ------------------------------atata----a----------
A0A3Q3WIW8_BCL2L1-      ------------------------------ctata----a----------
A0A3B5PQJ0_BCL2L1-      ------------------------------gttta----a----------
A0A3P9N9Y4_BCL2L1-      ------------------------------gttta----a----------
A0A3B3WI27_BCL2L1-      ------------------------------gttta----a----------
A0A087X9B7_BCL2L1-      ------------------------------gttta----a----------
A0A3B3TUS7_BCL2L1-      ------------------------------gttta----a----------
A0A3Q2FR43_BCL2L1-      ------------------------------gttca----a----------
A0A3Q3B3X5_BCL2L1-      ------------------------------gtata----a----------
A0A667ZHE8_BCL2L1-      ------------------------------ctata----a----------
A0A3Q3G2E1_BCL2L1-      ------------------------------ctata----a----------
A0A3Q3G2E1_BCL2L1-      ------------------------------ctata----a----------
A0A3Q3G2E1_BCL2L1-      ------------------------------ctata----a----------
A0A3Q3MX20_BCL2L1-      ------------------------------atata----a----------
A0A0D6DR75_BCL2L1-      ------------------------------atata----a----------
A0A3Q1GZ93_BCL2L1-      ------------------------------atata----a----------
A0A4W6BQD5_BCL2L1-      ------------------------------gtata----a----------
A0A3B4V3T1_BCL2L1-      ------------------------------gcata----a----------
A0A3B4XU17_BCL2L1-      ------------------------------gtata----a----------
A0A673BZP5_BCL2L1-      ------------------------------ctata----a----------
A0A671WXV0_BCL2L1-      ------------------------------ctata----a----------
A0A219P0Y3_BCL2L1-      ------------------------------atata----a----------
A0A8C9WU15_BCL2L1-      ------------------------------ctata----a----------
A0A1A7ZDF6_BCL2L1-      ------------------------------atata----a----------
A0A8F0MQ26_BCL2L1-      ------------------------------ctata----a----------
A0A672IDC1_BCL2L1-      ------------------------------ctaca----a----------
A0A672IDC1_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q0RTF8_BCL2L1-      ------------------------------gtata----a----------
A0A668RI12_BCL2L1-      ------------------------------gtata----a----------
I3IZK7_BCL2L1-01        ------------------------------gtata----a----------
A0A3Q4N4B5_BCL2L1-      ------------------------------gtata----a----------
A0A3Q2X557_BCL2L1-      ------------------------------gtata----a----------
A0A3P8P0F1_BCL2L1-      ------------------------------gtata----a----------
A0A3P9D632_BCL2L1-      ------------------------------gtata----a----------
A0A3P9D632_BCL2L1-      ------------------------------gtata----a----------
A0A3B4FNX1_BCL2L1-      ------------------------------gtata----a----------
A0A8C2ZZ68_BCL2L1-      ------------------------------ctata----a----------
G3NJY1_BCL2L1-01        ------------------------------ctata----a----------
A0A3B3DHA1_BCL2L1-      ------------------------------gtata----a----------
A0A3P9JYH1_BCL2L1-      ------------------------------gtata----a----------
A0A3B3IB64_BCL2L1-      ------------------------------gtata----a----------
A0A8C7YJI1_BCL2L1-      ------------------------------gtata----a----------
C3VIT1_BCL2L1-01        ------------------------------gtata----a----------
A0A3B4Z3X2_BCL2L1-      ------------------------------gtata----a----------
A0A3B4Z3X2_BCL2L1-      ------------------------------gtata----a----------
A0A3Q1FR00_BCL2L1-      ------------------------------gtata----a----------
A0A3Q1FR00_BCL2L1-      ------------------------------gtata----a----------
A0A3Q1DHJ3_BCL2L1-      ------------------------------gtata----a----------
A0A3Q1DHJ3_BCL2L1-      ------------------------------gtata----a----------
A0A3Q1DHJ3_BCL2L1-      ------------------------------gtata----a----------
A0A3P8TL99_BCL2L1-      ------------------------------gtata----a----------
A0A3P8TL99_BCL2L1-      ------------------------------gtata----a----------
A0A8C6UPI9_BCL2L1-      ------------------------------ttaca----a----------
A0A3B4BFZ8_BCL2L1-      ------------------------------ctaca----a----------
A0A3B3E2W4_BCL2L1-      ------------------------------ctata----a----------
A0A3P9MKK4_BCL2L1-      ------------------------------ctaca----a----------
A0A3P9MKK4_BCL2L1-      ------------------------------ctaca----a----------
A0A3B3I2Q5_BCL2L1-      ------------------------------ctata----a----------
A0A3B3I2Q5_BCL2L1-      ------------------------------ctata----a----------
A0A3P9I2N4_BCL2L1-      ------------------------------ctata----a----------
A0A3P9I2N4_BCL2L1-      ------------------------------ctata----a----------
A0A8C7XSQ2_BCL2L1-      ------------------------------ctata----a----------
A0A8C7XSQ2_BCL2L1-      ------------------------------ctata----a----------
A0A3P8VMA1_BCL2L1-      ------------------------------ttata----a----------
A0A3Q2C6K4_BCL2L1-      ------------------------------ctaca----a----------
A0A3B5MGS2_BCL2L1-      ------------------------------ctaca----a----------
M4A558_BCL2L1-01        ------------------------------ctaca----a----------
A0A3P9QFB3_BCL2L1-      ------------------------------ctaca----a----------
A0A3B3XN57_BCL2L1-      ------------------------------ctaca----a----------
A0A087YBW4_BCL2L1-      ------------------------------ctaca----a----------
A0A3B3VWI7_BCL2L1-      ------------------------------ctaca----a----------
A0A1A8A2S0_BCL2L1-      ------------------------------ctaca----a----------
A0A672JL90_BCL2L1-      ------------------------------ccaca----g----------
A0A672Z262_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q3BEB7_BCL2L1-      ------------------------------ctata----a----------
A0A0F7L1T6_BCL2L1-      ------------------------------ataca----a----------
H2U5I3_BCL2L1-01        ------------------------------ataca----a----------
A0A8C2ZH46_BCL2L1-      ------------------------------ctaca----a----------
G3P7B4_BCL2L1-01        ------------------------------ctaca----a----------
A0A3Q3FUB6_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q3X5M5_BCL2L1-      ------------------------------ctaca----a----------
A0A665VSD7_BCL2L1-      ------------------------------ctcca----a----------
A0A8D3CTR5_BCL2L1-      ------------------------------ctata----a----------
A0A3Q1JZ46_BCL2L1-      ------------------------------gtaca----a----------
A0A3B5B4X7_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q1EVP6_BCL2L1-      ------------------------------ctaca----a----------
A0A6G7K5D7_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q1BQA0_BCL2L1-      ------------------------------cgaca----a----------
A0A3P8U812_BCL2L1-      ------------------------------ctaca----a----------
A0A3Q3NFM4_BCL2L1-      ------------------------------ctaca----a----------
A0A4W6EST2_BCL2L1-      ------------------------------ctaca----a----------
A0A3B4V9K8_BCL2L1-      ------------------------------ctaca----a----------
A0A3B4XS24_BCL2L1-      ------------------------------ctaca----a----------
A0A510BW31_BCL2L1-      ------------------------------ctaca----a----------
A0A8D0AAQ8_BCL2L1-      ------------------------------ctaca----a----------
A0A8C4IRU9_BCL2L1-      ------------------------------ctata----a----------
E6ZFR0_BCL2L1-01        ------------------------------ctata----a----------
                                                                          

R4JQR8_BCL2L1-01        -----------accgacttcgaaaacat----------------------
A0A346RRN1_BCL2L1-      -----------accgactaagaaagaat----------------------
A0A8C4STP1_BCL2L1-      -----------attatctcagaaaaatttttcatgtaacc----------
A0A8C4XBF6_BCL2L1-      -----------attatcgcagaaaaatgttttgaatagcc----------
Q90ZH2_BCL2L1-01        -----------actttcccagaatgaagcctgcagga------------a
Q2TAP5_BCL2L1-01        -----------actttcccagaatgaagcctgcagga------------a
Q91828_BCL2L1-01        -----------actttcccagaatgaagcctgcagga------------a
A0A8C5WFB8_BCL2L1-      -----------attgtcccagagagatttcacatggaattgctgcacaga
A0A4X2KZ04_BCL2L1-      --------------------------------------------------
F6WA14_BCL2L1-01        -----------gctctcacagaaaggatacaattggagtc---------a
A0A7N4P3X2_BCL2L1-      -----------gctttcacagaagggatacaattggagtc---------a
A0A7N4P3X2_BCL2L1-      -----------gctttcacagaagggatacaattggagtc---------a
A0A8C5YLY6_BCL2L1-      -----------gctttcccagaaaggataccgctggagcc---------a
A0A8D2IA38_BCL2L1-      -----------gctttcccagaaaggatatagctggagcc---------a
A0A8D2IA38_BCL2L1-      -----------gctttcccagaaaggatatagctggagcc---------a
G3SPN0_BCL2L1-01        -----------gctttcccagaaaggatacagttggagtc---------a
O35843_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
Q7TS62_BCL2L1-02        -----------gctctcccagaaaggatacagctggagtc---------a
Q7TS62_BCL2L1-03        -----------gctctcccagaaaggatacagctggagtc---------a
Q5HZH3_BCL2L1-02        -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C6G6C7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
Q7TS62_BCL2L1-01        -----------gctctcccagaaaggatacagctggagtc---------a
A0A6I9LMY5_BCL2L1-      -----------gctgtcccagaaagggtacagctggagtc---------a
B2Z3Z4_BCL2L1-01        -----------gttctcccagaaaggatacagctggagtc---------a
A0A8C6W748_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
H0X6V2_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A286Y5D6_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D2AGI2_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A287CZ07_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C9UNM3_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D2I760_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C2YUU6_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C2YUU6_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C2YUU6_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
G1P9D2_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C5NZI4_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A3Q2H0F6_BCL2L1-      -----------gctttcccagaaaggatacaactggagtc---------a
A0A8B9XQH5_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
Q05KJ0_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
Q05KJ0_BCL2L1-02        -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C6DX24_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A452FWV3_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
Q9MZS7_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C3WJH5_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D1ALD6_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4X1SQU7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D0XF62_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
O77737_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D0J6V8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D0J6V8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D0J6V8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D0J6V8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D0J6V8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4X1SQU7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4X1SQU7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4X1SQU7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4X1SRM7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D0XF62_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D1ALD6_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4X1SQU7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C4L2X1_BCL2L1-      -----------gctttcccagaaaggatacaactggagtc---------a
A0A3Q2H0F6_BCL2L1-      -----------gctttcccagaaaggatacaactggagtc---------a
A0A250YD48_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A1L5BWY3_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8B7FNN3_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8B7FNN3_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8B7FNN3_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C8YN28_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8I3ZZI7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A5F7ZJK5_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K6UWY8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
E2IV77_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
E2IV75_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A6D2VXZ3_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
G1RER8_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A7I2V597_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2R8Z9D7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K5VPG2_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8I5MVB8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8D2ERY7_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K5VPG2_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A5F7ZJK5_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A5F7ZJK5_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A5F7ZJK5_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A5F7ZJK5_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A0D9RJZ8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K6QFA2_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A2K5YR37_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A5F5XYW0_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C7BPR9_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A5F5XYW0_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8B8VBB9_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C6F2V6_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C9BM97_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
M3Z2H9_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C7BPR9_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A5F5XYW0_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C0TGM4_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
Q76LT7_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------a
Q8SQ42_BCL2L1-01        -----------gctttcccagaaaggatacagctggagtc---------g
A0A673UUI0_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A452SDS4_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A384D3U1_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C9D5N1_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C9M2S8_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A667HK09_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A3Q1LRT3_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4W2D608_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4W2D608_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4W2F845_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A4W2F845_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8B9WB42_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------a
A0A8C6FN58_BCL2L1-      -----------gctttcccagaaaggatacatctggagtc---------a
A0A452E1B1_BCL2L1-      -----------gtttttccagaaaggatacagctggagtc---------a
W5PSA5_BCL2L1-01        -----------gttttttcagaaaggatacagctggagtc---------a
A0A8B9X9C2_BCL2L1-      -----------gctttcccagaaaggatacagctggagtc---------g
A0A452FHY1_BCL2L1-      -----------gctttcccagaaaggattcagctgga-------------
A0A452FHY1_BCL2L1-      -----------gctttcccagaaaggattcagctgga-------------
H3ANS8_BCL2L1-01        -----------gctgatgcagcggggataccagtggag------------
W5MG74_BCL2L1-01        -----------actctcgcagaagaactactcctgggacc---------a
H9GHK7_BCL2L1-01        -----------gctgtcgcagcggggccacagctggcatg---------a
A0A6I8PIR3_BCL2L1-      -----------gctggcccagcgcgggcacgactggagcc---------g
A0A8D0HVA8_BCL2L1-      -----------gctgtcgcagaggggctacagctggagcc---------a
A0A8D0HVA8_BCL2L1-      -----------gctgtcgcagaggggctacagctggagcc---------a
A0A8D0HVA8_BCL2L1-      -----------gctgtcgcagaggggctacagctggagcc---------a
A0A7M4EJG9_BCL2L1-      -----------gctgtcacagcggggacacagctggagtc---------a
A0A670IBZ4_BCL2L1-      -----------gctgtcagagaggggccacagctgggatg---------a
A0A8D0E1K1_BCL2L1-      -----------gctctcccagaggggccacaactggagcg---------a
A0A8D2L5P2_BCL2L1-      -----------gctgtctcagcggggccacagctggaatg---------a
A0A8C6V6T2_BCL2L1-      -----------gctggcgcagcggggccacagctggcgcg---------a
A0A8C5RX62_BCL2L1-      -----------gctggcgcagcggggccacagctggcgcg---------a
A0A670Z9Y4_BCL2L1-      -----------gctggcgcagcggggccacagctggcgcg---------a
A0A8C8S850_BCL2L1-      -----------gctatcgcagaggggatacagctggagtc---------a
K7F655_BCL2L1-01        -----------gctatcgcagaggggacacagctggagct---------g
A0A8C0IVL6_BCL2L1-      -----------gctatcgcagaggggatacagctggagtc---------g
A0A8C4W8N7_BCL2L1-      agtctggacctgctatcgcagaggggatacagctggagtc---------g
A0A8C3RIU8_BCL2L1-      -----------gctttcgcagaggggatacagctggagtc---------g
A0A8C3IUT0_BCL2L1-      -----------gctatcgcagcggggatacagctggagtc---------g
A0A8C3IUT0_BCL2L1-      -----------gctatcgcagcggggatacagctggagtc---------g
A0A8C3IUT0_BCL2L1-      -----------gctatcgcagcggggatacagctggagtc---------g
A0A8C3IUT0_BCL2L1-      -----------gctatcgcagcggggatacagctggagtc---------g
A0A674J5J7_BCL2L1-      -----------gctatcgcagcggggatacagctggagtc---------g
A0A8B9CUX0_BCL2L1-      -----------gctgtcgcagaagggctacagctggagcc---------a
A0A8B9DB39_BCL2L1-      -----------gctgtcgcagaagggctacagctggagcc---------a
A0A493TIA6_BCL2L1-      -----------gctgtcgcagaaaggctacagctggagcc---------a
A0A8C3CGW6_BCL2L1-      -----------gctgtcgcagaagggctacagctggagcc---------a
A0A8B9SM69_BCL2L1-      -----------gctgtcgcagaaaggctacagctggagcc---------a
A0A8B9V5I0_BCL2L1-      -----------gctgtcgcagaaaggctacagctggagcc---------a
A0A8C7ECQ9_BCL2L1-      -----------gctctcgcagaaggggtacagctggagtc---------a
A0A669P0Q7_BCL2L1-      -----------gctctcgcagaaggggcactgctggagcg---------a
A0A8C2T2M7_BCL2L1-      -----------gctctcgcagaaggggcactgctggagcg---------a
A0A8C9EN38_BCL2L1-      -----------gctctcgcagaaggggcactgctggagcg---------a
A0A8C3LRK6_BCL2L1-      -----------gctctcgcagaaggggcactgctggagcg---------a
G1N5N5_BCL2L1-01        -----------gctctcgcagaaggggcactgctggagcg---------a
A0A8B9NWH6_BCL2L1-      -----------gctctcacagaagggatacagctggagtc---------a
A0A8B9NWH6_BCL2L1-      -----------gctctcacagaagggatacagctggagtc---------a
A0A8C4JDK2_BCL2L1-      -----------gctctcacagaaggactacagctggagtc---------a
A0A8C4JDK2_BCL2L1-      -----------gctctcacagaaggactacagctggagtc---------a
A0A8C5JFI3_BCL2L1-      -----------gctctcacagaaaggatacagctggagtc---------a
A0A8D2M680_BCL2L1-      -----------gctctcacagaaaggatacagctggagtc---------a
A0A803VLI1_BCL2L1-      -----------gctctcacagaaaggctacagctggagtc---------a
A0A8C5U1E1_BCL2L1-      -----------gctctcacagaaaggatacagctggagtc---------a
A0A8C3U3Q2_BCL2L1-      -----------gctctcccagaaaggatacagctggagtc---------a
A0A8C0U194_BCL2L1-      -----------gctctcacagaaaggatacagctggagtc---------a
H0Z8G3_BCL2L1-01        -----------gctctcacagaaaggatacagctggagtc---------a
Q4U2V6_BCL2L1-01        -----------gctctcacagaaaggatacagctggagtc---------a
A0A8C9NN65_BCL2L1-      -----------gctctcacagaaaggatacagctggagtc---------a
A0A8C3XCF2_BCL2L1-      -----------gctctcacagaaaggatacagctggagcc---------a
A0A8D2NN48_BCL2L1-      -----------gctctcacagaaaggatacagctggagtc---------a
A0A8C0FL84_BCL2L1-      -----------gctctcgcagaagggatacagctggagtc---------a
A0A8C0AYR5_BCL2L1-      -----------gctctcacagaagggatacagctggagtc---------a
A0A8C4TWS5_BCL2L1-      -----------gctctcgcagaaggggtacagctggagtc---------a
A0A8C3KQJ2_BCL2L1-      -----------gctttcacagaagggatacagctggagcg---------a
A0A8C8A4L8_BCL2L1-      -----------gctctcgcagaagggatacagctggagtc---------a
A0A8D0FHG7_BCL2L1-      -----------gctctcgcagaagggatacagctggagtc---------a
A0A8B9N2I0_BCL2L1-      -----------gctctcacagaagggatacagctggagtc---------a
A0A663ECL2_BCL2L1-      -----------gctctcacagaagggatacagctggagtc---------a
A0A8C0AYR5_BCL2L1-      -----------gctctcacagaagggatacagctggagtc---------a
A0A8B9FKI5_BCL2L1-      -----------gctctcgcagaagggccacagctggagcc---------a
A0A672UKR0_BCL2L1-      -----------gctctcgcagaagggccacagctggagcc---------a
A0A3B5K6B9_BCL2L1-      -----------actctcccaaagaaattaccctttcaatc---------a
H3CH49_BCL2L1-01        -----------actttcccaaagaaactaccctttgagtc---------a
A0A059PJI5_BCL2L1-      -----------gctctcccagaaaaactacccctgcgacc---------a
A0A8C5B4N8_BCL2L1-      -----------actgtctcagaggaattacaggcctattc---------c
D2ITA2_BCL2L1-02        -----------actgtctcagaggaattacaggcctattc---------c
C1BLI0_BCL2L1-01        -----------actttcacagaggaattatcctatttctc---------a
A0A3B3ZMX9_BCL2L1-      -----------actgtctcagcgggactgtcctctgcagc---------a
A0A3B3ZMX9_BCL2L1-      -----------actgtctcagcgggactgtcct-----------------
A0A667Y1V0_BCL2L1-      -----------actgtctcagaggaactatcccacttgtc---------a
A0A3P8XFS0_BCL2L1-      -----------actgtcccagaggaattattcctgttgtg---------a
A0A3P8XFS0_BCL2L1-      -----------actgtcccagaggaattattcctgttgtg---------a
A0A4W5LYF9_BCL2L1-      -----------actgtcccagagaaattatccatgttgtc---------a
A0A6F8ZUL6_BCL2L1-      -----------actgtcccagagaaattatccatgttgtc---------a
A0A674C4N2_BCL2L1-      -----------actgtcccagagaaattatccatgttgtc---------a
A0A8C7RD80_BCL2L1-      -----------actgtcccagagaaattatccatgttgtc---------a
A0A8C7CBC7_BCL2L1-      -----------actgtcccagagaaattatccatgttgtc---------a
A0A8C7CBC7_BCL2L1-      -----------actgtcccagagaaattatccatgttgtc---------a
A0A8C8GSY4_BCL2L1-      -----------actgtcccagagaaattatccatgttgtc---------a
A0A8C8GSY4_BCL2L1-      -----------actgtcccagagaaattatccatgttgtc---------a
A0A6F9CY91_BCL2L1-      -----------actgtcccagaggaattattcattttgtc---------a
A0A060XE41_BCL2L1-      -----------actgtcccagaggaattattcatgttgtc---------a
A0A286MU87_BCL2L1-      -----------actgtcccagaggaattattcatgttgtc---------a
A0A8C8J941_BCL2L1-      -----------actgtcccagaggaattattcatgttgtc---------a
A0A8C7FX38_BCL2L1-      -----------actgtcccagaggaattattcatgttgtc---------a
A0A4W5JPK5_BCL2L1-      -----------actgtcccagaggaattattcatgttgtc---------a
C0HAD8_BCL2L1-01        -----------actgtcccagaggaattattcatgttgtc---------a
A0A673Z4J6_BCL2L1-      -----------actgtcccagaggaattattcatgttgtc---------a
A0A3B3QRZ2_BCL2L1-      -----------actgtcccagaggaacta---caatggcc---------a
A0A3P8UWG7_BCL2L1-      -----------actttcccagaggaactttcccgtccacc---------a
A0A345BSW9_BCL2L1-      -----------actctcgcagaggaactacccctgcaacc---------a
B2GRK1_BCL2L1-01        -----------actctcgcagaggaactacccctgcaacc---------a
B2GRK1_BCL2L1-02        -----------actctcgcagaggaactacccctgcaacc---------a
Q90Z98_BCL2L1-01        -----------actctcgcagaggaactacccctgcaacc---------a
A0A672K8R2_BCL2L1-      -----------actctcgcagaggaactacccctacaacc---------a
A0A8C1JXA4_BCL2L1-      -----------actctcacagaggaactacccgtacaatc---------a
A0A673M4N6_BCL2L1-      -----------actctcacagaggaactacccctacaatc---------a
A0A673M4N6_BCL2L1-      -----------actctcacagaggaactacccctacaatc---------a
A0A671QPE4_BCL2L1-      -----------actctcacagaggaactacccctacaatc---------a
A0A672N8N5_BCL2L1-      -----------actctcacagaggaactacccctacaatc---------a
A0A671K7W7_BCL2L1-      -----------actctcgcagaggaactacccctacaacc---------a
A0A671K7W7_BCL2L1-      -----------actctcgcagaggaactacccctacaacc---------a
A0A673IGS5_BCL2L1-      -----------actctcgcagaggaactacccctacaacc---------a
A0A8C5D4L1_BCL2L1-      -----------actggctcagagggactttcccacatccc---------c
A0A8C5D4L1_BCL2L1-      -----------actggctcagagggactttcccacatccc---------c
A0A8C5D4L1_BCL2L1-      -----------actggctcagagggactttcccacatccc---------c
A0A4W4GHX3_BCL2L1-      -----------actctcccagaggaactatccctgtagcc---------a
A0A3B4DTL9_BCL2L1-      -----------actctcccagaggaactatccctataacc---------a
A0A3B1JJ42_BCL2L1-      -----------actctcacagaggaactatcctactaatc---------a
A0A8B9LKW7_BCL2L1-      -----------actctcacagaggaactatcctactaatc---------a
A0A8C9SVL8_BCL2L1-      -----------actgtcccaaaggaactactgt---agtc---------a
A0A8C4CMF6_BCL2L1-      -----------actgtcccagaggaactaccctctgagcc---------a
A0A3B3TFR4_BCL2L1-      -----------gctggcccagaagaattactccattgccc---------a
A0A3P8XYL5_BCL2L1-      -----------actatcccagagaaactaccccatcaatc---------a
A0A6F9B188_BCL2L1-      -----------actatcacagagagactaccccttcaacc---------a
A0A4W5R2W6_BCL2L1-      -----------actttcacagagagactaccccttcaacc---------a
A0A4W5R2W6_BCL2L1-      -----------actttcacagagagactaccccttcaacc---------a
A0A674C578_BCL2L1-      -----------actatcacagagagactaccccttcaacc---------a
A0A674C578_BCL2L1-      -----------actatcacagagagactaccccttcaacc---------a
A0A8C7IJ10_BCL2L1-      -----------actatcacagagagactaccccttcaacc---------a
A0A8C8D057_BCL2L1-      -----------actatcacagagagactaccccttcaacc---------a
A0A8C7P574_BCL2L1-      -----------actatcacagagagactaccccttcaacc---------a
A0A8C7IJ10_BCL2L1-      -----------actatcacagagagactaccccttcaacc---------a
A0A8C8D057_BCL2L1-      -----------actatcacagagagactaccccttcaacc---------a
A0A6F9BJ02_BCL2L1-      -----------actatcacagagggactaccccttcaatc---------a
A0A4W5NQ40_BCL2L1-      -----------actatcacagagggactaccccttcaacc---------a
A0A8C7UB69_BCL2L1-      -----------actatcacagagggactaccccttcaacc---------a
A0A8C7J9N8_BCL2L1-      -----------actatcacagagggactaccccttcaacc---------a
A0A8C8FJG7_BCL2L1-      -----------actatcacagagggactaccctttcaacc---------a
B5XAY3_BCL2L1-01        -----------actatcacagagggactaccccttcaacc---------a
A0A674C337_BCL2L1-      -----------actatcacagagggactaccccttcaacc---------a
A0A8C9SET9_BCL2L1-      -----------gctggcccagaagaactactcgtttgccc---------a
A0A8C5G971_BCL2L1-      -----------actgtctcagaggaactaccctctggacc---------a
A0A8C5FC81_BCL2L1-      -----------gctggcccagaagaacttccccctcaacc---------a
A0A665VM40_BCL2L1-      -----------actttcccagagaaactatcctctcaacc---------a
A0A3Q3WIW8_BCL2L1-      -----------actctcccatagaggctgtcctctcaacc---------a
A0A3B5PQJ0_BCL2L1-      -----------actgtctcagaggaactatccgatccaac---------a
A0A3P9N9Y4_BCL2L1-      -----------actatctcagaggaactatccgatccaac---------a
A0A3B3WI27_BCL2L1-      -----------actgtctcagaggaactatccgatccaac---------a
A0A087X9B7_BCL2L1-      -----------actgtctcagaggaactatccgatccaac---------a
A0A3B3TUS7_BCL2L1-      -----------actgtctcagaggaactatccgatccaac---------a
A0A3Q2FR43_BCL2L1-      -----------actgtctcagaggaactatcccgtcaacc---------a
A0A3Q3B3X5_BCL2L1-      -----------actgtcacagagaaactatcctgtcaatc---------a
A0A667ZHE8_BCL2L1-      -----------actctcccagaggaactatcctttcaacc---------a
A0A3Q3G2E1_BCL2L1-      -----------attctctcagagaaattatcctcttaatc---------a
A0A3Q3G2E1_BCL2L1-      -----------attctctcagagaaattatcctcttaatc---------a
A0A3Q3G2E1_BCL2L1-      -----------attctctcagagaaattatcctcttaatc---------a
A0A3Q3MX20_BCL2L1-      -----------actctcccagagaaactatcctctcatct---------a
A0A0D6DR75_BCL2L1-      -----------actgtcggagaaaaactatcctctcaacc---------a
A0A3Q1GZ93_BCL2L1-      -----------actatcccagagaaactatcctctcaacc---------a
A0A4W6BQD5_BCL2L1-      -----------actctctcagagaaactatccactcaacc---------a
A0A3B4V3T1_BCL2L1-      -----------gctctcccagagaaactatcctctcaccc---------a
A0A3B4XU17_BCL2L1-      -----------gctctcccagagaaactatcctctcaccc---------a
A0A673BZP5_BCL2L1-      -----------actctcccagagaaactatcccatcaacc---------a
A0A671WXV0_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
A0A219P0Y3_BCL2L1-      -----------actaacccagagaaactatcctctcaacc---------a
A0A8C9WU15_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
A0A1A7ZDF6_BCL2L1-      -----------actgtcacagaggaactatcccctcaacc---------a
A0A8F0MQ26_BCL2L1-      -----------actctcccagaggaactatcctctcaact---------a
A0A672IDC1_BCL2L1-      -----------actgtcccagaggaactaccctctcaacc---------a
A0A672IDC1_BCL2L1-      -----------actgtcccagaggaactaccctctcaacc---------a
A0A3Q0RTF8_BCL2L1-      -----------actatcccagagaaactatcctctcaacc---------a
A0A668RI12_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
I3IZK7_BCL2L1-01        -----------actctcccagagaaactatcctctcaacc---------a
A0A3Q4N4B5_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
A0A3Q2X557_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
A0A3P8P0F1_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
A0A3P9D632_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
A0A3P9D632_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
A0A3B4FNX1_BCL2L1-      -----------actctcccagagaaactatcctctcaacc---------a
A0A8C2ZZ68_BCL2L1-      -----------actctcccagaggaactatcccctcaccc---------a
G3NJY1_BCL2L1-01        -----------actctcccagaggaacttacccctcaacc---------a
A0A3B3DHA1_BCL2L1-      -----------actgtctcagaggaactaccccctcaacc---------a
A0A3P9JYH1_BCL2L1-      -----------actgtctcagaggaactaccccctcaacc---------a
A0A3B3IB64_BCL2L1-      -----------actgtctcagaggaactaccccctcaacc---------a
A0A8C7YJI1_BCL2L1-      -----------actgtctcagaggaactaccccctcaacc---------a
C3VIT1_BCL2L1-01        -----------actctcccagagaaactatcctctcaacc---------a
A0A3B4Z3X2_BCL2L1-      -----------actctcccagagaaactatcccctcaatc---------a
A0A3B4Z3X2_BCL2L1-      -----------actctcccagagaaactatcccctcaatc---------a
A0A3Q1FR00_BCL2L1-      -----------actgtcccagagaaactatcccctcaacc---------a
A0A3Q1FR00_BCL2L1-      -----------actgtcccagagaaactatcccctcaacc---------a
A0A3Q1DHJ3_BCL2L1-      -----------actctcccagagaaactatcccctcaacc---------a
A0A3Q1DHJ3_BCL2L1-      -----------actctcccagagaaactatcccctcaacc---------a
A0A3Q1DHJ3_BCL2L1-      -----------actctcccagagaaactatcccctcaacc---------a
A0A3P8TL99_BCL2L1-      -----------actctcccagagaaactatcccctcaacc---------a
A0A3P8TL99_BCL2L1-      -----------actctcccagagaaactatcccctcaacc---------a
A0A8C6UPI9_BCL2L1-      -----------gttaacacagaaaaactacccatgctctc---------t
A0A3B4BFZ8_BCL2L1-      -----------attatcacagaaaaactacccaagttcgc---------t
A0A3B3E2W4_BCL2L1-      -----------gatgtcatccagagactatcctgtgtccc---------t
A0A3P9MKK4_BCL2L1-      -----------gatgtcatgcagggactatcctgtgtccc---------t
A0A3P9MKK4_BCL2L1-      -----------gatgtcatgcagggactatcctgtgtccc---------t
A0A3B3I2Q5_BCL2L1-      -----------gatgtcatgcagggactatcctgtgtccc---------t
A0A3B3I2Q5_BCL2L1-      -----------gatgtcatgcagggactatcctgtgtccc---------t
A0A3P9I2N4_BCL2L1-      -----------gatgtcatgcagggactatcctgtgtccc---------t
A0A3P9I2N4_BCL2L1-      -----------gatgtcatgcagggactatcctgtgtccc---------t
A0A8C7XSQ2_BCL2L1-      -----------gatgtcatgcagggactatcctgtgtccc---------t
A0A8C7XSQ2_BCL2L1-      -----------gatgtcatgcagggactatcctgtgtccc---------t
A0A3P8VMA1_BCL2L1-      -----------gctttctcagaggaactacccagaatctc---------t
A0A3Q2C6K4_BCL2L1-      -----------actgtctcagacaaactgcccaaactctc---------t
A0A3B5MGS2_BCL2L1-      -----------attgtctcagagaaactattcaagctctc---------t
M4A558_BCL2L1-01        -----------attgtctcagagaaactattcaagctctc---------t
A0A3P9QFB3_BCL2L1-      -----------attgtctcagagaaactattcaagctctc---------t
A0A3B3XN57_BCL2L1-      -----------attgtctcagagaaactattcaagctctc---------t
A0A087YBW4_BCL2L1-      -----------attgtctcagagaaactattcaagctctc---------t
A0A3B3VWI7_BCL2L1-      -----------attgtctcagagaaactattcaagctctc---------t
A0A1A8A2S0_BCL2L1-      -----------gttgtcccaaaggaactgtcccatgtctc---------t
A0A672JL90_BCL2L1-      -----------gctgtctcagaggaaccatccgtcctccc---------t
A0A672Z262_BCL2L1-      -----------gctgtcgcagaaaaattacccgtcctctc---------t
A0A3Q3BEB7_BCL2L1-      -----------gttgtctcagaggaactgttcgaagtctc---------t
A0A0F7L1T6_BCL2L1-      -----------gctgtctcagaggaactacccatcttctc---------t
H2U5I3_BCL2L1-01        -----------gctgtctcagaggaactacccaacttctc---------t
A0A8C2ZH46_BCL2L1-      -----------gctgtcgcagaagaactacccaacctctc---------t
G3P7B4_BCL2L1-01        -----------gctgtctcagaagaaccacccaacctctc---------t
A0A3Q3FUB6_BCL2L1-      -----------actgtctcagaggaactatccaacctatg---------t
A0A3Q3X5M5_BCL2L1-      -----------actgactcaaaagaactacccaacctctc---------t
A0A665VSD7_BCL2L1-      -----------actgcctc------------tggcctcgc---------t
A0A8D3CTR5_BCL2L1-      -----------gctgtcccagaggaactacccgacctctc---------t
A0A3Q1JZ46_BCL2L1-      -----------actgtctcaaagaaaccacccagcctctc---------t
A0A3B5B4X7_BCL2L1-      -----------gctgtctcaaaggaactatccaacgtctc---------t
A0A3Q1EVP6_BCL2L1-      -----------gctgtctcaaaggaactatccgatgtctc---------t
A0A6G7K5D7_BCL2L1-      -----------gctgtctcaaaggaactatccgacgtctc---------t
A0A3Q1BQA0_BCL2L1-      -----------gctgtctcaaaggaactatccgacgtctc---------t
A0A3P8U812_BCL2L1-      -----------gctgtctcaaaggaactatccgacgtctc---------t
A0A3Q3NFM4_BCL2L1-      -----------gctgtctcagaagaactacccgacctctc---------t
A0A4W6EST2_BCL2L1-      -----------gctttctcagaggaaccacccaacctctc---------t
A0A3B4V9K8_BCL2L1-      -----------actgtctcaaagtaactgcccaacctcac---------t
A0A3B4XS24_BCL2L1-      -----------actgtctcaaagtaactgcccaacctcac---------t
A0A510BW31_BCL2L1-      -----------gctgtctcagaggaaccacccgacctctc---------t
A0A8D0AAQ8_BCL2L1-      -----------gctgtctcagagaaactattcaacctctc---------t
A0A8C4IRU9_BCL2L1-      -----------actgtctcagaggaaccacccaacctctc---------t
E6ZFR0_BCL2L1-01        -----------actgtctcagaggaaccacccaacctctc---------t
                                                                          

R4JQR8_BCL2L1-01        ------------------------ggaatgcgatgggac-----------
A0A346RRN1_BCL2L1-      ------------------------ggattacaatgggaa-----------
A0A8C4STP1_BCL2L1-      -----------------agtatttcggagacagtaggac---------tg
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        gttctccaataatcccca------acccaatgccatatc-----------
Q2TAP5_BCL2L1-01        gttctccaataatcccca------acccaatgccatatc-----------
Q91828_BCL2L1-01        gttctccaataat-ccca------acccaatgccatatc-----------
A0A8C5WFB8_BCL2L1-      ctcacattctgagg---t------tctatctaatgggac-----------
A0A4X2KZ04_BCL2L1-      --------------------------------------c---------tc
F6WA14_BCL2L1-01        gtt---tgaagat---------------gagaacaggac---------tg
A0A7N4P3X2_BCL2L1-      gtt---tgaagat---------------gagaacaggac---------tg
A0A7N4P3X2_BCL2L1-      gtt---tgaagat---------------gagaacaggac---------tg
A0A8C5YLY6_BCL2L1-      gtt---tagccgtg---a------ggaagagaaccgcgt---------tc
A0A8D2IA38_BCL2L1-      gtt---tagccatg---a------ggaagagaaccgcgt---------tc
A0A8D2IA38_BCL2L1-      gtt---tagccatg---a------ggaagagaaccgcgt---------tc
G3SPN0_BCL2L1-01        gtt---tagtgatg---t------ggaggagaataggac---------tg
O35843_BCL2L1-01        gtt---tagtgatg---t------tgaagagaataggac---------tg
Q7TS62_BCL2L1-02        gtt---tagcgatg---t------cgaagagaacaggac---------tg
Q7TS62_BCL2L1-03        gtt---tagcgatg---t------cgaagagaacaggac---------tg
Q5HZH3_BCL2L1-02        gtt---tagtgatg---t------cgaagagaataggac---------tg
A0A8C6G6C7_BCL2L1-      gtt---tagtgatg---t------cgaagagaataggac---------tg
Q7TS62_BCL2L1-01        gtt---tagcgatg---t------cgaagagaacaggac---------tg
A0A6I9LMY5_BCL2L1-      gtt---tagtgatg---t------cgaagaggacaggac---------tg
B2Z3Z4_BCL2L1-01        gtt---tagtgatg---t------cgaagagaacaggac---------tg
A0A8C6W748_BCL2L1-      gtt---cagtgatg---t------cgaagagaacaggac---------tg
H0X6V2_BCL2L1-01        gtt---tagcgatg---t------ggaagagaacaggac---------tg
A0A286Y5D6_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A8D2AGI2_BCL2L1-      gtt---tagcgatg---t------ggaagataataggac---------tg
A0A287CZ07_BCL2L1-      gtt---tagcgatg---t------ggaagagaacaggac---------tg
A0A8C9UNM3_BCL2L1-      gtt---tagcgatg---t------ggaagagaacaggac---------tg
A0A8D2I760_BCL2L1-      gtt---tagtgatg---t------ggaagagaataagat---------tg
A0A8C2YUU6_BCL2L1-      gtt---cagtgatg---t------ggaagagaacaggac---------tg
A0A8C2YUU6_BCL2L1-      gtt---cagtgatg---t------ggaagagaacaggac---------tg
A0A8C2YUU6_BCL2L1-      gtt---cagtgatg---t------ggaagagaacaggac---------tg
G1P9D2_BCL2L1-01        gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8C5NZI4_BCL2L1-      gtt---tagtgatg---t------cgaagagaacaggac---------tg
A0A3Q2H0F6_BCL2L1-      gtt---tagtgacg---t------ggaagagaacagaac---------tg
A0A8B9XQH5_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
Q05KJ0_BCL2L1-01        gtt---tagtgatg---t------ggaagagaacagaac---------tg
Q05KJ0_BCL2L1-02        gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8C6DX24_BCL2L1-      gtt---tagtgatg---t------ggaagaaaacagaac---------tg
A0A452FWV3_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
Q9MZS7_BCL2L1-01        gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8C3WJH5_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8D1ALD6_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A4X1SQU7_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8D0XF62_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
O77737_BCL2L1-01        gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8D0J6V8_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8D0J6V8_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8D0J6V8_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8D0J6V8_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8D0J6V8_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A4X1SQU7_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A4X1SQU7_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A4X1SQU7_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A4X1SRM7_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8D0XF62_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8D1ALD6_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A4X1SQU7_BCL2L1-      gtt---tactgatg---t------ggaagagaacagaac---------tg
A0A8C4L2X1_BCL2L1-      gtt---tagtgacg---t------ggaagagaacagaac---------tg
A0A3Q2H0F6_BCL2L1-      gtt---tagtgacg---t------ggaagagaacagaac---------tg
A0A250YD48_BCL2L1-      gtt---tagtgatg---t------ggaagagaataggac---------tg
A0A1L5BWY3_BCL2L1-      gtt---tagtgatg---t------ggaagagaataggac---------tg
A0A8B7FNN3_BCL2L1-      gtt---tattgatg---c------agaagaaaataggac---------tg
A0A8B7FNN3_BCL2L1-      gtt---tattgatg---c------agaagaaaataggac---------tg
A0A8B7FNN3_BCL2L1-      gtt---tattgatg---c------agaagaaaataggac---------tg
A0A8B7FNN3_BCL2L1-      -----------atg---c------agaagaaaataggac---------tg
A0A2K6G3C5_BCL2L1-      gtt---tatcgatg---c------agaagagaacaggac---------tg
A0A2K6G3C5_BCL2L1-      -----------atg---c------agaagagaacaggac---------tg
E2IV76_BCL2L1-01        gtt---tatcgatg---c------agaagagaacaggac---------tg
A0A8C8YN28_BCL2L1-      gtt---tatcgatg---c------agaagagaacaggac---------tg
A0A8I3ZZI7_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A5F7ZJK5_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K6UWY8_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
E2IV77_BCL2L1-01        gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K6UWY8_BCL2L1-      -----------atg---t------ggaagagaacaggac---------tg
A0A8I3ZZI7_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K5EBP4_BCL2L1-      -----------atg---t------ggaagagaacaggac---------tg
A0A2K5EBP4_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
E2IV75_BCL2L1-01        gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A6D2VXZ3_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
G1RER8_BCL2L1-01        gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A7I2V597_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2R8Z9D7_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2R8Z9D7_BCL2L1-      -----------atg---t------ggaagagaacaggac---------tg
A0A2K5H963_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K5H963_BCL2L1-      -----------atg---t------ggaagagaacaggac---------tg
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K6QFA2_BCL2L1-      -----------atg---t------ggaagagaacaggac---------tg
A0A2K5M8B1_BCL2L1-      -----------atg---t------ggaagagaacaggac---------tg
A0A2K5M8B1_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K5VPG2_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A8I5MVB8_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A8D2ERY7_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K5YR37_BCL2L1-      -----------atg---t------ggaagagaacaggac---------tg
A0A2K5YR37_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K5VPG2_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A5F7ZJK5_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A5F7ZJK5_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A5F7ZJK5_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A5F7ZJK5_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
A0A0D9RJZ8_BCL2L1-      att---tagtgatg---t------ggaagagaacaggac---------tg
I7GKS6_BCL2L1-01        -----------atg---t------ggaagagaacaggac---------tg
A0A2K6QFA2_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K6QFA2_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A2K5YR37_BCL2L1-      gtt---tagtgatg---t------ggaagagaacaggac---------tg
A0A5F5XYW0_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8C7BPR9_BCL2L1-      gtt---tagtgatg---c------agaagagaacagaac---------tg
A0A5F5XYW0_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8B8VBB9_BCL2L1-      gtt---tagtgatg---t------ggacgagaacagaac---------tg
A0A8C6F2V6_BCL2L1-      gtt---tagcgatg---t------ggacgagaacagaac---------tg
A0A8C9BM97_BCL2L1-      gtt---tagcgatg---t------ggacgagaacagaac---------tg
M3Z2H9_BCL2L1-01        gtt---tagtgatg---c------agaagagaacagaac---------tg
A0A8C7BPR9_BCL2L1-      gtt---tagtgatg---c------agaagagaacagaac---------tg
A0A5F5XYW0_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8C0TGM4_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
Q76LT7_BCL2L1-01        gtt---tagtgatg---t------ggaagagaacagaac---------tg
Q8SQ42_BCL2L1-01        gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A673UUI0_BCL2L1-      gtt---tagcgatg---t------ggaagagaacagaac---------tg
A0A452SDS4_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A384D3U1_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8C9D5N1_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A8C9M2S8_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A667HK09_BCL2L1-      gtt---tagtgatg---t------ggaagagaacagaac---------tg
A0A3Q1LRT3_BCL2L1-      gtt---tagtgt---------------------cagata---------tg
A0A4W2D608_BCL2L1-      gtt---tagtggta---t------gaaagaacacagaac---------tg
A0A4W2D608_BCL2L1-      gtt---tagtggta---t------gaaagaacacagaac---------tg
A0A4W2F845_BCL2L1-      gtt---tagtgt---------------------cagata---------tg
A0A4W2F845_BCL2L1-      gtt---tagtgt---------------------cagata---------tg
A0A8B9WB42_BCL2L1-      gtt---tagtgt---------------------cagata---------tg
A0A8C6FN58_BCL2L1-      gtt---tagtgata---t------ggaagagaacagaac---------tg
A0A452E1B1_BCL2L1-      gtt---tagtgata---t------ggaagagaacagaac---------tg
W5PSA5_BCL2L1-01        gtt---tagtgaca---t------ggaagagaacagaac---------tg
A0A8B9X9C2_BCL2L1-      att---taatgatg---t------ggaagagaacagaac---------tg
A0A452FHY1_BCL2L1-      --------------------------------------------------
A0A452FHY1_BCL2L1-      --------------------------------------------------
H3ANS8_BCL2L1-01        ---------ggagg---t------tggtgag--caggac---------ca
W5MG74_BCL2L1-01        gttcagcctggagg---g---------------caggac---------cg
H9GHK7_BCL2L1-01        gattgagatggaga---g------cggggaggaagcgat---------gg
A0A6I8PIR3_BCL2L1-      gctggtcgacccgg---a------ggccccggacacg-------------
A0A8D0HVA8_BCL2L1-      gct---cgaagggc---a------cgatgagaacaggac---------tg
A0A8D0HVA8_BCL2L1-      gct---cgaagggc---a------cgatgagaacaggac---------tg
A0A8D0HVA8_BCL2L1-      gct---cgaagggc---a------cgatgagaacaggac---------tg
A0A7M4EJG9_BCL2L1-      gct---tgaggggc---a------ggatgagaccaggac---------tg
A0A670IBZ4_BCL2L1-      gct---ggaggagg---a------cagcgagaacaggac---------tg
A0A8D0E1K1_BCL2L1-      cct---ggagggga---a------cggcgaggacaggac---------tg
A0A8D2L5P2_BCL2L1-      gat---cgaaggcg---a------cgagggaagcaggac---------tg
A0A8C6V6T2_BCL2L1-      gat---ccagggcg---a------cagcgaggagcggac---------gg
A0A8C5RX62_BCL2L1-      gat---cgagggtg---a------cggcgaggagcggac---------ag
A0A670Z9Y4_BCL2L1-      gat---cgaggggg---a------cggcgaggagcggac---------gg
A0A8C8S850_BCL2L1-      gtt---ccacgcag---a------ggatgagaacaggac---------tg
K7F655_BCL2L1-01        gtt---cgaggggg---a------ggatgagatcaggac---------tg
A0A8C0IVL6_BCL2L1-      gtt---tgaagggg---a------ggatgagatcaggac---------tg
A0A8C4W8N7_BCL2L1-      gtt---cgaagggg---a------ggatgagatcaggac---------tg
A0A8C3RIU8_BCL2L1-      gtt---cgaggggg---a------ggatgagatcaggac---------tg
A0A8C3IUT0_BCL2L1-      gtt---cgaggggg---a------ggatgagatcaggac---------tg
A0A8C3IUT0_BCL2L1-      gtt---cgaggggg---a------ggatgagatcaggac---------tg
A0A8C3IUT0_BCL2L1-      gtt---cgaggggg---a------ggatgagatcaggac---------tg
A0A8C3IUT0_BCL2L1-      gtt---cgaggggg---a------ggatgagatcaggac---------tg
A0A674J5J7_BCL2L1-      gtt---tgaggggg---a------ggatgagatcaggac---------tg
A0A8B9CUX0_BCL2L1-      gctggaggaggagg---a------ggatgagaacaggac---------tg
A0A8B9DB39_BCL2L1-      gctggaggaggagg---a------ggatgagaacaggac---------tg
A0A493TIA6_BCL2L1-      gct---ggaggaag---a------ggatgagaacaggac---------tg
A0A8C3CGW6_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8B9SM69_BCL2L1-      gct---ggaggaag---a------ggatgagaacaggac---------tg
A0A8B9V5I0_BCL2L1-      gct---ggaggaag---a------ggatgagaacaggac---------tg
A0A8C7ECQ9_BCL2L1-      gct---gcaggagg---a------ggatgagaacaggac---------tg
A0A669P0Q7_BCL2L1-      gct---ggaggaag---a------ggatgagaacaggac---------tg
A0A8C2T2M7_BCL2L1-      gct---ggaggaag---a------ggatgagaacaggac---------tg
A0A8C9EN38_BCL2L1-      gct---ggaggaag---a------ggatgagaacaggac---------tg
A0A8C3LRK6_BCL2L1-      gct---ggaggaag---a------ggatgagaacaggac---------tg
G1N5N5_BCL2L1-01        gct---ggaggaag---a------ggatgagaacaggac---------tg
A0A8B9NWH6_BCL2L1-      gct---cgaggaag---a------ggatgagaacaggac---------tg
A0A8B9NWH6_BCL2L1-      gct---cgaggaag---a------ggatgagaacaggac---------tg
A0A8C4JDK2_BCL2L1-      gct---cgaggaag---a------ggatgagaacaggac---------tg
A0A8C4JDK2_BCL2L1-      gct---cgaggaag---a------ggatgagaacaggac---------tg
A0A8C5JFI3_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8D2M680_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A803VLI1_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8C5U1E1_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8C3U3Q2_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8C0U194_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
H0Z8G3_BCL2L1-01        gct---ggaagagg---a------ggatgagaacaggac---------tg
Q4U2V6_BCL2L1-01        gct---ggaagagg---a------ggatgagaacaggac---------tg
A0A8C9NN65_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8C3XCF2_BCL2L1-      gct---ggaggagg---a------agatgagaacaggac---------tg
A0A8D2NN48_BCL2L1-      gct---ggaggagg---a------agatgagaacaggac---------tg
A0A8C0FL84_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8C0AYR5_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8C4TWS5_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8C3KQJ2_BCL2L1-      tct---gcaggagg---a------ggatgagaacaggac---------tg
A0A8C8A4L8_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8D0FHG7_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8B9N2I0_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A663ECL2_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8C0AYR5_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A8B9FKI5_BCL2L1-      gct---ggaggagg---a------ggatgagagcaggac---------tg
A0A672UKR0_BCL2L1-      gct---ggaggagg---a------ggatgagaacaggac---------tg
A0A3B5K6B9_BCL2L1-      caatggactcatattaga------gcctccaagtaggac-----------
H3CH49_BCL2L1-01        cattg---------taga------gccttcaagtaggac-----------
A0A059PJI5_BCL2L1-      catcggcctcacgg--------------aagaggtgaac-----------
A0A8C5B4N8_BCL2L1-      cttccagcccgagg---g------ggcagatgaggggac---------tg
D2ITA2_BCL2L1-02        cttccagcccgagg---g------ggcaggtgaggggac---------tg
C1BLI0_BCL2L1-01        gttgggactggaag---a------tgccagtgaacggac---------ta
A0A3B3ZMX9_BCL2L1-      cctggggctggggg------------------acagga---------gca
A0A3B3ZMX9_BCL2L1-      -ctggggctggagg------------------atggtacggagattgaca
A0A667Y1V0_BCL2L1-      gctggggctggagg---a------ggccagcgaaaggac---------tg
A0A3P8XFS0_BCL2L1-      attggagctggagg---g------tgcaagtggacggac---------tg
A0A3P8XFS0_BCL2L1-      attggagctggagg---g------tgcaagtggacggac---------tg
A0A4W5LYF9_BCL2L1-      attggtgctggagg---g------tgcaagtggacggac---------tg
A0A6F8ZUL6_BCL2L1-      attggtgctggagg---g------tgcaagtggacggac---------tg
A0A674C4N2_BCL2L1-      gttggtgctggagg---g------tgcaagtgggcggac---------tg
A0A8C7RD80_BCL2L1-      gttggtgctggagg---g------tgcaagtggacggac---------tg
A0A8C7CBC7_BCL2L1-      gttggtgctggagg---g------tgcaagtggacggac---------tg
A0A8C7CBC7_BCL2L1-      gttggtgctggagg---g------tgcaagtggacggac---------tg
A0A8C8GSY4_BCL2L1-      gttggtgctggagg---g------tgcaagtggacggac---------tg
A0A8C8GSY4_BCL2L1-      gttggtgctggagg---g------tgcaagtggacggac---------tg
A0A6F9CY91_BCL2L1-      attggggctggagg---g------tgtaagtggacggac---------tg
A0A060XE41_BCL2L1-      attggggctggagg---g------tgcaagtggacggac---------tg
A0A286MU87_BCL2L1-      attggggctggagg---g------tgcaagtggacggac---------tg
A0A8C8J941_BCL2L1-      attggggctggagg---g------tgcaagtggacagac---------tg
A0A8C7FX38_BCL2L1-      attggggctggagg---g------tgcaagtggacggac---------tg
A0A4W5JPK5_BCL2L1-      gttggggctggagg---g------tgcaagtggacggac---------tg
C0HAD8_BCL2L1-01        attggggctggagg---g------tgcaagtggacggac---------tg
A0A673Z4J6_BCL2L1-      attggggctggagg---g------tgcaagtggacggac---------tg
A0A3B3QRZ2_BCL2L1-      ctttgggcttcctg---a------agacaggggtcggac-----------
A0A3P8UWG7_BCL2L1-      cctgggactcggtg---a------ttctccaaacaggac---------tg
A0A345BSW9_BCL2L1-      cattgggcttacag---a------agacacaaatcggac---------tg
B2GRK1_BCL2L1-01        cattggacttacag---a------agacacaaatcggac---------tg
B2GRK1_BCL2L1-02        cattggacttacag---a------agacacaaatcggac---------tg
Q90Z98_BCL2L1-01        cattggacttacag---a------agacacaaatcggac---------tg
A0A672K8R2_BCL2L1-      cattgaatttacag---a------agacacaaatcggac---------tg
A0A8C1JXA4_BCL2L1-      cattgaatttacag---a------agacacacatcggac---------tg
A0A673M4N6_BCL2L1-      cattgaatttacag---a------agacacaaatcggac---------tg
A0A673M4N6_BCL2L1-      cattgaatttacag---a------agacacaaatcggac---------tg
A0A671QPE4_BCL2L1-      cattgaatttacag---a------agacacaaatcggac---------tg
A0A672N8N5_BCL2L1-      cattgaatttacag---a------agacacaaatcggac---------tg
A0A671K7W7_BCL2L1-      cattgaatttacag---a------agacacaaatcggac---------tg
A0A671K7W7_BCL2L1-      cattgaatttacag---a------agacacaaatcggac---------tg
A0A673IGS5_BCL2L1-      cattgaatttacag---a------agacacaaatcggac---------tg
A0A8C5D4L1_BCL2L1-      gctgaggctgcagg---a------taccagggacaggac-----------
A0A8C5D4L1_BCL2L1-      gctgaggctgcagg---a------taccagggacaggac-----------
A0A8C5D4L1_BCL2L1-      gctgaggctgcagg---a------taccagggacaggac-----------
A0A4W4GHX3_BCL2L1-      catcgggctcacag---a------agatatgggccagac---------tg
A0A3B4DTL9_BCL2L1-      cattgggcttatgg---a------agacacaaatcggac---------tg
A0A3B1JJ42_BCL2L1-      catcggactcatgg---a------agaaacaaatcgaac---------tg
A0A8B9LKW7_BCL2L1-      catcggactcgtgg---a------agaaacaaatcgaac---------tg
A0A8C9SVL8_BCL2L1-      ctttgagtttcccg---a------ggacgggagtcggaccgagcgctcgg
A0A8C4CMF6_BCL2L1-      cgtcggcct--------g------acccaccagatggag---------tc
A0A3B3TFR4_BCL2L1-      catcatacaggacg--aa------gccgacgagcaga-------------
A0A3P8XYL5_BCL2L1-      cactgggctcacag---g------agcatttgatcggac---------tg
A0A6F9B188_BCL2L1-      cactgggctcacag---a------agctcccagtcagactgaggggggtg
A0A4W5R2W6_BCL2L1-      cattgggctcacag---a------agctcccagtcggactgaggggggtg
A0A4W5R2W6_BCL2L1-      cattgggctcacag---a------agctcccagtcggactgaggggggtg
A0A674C578_BCL2L1-      cattgggctcacag---a------agctcccagtcggac---------tg
A0A674C578_BCL2L1-      cattgggctcacag---a------agctcccagtcggac---------tg
A0A8C7IJ10_BCL2L1-      cattgggctcacag---a------agctcccagtcggac---------tg
A0A8C8D057_BCL2L1-      cattgggctcacag---a------agctcccagtcggactgagggggatg
A0A8C7P574_BCL2L1-      cattgggctcacag---a------agctcccagtcggactgagggggatg
A0A8C7IJ10_BCL2L1-      cattgggctcacag---a------agctcccagtcggac---------tg
A0A8C8D057_BCL2L1-      cattgggctcacag---a------agctcccagtcggactgagggggatg
A0A6F9BJ02_BCL2L1-      cattgggctcacgg---a------atcccagagtcggac---------tg
A0A4W5NQ40_BCL2L1-      cattgagctcacgg---a------agcccagaatcggac---------tg
A0A8C7UB69_BCL2L1-      catggagctcacag---a------agcccagaatcggac---------tg
A0A8C7J9N8_BCL2L1-      catggagctcacag---a------agcccagaatcggac---------tg
A0A8C8FJG7_BCL2L1-      catggagctcacag---a------agcccagaattgtac---------tg
B5XAY3_BCL2L1-01        catggagctcacgg---a------agcccagaatcggac---------tg
A0A674C337_BCL2L1-      catggagctcacgg---a------agcccagaatcggac---------tg
A0A8C9SET9_BCL2L1-      cttcgtgc---------------------cggaaagggc---------cc
A0A8C5G971_BCL2L1-      catagtgctcaatg---a------gcctccacacaggac---------cg
A0A8C5FC81_BCL2L1-      cctcacactggcggccac------gcccccaaaccggac---------tg
A0A665VM40_BCL2L1-      catggagttcaatg---a------atctcttcacaggac---------tg
A0A3Q3WIW8_BCL2L1-      catgggactcatag---a------gcctcccaacaggac---------tg
A0A3B5PQJ0_BCL2L1-      catattgcccaacg---a------gcccccggacggcac---------cg
A0A3P9N9Y4_BCL2L1-      catattgcccaatg---a------gcccccggacagcac---------cg
A0A3B3WI27_BCL2L1-      catattgcccaatg---a------gcccccggacagcac---------cg
A0A087X9B7_BCL2L1-      catattgcccaatg---a------gcccccggacagcac---------cg
A0A3B3TUS7_BCL2L1-      catattgcccaatg---a------gcccccggacagcac---------cg
A0A3Q2FR43_BCL2L1-      cataatgctcaacg---a------gccgcccaacggcac---------cg
A0A3Q3B3X5_BCL2L1-      cataatactcagtg---a------tcctccgaatagaac---------tg
A0A667ZHE8_BCL2L1-      catcgggctcatag---a------gtccccaaacaggac---------tg
A0A3Q3G2E1_BCL2L1-      catggaactcttag---a------gcctccaaacaggac---------tg
A0A3Q3G2E1_BCL2L1-      catggaactcttag---a------gcctccaaacaggac---------tg
A0A3Q3G2E1_BCL2L1-      catggaactcttag---a------gcctccaaacaggac---------tg
A0A3Q3MX20_BCL2L1-      catagaactcaatg---a------gcaacagaacaggac---------tg
A0A0D6DR75_BCL2L1-      cttgggactcagtg---a------gcctccaaacaggac---------tg
A0A3Q1GZ93_BCL2L1-      cttgggactcaatg---a------gactcccaacaggac---------tg
A0A4W6BQD5_BCL2L1-      catggaactcaatg---a------gcctccaaacaggac---------tg
A0A3B4V3T1_BCL2L1-      catggaactcaatg---a------gtctcccaacaggac---------tg
A0A3B4XU17_BCL2L1-      catggaactcaatg---a------gtctcccaacaggac---------tg
A0A673BZP5_BCL2L1-      cattggactcatag---a------accccccagcaggac---------tg
A0A671WXV0_BCL2L1-      catgggactcatag---a------gtctccaaacaggac---------tg
A0A219P0Y3_BCL2L1-      catgggactcatag---a------gcctccaaacaggac---------tg
A0A8C9WU15_BCL2L1-      catgggactcatag---a------gccttcgaacaggac---------tg
A0A1A7ZDF6_BCL2L1-      catagtcctcaatg---a------ccccctaaacaggac---------tg
A0A8F0MQ26_BCL2L1-      catgggactcagag---a------gcctccgaacaggac---------tg
A0A672IDC1_BCL2L1-      catagtgctcaatg---a------gcctcccagcaggac---------tg
A0A672IDC1_BCL2L1-      catagtgctcaatg---a------gcctcccagcaggac---------tg
A0A3Q0RTF8_BCL2L1-      catagtactcaacg---a------gccttcgaacaggac---------tg
A0A668RI12_BCL2L1-      catagtactcaacg---a------gcctttgaacaggac---------tg
I3IZK7_BCL2L1-01        catagtactcaacg---a------gcctttgaacaggac---------tg
A0A3Q4N4B5_BCL2L1-      catagtactcaacg---a------gccttcgaacaggac---------tg
A0A3Q2X557_BCL2L1-      catagtactcaacg---a------gccttcgaacaggac---------tg
A0A3P8P0F1_BCL2L1-      catagtactcaacg---a------gccttcgaacaggac---------tg
A0A3P9D632_BCL2L1-      catagtactcaacg---a------gccttcgaacaggac---------tg
A0A3P9D632_BCL2L1-      catagtactcaacg---a------gccttcgaacaggac---------tg
A0A3B4FNX1_BCL2L1-      catagtactcaacg---a------gccttcgaacaggac---------tg
A0A8C2ZZ68_BCL2L1-      catgggactcacag---a------gcctctgaacaggac---------tg
G3NJY1_BCL2L1-01        catagggctgtccg---a------gcctcccaacaggac---------tg
A0A3B3DHA1_BCL2L1-      catagtgctcaatg---a------gtctccgaacaggac---------tg
A0A3P9JYH1_BCL2L1-      catagtgctcaatg---a------gtctccgaacaggac---------tg
A0A3B3IB64_BCL2L1-      catagtgctcaatg---a------gtctccgaacaggac---------tg
A0A8C7YJI1_BCL2L1-      catagtgctcaatg---a------gtctccgaacaggac---------tg
C3VIT1_BCL2L1-01        catagtgctcaatg---a------gcctccgaacaggac---------tg
A0A3B4Z3X2_BCL2L1-      catggtgctcaatg---a------ggctcccaacaggac---------tg
A0A3B4Z3X2_BCL2L1-      catggtgctcaatg---a------ggctcccaacaggac---------tg
A0A3Q1FR00_BCL2L1-      catggtgctgaacg---a------ggctcccaacaggac---------tg
A0A3Q1FR00_BCL2L1-      catggtgctgaacg---a------ggctcccaacaggac---------tg
A0A3Q1DHJ3_BCL2L1-      catggtgctgaatg---a------ggctcccagcaggac---------tg
A0A3Q1DHJ3_BCL2L1-      catggtgctgaatg---a------ggctcccagcaggac---------tg
A0A3Q1DHJ3_BCL2L1-      catggtgctgaatg---a------ggctcccagcaggac---------tg
A0A3P8TL99_BCL2L1-      catggtgctgaatg---a------ggctcccagcaggac---------tg
A0A3P8TL99_BCL2L1-      catggtgctgaatg---a------ggctcccagcaggac---------tg
A0A8C6UPI9_BCL2L1-      gctcatgtcagact---c------tgctcgggttcaatc---------tg
A0A3B4BFZ8_BCL2L1-      gcttatgtcagacc---c------cgctagggtccagtg---------tg
A0A3B3E2W4_BCL2L1-      gctgaaacccacag---a------tgatgggggacaaac---------tg
A0A3P9MKK4_BCL2L1-      gctgaagcccacag---a------cgatgggggagaaac---------tg
A0A3P9MKK4_BCL2L1-      gctgaagcccacag---a------cgatgggggagaaac---------tg
A0A3B3I2Q5_BCL2L1-      gctgaagcccacag---a------cgatgggggagaaac---------tg
A0A3B3I2Q5_BCL2L1-      gctgaagcccacag---a------cgatgggggagaaac---------tg
A0A3P9I2N4_BCL2L1-      gctgaagcccacag---a------tgatgggggagaaac---------tg
A0A3P9I2N4_BCL2L1-      gctgaagcccacag---a------tgatgggggagaaac---------tg
A0A8C7XSQ2_BCL2L1-      gctgaagcccacag---a------cgatgggggagaaac---------tg
A0A8C7XSQ2_BCL2L1-      gctgaagcccacag---a------cgatgggggagaaac---------tg
A0A3P8VMA1_BCL2L1-      tctgatgttgagga---t------tgggggagaacagcg---------tg
A0A3Q2C6K4_BCL2L1-      gctgaggtcggagg---t------cactggtggccggac---------cg
A0A3B5MGS2_BCL2L1-      gctgaggtccgagg---t------tgccgggggcaggac---------ca
M4A558_BCL2L1-01        gctgaggtccgagg---t------tgccgggggcaggac---------ca
A0A3P9QFB3_BCL2L1-      gctgaggtccgagg---c------cgacggggccaggac---------ca
A0A3B3XN57_BCL2L1-      gctgaggtccgagg---c------cgacggggccaggac---------ca
A0A087YBW4_BCL2L1-      gctgaggtccgagg---c------cgacggggccaggac---------ca
A0A3B3VWI7_BCL2L1-      gctgaggtccgagg---c------cgacggggccaggac---------ca
A0A1A8A2S0_BCL2L1-      gctggggccagagg---a------tgggggtaagaagac---------tc
A0A672JL90_BCL2L1-      gctgagaccgcagg---a------tgcacggcaaaggac---------cg
A0A672Z262_BCL2L1-      gctgaggccagatg---a------tgcc------aggac---------tg
A0A3Q3BEB7_BCL2L1-      gctgatgccggagg---t------tgccggtgaaaggac---------cg
A0A0F7L1T6_BCL2L1-      gctgagaccagagg---a------tactgatggaaggac---------ag
H2U5I3_BCL2L1-01        gctgagaccagagg---a------tactgatggaaggac---------ag
A0A8C2ZH46_BCL2L1-      gctgtggccagagg---aggatgccgccggtgggaggac---------gg
G3P7B4_BCL2L1-01        gttgaggccggagg---a------tgccggcggaaggac---------gg
A0A3Q3FUB6_BCL2L1-      gctgaggtcagagg---a------tgctggtgaaaggac---------tg
A0A3Q3X5M5_BCL2L1-      gttaaggccagaag---a------taccggtgggaggac---------tg
A0A665VSD7_BCL2L1-      gctgaggccagagg---a------tgctggtggacagac---------tg
A0A8D3CTR5_BCL2L1-      actgaggccggagg---a------tgctggtggaaggac---------tg
A0A3Q1JZ46_BCL2L1-      tctgaggccagatg---a------taccggtgga---------------g
A0A3B5B4X7_BCL2L1-      gctgaggccggagg---a------tgctgcaggaaggac---------tg
A0A3Q1EVP6_BCL2L1-      gctgaggccagagg---a------tgctggaggaaggac---------tg
A0A6G7K5D7_BCL2L1-      gctgaggccagagg---a------tgctggaggaaggac---------tg
A0A3Q1BQA0_BCL2L1-      gctgaggccagagg---a------tgctggaggaaggac---------tg
A0A3P8U812_BCL2L1-      gctgaggccagagg---a------tgctgaaggaaggac---------tg
A0A3Q3NFM4_BCL2L1-      gctgaggccagaag---a------tgctggtggaaggac---------ag
A0A4W6EST2_BCL2L1-      gctgaggccagagg---a------tgctggtggaaggac---------tg
A0A3B4V9K8_BCL2L1-      gctgaggccagagg---a------tgctggtggaaggac---------tg
A0A3B4XS24_BCL2L1-      gctgaggccagagg---a------tgctggtggaaggac---------tg
A0A510BW31_BCL2L1-      actgaggccagagg---g------tgctgaaggaaggac---------cg
A0A8D0AAQ8_BCL2L1-      gctgaggccagagg---a------tgctggcagaaggac---------tg
A0A8C4IRU9_BCL2L1-      actgaggccggaga---a------tgccggtgaaaggac---------tg
E6ZFR0_BCL2L1-01        actgaggccggaga---a------tgccggtgaaaggac---------tg
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      c-------------------------------------cacaccagggac
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------atctcc------------------------------
A0A4X2KZ04_BCL2L1-      c-------------ggcccc------------------------------
F6WA14_BCL2L1-01        a-------------ggttct------------------------------
A0A7N4P3X2_BCL2L1-      a-------------ggcctc------------------------------
A0A7N4P3X2_BCL2L1-      a-------------ggcctc------------------------------
A0A8C5YLY6_BCL2L1-      a-------------agcccc------------------------------
A0A8D2IA38_BCL2L1-      a-------------aggccc------------------------------
A0A8D2IA38_BCL2L1-      a-------------aggccc------------------------------
G3SPN0_BCL2L1-01        g-------------ggcctc------------------------------
O35843_BCL2L1-01        a-------------ggcccc------------------------------
Q7TS62_BCL2L1-02        a-------------agcccc------------------------------
Q7TS62_BCL2L1-03        a-------------agcccc------------------------------
Q5HZH3_BCL2L1-02        a-------------ggcccc------------------------------
A0A8C6G6C7_BCL2L1-      a-------------ggcccc------------------------------
Q7TS62_BCL2L1-01        a-------------agcccc------------------------------
A0A6I9LMY5_BCL2L1-      a-------------ggctcc------------------------------
B2Z3Z4_BCL2L1-01        a-------------ggcccc------------------------------
A0A8C6W748_BCL2L1-      a-------------ggcccc------------------------------
H0X6V2_BCL2L1-01        a-------------ggcccc------------------------------
A0A286Y5D6_BCL2L1-      a-------------aggccc------------------------------
A0A8D2AGI2_BCL2L1-      a-------------agcccc------------------------------
A0A287CZ07_BCL2L1-      a-------------agcccc------------------------------
A0A8C9UNM3_BCL2L1-      a-------------agcccc------------------------------
A0A8D2I760_BCL2L1-      a-------------agcccc------------------------------
A0A8C2YUU6_BCL2L1-      a-------------aggccc------------------------------
A0A8C2YUU6_BCL2L1-      a-------------aggccc------------------------------
A0A8C2YUU6_BCL2L1-      a-------------aggccc------------------------------
G1P9D2_BCL2L1-01        a-------------ggcccc------------------------------
A0A8C5NZI4_BCL2L1-      a-------------ggcccc------------------------------
A0A3Q2H0F6_BCL2L1-      a-------------ggcccc------------------------------
A0A8B9XQH5_BCL2L1-      a-------------ggcccc------------------------------
Q05KJ0_BCL2L1-01        a-------------ggcccc------------------------------
Q05KJ0_BCL2L1-02        a-------------ggcccc------------------------------
A0A8C6DX24_BCL2L1-      a-------------ggcccc------------------------------
A0A452FWV3_BCL2L1-      a-------------ggcccc------------------------------
Q9MZS7_BCL2L1-01        a-------------ggcccc------------------------------
A0A8C3WJH5_BCL2L1-      a-------------ggcccc------------------------------
A0A8D1ALD6_BCL2L1-      a-------------ggcccc------------------------------
A0A4X1SQU7_BCL2L1-      a-------------ggcccc------------------------------
A0A8D0XF62_BCL2L1-      a-------------ggcccc------------------------------
O77737_BCL2L1-01        a-------------ggcccc------------------------------
A0A8D0J6V8_BCL2L1-      a-------------ggcccc------------------------------
A0A8D0J6V8_BCL2L1-      a-------------ggcccc------------------------------
A0A8D0J6V8_BCL2L1-      a-------------ggcccc------------------------------
A0A8D0J6V8_BCL2L1-      a-------------ggcccc------------------------------
A0A8D0J6V8_BCL2L1-      a-------------ggcccc------------------------------
A0A4X1SQU7_BCL2L1-      a-------------ggcccc------------------------------
A0A4X1SQU7_BCL2L1-      a-------------ggcccc------------------------------
A0A4X1SQU7_BCL2L1-      a-------------ggcccc------------------------------
A0A4X1SRM7_BCL2L1-      a-------------ggcccc------------------------------
A0A8D0XF62_BCL2L1-      a-------------ggcccc------------------------------
A0A8D1ALD6_BCL2L1-      a-------------ggcccc------------------------------
A0A4X1SQU7_BCL2L1-      a-------------ggcccc------------------------------
A0A8C4L2X1_BCL2L1-      a-------------ggcccc------------------------------
A0A3Q2H0F6_BCL2L1-      a-------------ggcccc------------------------------
A0A250YD48_BCL2L1-      a-------------ggcccc------------------------------
A0A1L5BWY3_BCL2L1-      a-------------ggcccc------------------------------
A0A8B7FNN3_BCL2L1-      a-------------ggcccc------------------------------
A0A8B7FNN3_BCL2L1-      a-------------ggcccc------------------------------
A0A8B7FNN3_BCL2L1-      a-------------ggcccc------------------------------
A0A8B7FNN3_BCL2L1-      a-------------ggcccc------------------------------
A0A2K6G3C5_BCL2L1-      a-------------ggcccc------------------------------
A0A2K6G3C5_BCL2L1-      a-------------ggcccc------------------------------
E2IV76_BCL2L1-01        a-------------ggcccc------------------------------
A0A8C8YN28_BCL2L1-      a-------------ggcccc------------------------------
A0A8I3ZZI7_BCL2L1-      a-------------ggcccc------------------------------
A0A5F7ZJK5_BCL2L1-      a-------------ggcccc------------------------------
A0A2K6UWY8_BCL2L1-      a-------------ggcccc------------------------------
E2IV77_BCL2L1-01        a-------------ggcccc------------------------------
A0A2K6UWY8_BCL2L1-      a-------------ggcccc------------------------------
A0A8I3ZZI7_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5EBP4_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5EBP4_BCL2L1-      a-------------ggcccc------------------------------
E2IV75_BCL2L1-01        a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A6D2VXZ3_BCL2L1-      a-------------ggcccc------------------------------
G1RER8_BCL2L1-01        a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A7I2V597_BCL2L1-      a-------------ggcccc------------------------------
A0A2R8Z9D7_BCL2L1-      a-------------ggcccc------------------------------
A0A2R8Z9D7_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5H963_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5H963_BCL2L1-      a-------------ggcccc------------------------------
Q2PFS6_BCL2L1-01        --------------------------------------------------
A0A8C9GFE0_BCL2L1-      a-------------ggcccc------------------------------
A0A2K6QFA2_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5M8B1_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5M8B1_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5VPG2_BCL2L1-      a-------------ggcccc------------------------------
A0A8I5MVB8_BCL2L1-      a-------------ggcccc------------------------------
A0A8D2ERY7_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5YR37_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5YR37_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5VPG2_BCL2L1-      a-------------ggcccc------------------------------
A0A5F7ZJK5_BCL2L1-      a-------------ggcccc------------------------------
A0A5F7ZJK5_BCL2L1-      a-------------ggcccc------------------------------
A0A5F7ZJK5_BCL2L1-      a-------------ggcccc------------------------------
A0A5F7ZJK5_BCL2L1-      a-------------ggcccc------------------------------
A0A0D9RJZ8_BCL2L1-      a-------------ggcccc------------------------------
I7GKS6_BCL2L1-01        a-------------ggcccc------------------------------
A0A2K6QFA2_BCL2L1-      a-------------ggcccc------------------------------
A0A2K6QFA2_BCL2L1-      a-------------ggcccc------------------------------
A0A2K5YR37_BCL2L1-      a-------------ggcccc------------------------------
A0A5F5XYW0_BCL2L1-      a-------------ggcccc------------------------------
A0A8C7BPR9_BCL2L1-      a-------------ggcccc------------------------------
A0A5F5XYW0_BCL2L1-      a-------------ggcccc------------------------------
A0A8B8VBB9_BCL2L1-      a-------------ggcccc------------------------------
A0A8C6F2V6_BCL2L1-      a-------------ggcccc------------------------------
A0A8C9BM97_BCL2L1-      a-------------ggcccc------------------------------
M3Z2H9_BCL2L1-01        a-------------ggcccc------------------------------
A0A8C7BPR9_BCL2L1-      a-------------ggcccc------------------------------
A0A5F5XYW0_BCL2L1-      a-------------ggcccc------------------------------
A0A8C0TGM4_BCL2L1-      a-------------ggcccc------------------------------
Q76LT7_BCL2L1-01        a-------------ggcccc------------------------------
Q8SQ42_BCL2L1-01        a-------------ggcccc------------------------------
A0A673UUI0_BCL2L1-      a-------------ggcccc------------------------------
A0A452SDS4_BCL2L1-      a-------------ggcccc------------------------------
A0A384D3U1_BCL2L1-      a-------------ggcccc------------------------------
A0A8C9D5N1_BCL2L1-      a-------------ggcccc------------------------------
A0A8C9M2S8_BCL2L1-      a-------------ggcccc------------------------------
A0A667HK09_BCL2L1-      a-------------ggcccc------------------------------
A0A3Q1LRT3_BCL2L1-      g-------------aaaccc------------------------------
A0A4W2D608_BCL2L1-      a-------------gacccc------------------------------
A0A4W2D608_BCL2L1-      a-------------gacccc------------------------------
A0A4W2F845_BCL2L1-      g-------------aaaccc------------------------------
A0A4W2F845_BCL2L1-      g-------------aaaccc------------------------------
A0A8B9WB42_BCL2L1-      g-------------aaaccc------------------------------
A0A8C6FN58_BCL2L1-      a-------------gaccac------------------------------
A0A452E1B1_BCL2L1-      a-------------gaccct------------------------------
W5PSA5_BCL2L1-01        a-------------gaccct------------------------------
A0A8B9X9C2_BCL2L1-      a-------------ggcctc------------------------------
A0A452FHY1_BCL2L1-      ---------------gcctc------------------------------
A0A452FHY1_BCL2L1-      ---------------gcctc------------------------------
H3ANS8_BCL2L1-01        c-------------ggtggt------------------------------
W5MG74_BCL2L1-01        g-------------aggcgc------------------------------
H9GHK7_BCL2L1-01        a-------------gccagc------------------------------
A0A6I8PIR3_BCL2L1-      ------------------gg------------------------------
A0A8D0HVA8_BCL2L1-      a-------------gacggt------------------------------
A0A8D0HVA8_BCL2L1-      a-------------gacggt------------------------------
A0A8D0HVA8_BCL2L1-      a-------------gacggt------------------------------
A0A7M4EJG9_BCL2L1-      a-------------gtttgc------------------------------
A0A670IBZ4_BCL2L1-      a-------------gttgag------------------------------
A0A8D0E1K1_BCL2L1-      a-------------gctggc------------------------------
A0A8D2L5P2_BCL2L1-      a-------------gctggc------------------------------
A0A8C6V6T2_BCL2L1-      a-------------gctgtc------------------------------
A0A8C5RX62_BCL2L1-      a-------------gctgtc------------------------------
A0A670Z9Y4_BCL2L1-      a-------------gctgtc------------------------------
A0A8C8S850_BCL2L1-      a-------------gtttgc------------------------------
K7F655_BCL2L1-01        a-------------ggctgc------------------------------
A0A8C0IVL6_BCL2L1-      a-------------ttctgc------------------------------
A0A8C4W8N7_BCL2L1-      a-------------ttctgc------------------------------
A0A8C3RIU8_BCL2L1-      a-------------gtctgc------------------------------
A0A8C3IUT0_BCL2L1-      a-------------gtctgc------------------------------
A0A8C3IUT0_BCL2L1-      a-------------gtctgc------------------------------
A0A8C3IUT0_BCL2L1-      a-------------gtctgc------------------------------
A0A8C3IUT0_BCL2L1-      a-------------gtctgc------------------------------
A0A674J5J7_BCL2L1-      a-------------gtctgc------------------------------
A0A8B9CUX0_BCL2L1-      a-------------cttcgc------------------------------
A0A8B9DB39_BCL2L1-      a-------------cttcgc------------------------------
A0A493TIA6_BCL2L1-      a-------------gttggc------------------------------
A0A8C3CGW6_BCL2L1-      a-------------ggtggc------------------------------
A0A8B9SM69_BCL2L1-      a-------------gttggc------------------------------
A0A8B9V5I0_BCL2L1-      a-------------gttggc------------------------------
A0A8C7ECQ9_BCL2L1-      a-------------ctttgc------------------------------
A0A669P0Q7_BCL2L1-      a-------------cactgc------------------------------
A0A8C2T2M7_BCL2L1-      a-------------cactgc------------------------------
A0A8C9EN38_BCL2L1-      a-------------cactgc------------------------------
A0A8C3LRK6_BCL2L1-      a-------------cactgc------------------------------
G1N5N5_BCL2L1-01        a-------------cactgc------------------------------
A0A8B9NWH6_BCL2L1-      a-------------ttttgc------------------------------
A0A8B9NWH6_BCL2L1-      a-------------ttttgc------------------------------
A0A8C4JDK2_BCL2L1-      a-------------ttttgc------------------------------
A0A8C4JDK2_BCL2L1-      a-------------ttttgc------------------------------
A0A8C5JFI3_BCL2L1-      a-------------ctttgc------------------------------
A0A8D2M680_BCL2L1-      a-------------ctttgc------------------------------
A0A803VLI1_BCL2L1-      a-------------ctttgc------------------------------
A0A8C5U1E1_BCL2L1-      a-------------ctttgc------------------------------
A0A8C3U3Q2_BCL2L1-      a-------------ctttgc------------------------------
A0A8C0U194_BCL2L1-      a-------------ctttgc------------------------------
H0Z8G3_BCL2L1-01        a-------------ctttgc------------------------------
Q4U2V6_BCL2L1-01        a-------------ctttgc------------------------------
A0A8C9NN65_BCL2L1-      a-------------ctttgc------------------------------
A0A8C3XCF2_BCL2L1-      a-------------ctttgc------------------------------
A0A8D2NN48_BCL2L1-      a-------------ctttgc------------------------------
A0A8C0FL84_BCL2L1-      a-------------ctttgc------------------------------
A0A8C0AYR5_BCL2L1-      a-------------ctttgc------------------------------
A0A8C4TWS5_BCL2L1-      a-------------ctttgc------------------------------
A0A8C3KQJ2_BCL2L1-      a-------------ctttgt------------------------------
A0A8C8A4L8_BCL2L1-      a-------------ctttgc------------------------------
A0A8D0FHG7_BCL2L1-      a-------------ctttgc------------------------------
A0A8B9N2I0_BCL2L1-      a-------------ctttgc------------------------------
A0A663ECL2_BCL2L1-      a-------------ctttgc------------------------------
A0A8C0AYR5_BCL2L1-      a-------------ctttgc------------------------------
A0A8B9FKI5_BCL2L1-      a-------------ctttgc------------------------------
A0A672UKR0_BCL2L1-      a-------------ctttgc------------------------------
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      --------------ggccag------------------gtggcggaagag
A0A8C5B4N8_BCL2L1-      at------------gaggac------------------------------
D2ITA2_BCL2L1-02        at------------gaggac------------------------------
C1BLI0_BCL2L1-01        at------------gttgac------------------------------
A0A3B3ZMX9_BCL2L1-      ca------------cagagt------------------gacacggagca-
A0A3B3ZMX9_BCL2L1-      ca------------gagaga------------------gacagggacct-
A0A667Y1V0_BCL2L1-      a-------------gggaga------------------------------
A0A3P8XFS0_BCL2L1-      a-------------gggaga------------------------------
A0A3P8XFS0_BCL2L1-      a-------------gggaga------------------------------
A0A4W5LYF9_BCL2L1-      a-------------ggggga------------------------------
A0A6F8ZUL6_BCL2L1-      a-------------ggggga------------------------------
A0A674C4N2_BCL2L1-      a-------------ggggga------------------------------
A0A8C7RD80_BCL2L1-      a-------------ggggga------------------------------
A0A8C7CBC7_BCL2L1-      a-------------ggggga------------------------------
A0A8C7CBC7_BCL2L1-      a-------------ggggga------------------------------
A0A8C8GSY4_BCL2L1-      a-------------gggaga------------------------------
A0A8C8GSY4_BCL2L1-      a-------------gggaga------------------------------
A0A6F9CY91_BCL2L1-      a-------------gggaga------------------------------
A0A060XE41_BCL2L1-      a-------------cggaga------------------------------
A0A286MU87_BCL2L1-      a-------------cggaga------------------------------
A0A8C8J941_BCL2L1-      a-------------gggaga------------------------------
A0A8C7FX38_BCL2L1-      a-------------gggaga------------------------------
A0A4W5JPK5_BCL2L1-      a-------------gggaga------------------------------
C0HAD8_BCL2L1-01        a-------------gggaga------------------------------
A0A673Z4J6_BCL2L1-      a-------------gggaga------------------------------
A0A3B3QRZ2_BCL2L1-      --------------agagggctcgggt-----------caggccgatggg
A0A3P8UWG7_BCL2L1-      at------------ggggaa------------------gaggcagggttg
A0A345BSW9_BCL2L1-      at------------------------------------ggggccgaagag
B2GRK1_BCL2L1-01        at------------------------------------ggggctgaagag
B2GRK1_BCL2L1-02        at------------------------------------ggggctgaagag
Q90Z98_BCL2L1-01        at------------------------------------ggggctgaagag
A0A672K8R2_BCL2L1-      at------------------------------------gcggcggaaggg
A0A8C1JXA4_BCL2L1-      at------------------------------------gcggtggaaggg
A0A673M4N6_BCL2L1-      at------------------------------------gcggcggaaggg
A0A673M4N6_BCL2L1-      at------------------------------------gcggcggaaggg
A0A671QPE4_BCL2L1-      at------------------------------------gcggcggaaggg
A0A672N8N5_BCL2L1-      at------------------------------------gcggcggaaggg
A0A671K7W7_BCL2L1-      at------------------------------------gcggcggaaggg
A0A671K7W7_BCL2L1-      at------------------------------------gcggcggaaggg
A0A673IGS5_BCL2L1-      at------------------------------------gcggcggaaggg
A0A8C5D4L1_BCL2L1-      --------------ggtggt------------------ggagaagg----
A0A8C5D4L1_BCL2L1-      --------------ggtggt------------------ggagaagg----
A0A8C5D4L1_BCL2L1-      --------------ggtggt------------------ggagaagg----
A0A4W4GHX3_BCL2L1-      ag------------gggggt---------------ccggagggagag---
A0A3B4DTL9_BCL2L1-      aa------------gggggt---------------caggcggcagaggag
A0A3B1JJ42_BCL2L1-      aa------------gggggc---------------caggaagcggagggg
A0A8B9LKW7_BCL2L1-      aa------------gggggc---------------caggaagcggagggg
A0A8C9SVL8_BCL2L1-      at------------------------------------caggcggaagcg
A0A8C4CMF6_BCL2L1-      tc------------cagtgg------------------acagcagt----
A0A3B3TFR4_BCL2L1-      --------------cagggg------------------gaggtgag----
A0A3P8XYL5_BCL2L1-      ag------------ggggga------------------gaggtggaa---
A0A6F9B188_BCL2L1-      ag------------ggtgga------------------caggtggaa---
A0A4W5R2W6_BCL2L1-      ag------------agggga------------------caggtggaa---
A0A4W5R2W6_BCL2L1-      ag------------agggga------------------caggtggaa---
A0A674C578_BCL2L1-      ag------------ggggga------------------caggcggaa---
A0A674C578_BCL2L1-      ag------------ggggga------------------caggcggaa---
A0A8C7IJ10_BCL2L1-      ag------------ggggga------------------caggtggaa---
A0A8C8D057_BCL2L1-      ag------------ggggga------------------caggtggaa---
A0A8C7P574_BCL2L1-      ag------------ggggga------------------caggtggaa---
A0A8C7IJ10_BCL2L1-      ag------------ggggga------------------caggtggaa---
A0A8C8D057_BCL2L1-      ag------------ggggga------------------caggtggaa---
A0A6F9BJ02_BCL2L1-      ag------------ggggga------------------ccggtggac---
A0A4W5NQ40_BCL2L1-      ag------------ggggga------------------caggtggaa---
A0A8C7UB69_BCL2L1-      ag------------ggggga------------------caggtggaa---
A0A8C7J9N8_BCL2L1-      ag------------gggggg------------------caggtggaa---
A0A8C8FJG7_BCL2L1-      ag------------gggggg------------------caggtggaa---
B5XAY3_BCL2L1-01        ag------------gtggga------------------caggtggaa---
A0A674C337_BCL2L1-      ag------------ggggga------------------caggtggaa---
A0A8C9SET9_BCL2L1-      gc------------gaggag------------------aatgaagacccg
A0A8C5G971_BCL2L1-      ct------------gggtcg------------------gacgcagagccc
A0A8C5FC81_BCL2L1-      ag------------gtgggc------------------ggggccgcaccg
A0A665VM40_BCL2L1-      at------------ggtggg------------------ggggcagggttg
A0A3Q3WIW8_BCL2L1-      ag------------gggggg------------------caggcagtgtca
A0A3B5PQJ0_BCL2L1-      ct------------gccggg------------------gacgtggggatg
A0A3P9N9Y4_BCL2L1-      ctgccagggacgcggccggg------------------gacggggggatg
A0A3B3WI27_BCL2L1-      ctgctggggacgcggccggg------------------gacgcggggatg
A0A087X9B7_BCL2L1-      ctgctggggacgcggccggg------------------gacgcggggatg
A0A3B3TUS7_BCL2L1-      ctgctggggacgcggccggg------------------gacgcggggatg
A0A3Q2FR43_BCL2L1-      gc------------gcccag------------------ggggcggagcag
A0A3Q3B3X5_BCL2L1-      at------------gcaggg------------------gatgcagggttg
A0A667ZHE8_BCL2L1-      at------------gggggg------------------caggcaggggcg
A0A3Q3G2E1_BCL2L1-      at------------ggggcg------------------ggggcagggtcg
A0A3Q3G2E1_BCL2L1-      at------------ggggcg------------------ggggcagggtcg
A0A3Q3G2E1_BCL2L1-      at------------ggggcg------------------ggggcagggtcg
A0A3Q3MX20_BCL2L1-      at------------ggggga------------------gaggctgagtca
A0A0D6DR75_BCL2L1-      at------------ggaggg------------------gaggttgagtcc
A0A3Q1GZ93_BCL2L1-      at------------gggggg------------------gaagatgggttg
A0A4W6BQD5_BCL2L1-      at------------gggggg------------------gaggcagggtca
A0A3B4V3T1_BCL2L1-      at------------ggcggg------------------gaggcagggttg
A0A3B4XU17_BCL2L1-      at------------ggcggg------------------gaggcagggttg
A0A673BZP5_BCL2L1-      at------------ggtgga------------------gaggcggggttg
A0A671WXV0_BCL2L1-      at------------gggggg------------------------------
A0A219P0Y3_BCL2L1-      at------------gggggg------------------gaggcagggtta
A0A8C9WU15_BCL2L1-      at------------gggggg------------------cacgcagggttg
A0A1A7ZDF6_BCL2L1-      gt------------gcgggg------------------gatgcggtggtg
A0A8F0MQ26_BCL2L1-      at------------gaaggg------------------gaggctggggtg
A0A672IDC1_BCL2L1-      ac------------gggggggacggcggggacgccggggacgccgggtcg
A0A672IDC1_BCL2L1-      ac------------gggggggacggcggggacgccggggacgccgggtcg
A0A3Q0RTF8_BCL2L1-      at------------gggggg------------------gcagcagggttg
A0A668RI12_BCL2L1-      at------------gggggg------------------gcggcggggttg
I3IZK7_BCL2L1-01        at------------gggggg------------------gcggcggggttg
A0A3Q4N4B5_BCL2L1-      at------------gggggg------------------gcagcggggttg
A0A3Q2X557_BCL2L1-      at------------gggggg------------------gcagcggggttg
A0A3P8P0F1_BCL2L1-      at------------gggggg------------------gcagcggggttg
A0A3P9D632_BCL2L1-      at------------gggggg------------------gcagcggggttg
A0A3P9D632_BCL2L1-      at------------gggggg------------------gcagcggggttg
A0A3B4FNX1_BCL2L1-      at------------gggggg------------------gcagcggggttg
A0A8C2ZZ68_BCL2L1-      ac------------gggggg------------------gaggcgggggcg
G3NJY1_BCL2L1-01        gc------------gggggg---------------gtagaggcaggggcg
A0A3B3DHA1_BCL2L1-      ct------------gcgggg------------------gagg------tg
A0A3P9JYH1_BCL2L1-      ct------------gcgggg------------------gagg------tg
A0A3B3IB64_BCL2L1-      ct------------gcgggg------------------gagg------tg
A0A8C7YJI1_BCL2L1-      ct------------gcgggg------------------gagg------tg
C3VIT1_BCL2L1-01        gt------------gccggg------------------gacgggggtctg
A0A3B4Z3X2_BCL2L1-      ac------------gggggg------------------gaggcgaggttg
A0A3B4Z3X2_BCL2L1-      ac------------gggggg------------------gaggcgaggttg
A0A3Q1FR00_BCL2L1-      at------------gggggg------------------gaggcccggctg
A0A3Q1FR00_BCL2L1-      at------------gggggg------------------gaggcccggctg
A0A3Q1DHJ3_BCL2L1-      ac------------gggggg------------------gaggcccggctg
A0A3Q1DHJ3_BCL2L1-      ac------------gggggg------------------gaggcccggctg
A0A3Q1DHJ3_BCL2L1-      ac------------gggggg------------------gaggcccggctg
A0A3P8TL99_BCL2L1-      ac------------gggggg------------------gaggcccggctg
A0A3P8TL99_BCL2L1-      ac------------gggggg------------------gaggcccggctg
A0A8C6UPI9_BCL2L1-      a-------------------------------------------------
A0A3B4BFZ8_BCL2L1-      a-------------------------------------------------
A0A3B3E2W4_BCL2L1-      c-------------------------------------------------
A0A3P9MKK4_BCL2L1-      a-------------------------------------------------
A0A3P9MKK4_BCL2L1-      a-------------------------------------------------
A0A3B3I2Q5_BCL2L1-      a-------------------------------------------------
A0A3B3I2Q5_BCL2L1-      a-------------------------------------------------
A0A3P9I2N4_BCL2L1-      a-------------------------------------------------
A0A3P9I2N4_BCL2L1-      a-------------------------------------------------
A0A8C7XSQ2_BCL2L1-      a-------------------------------------------------
A0A8C7XSQ2_BCL2L1-      a-------------------------------------------------
A0A3P8VMA1_BCL2L1-      a-------------------------------------------------
A0A3Q2C6K4_BCL2L1-      a-------------------------------------------------
A0A3B5MGS2_BCL2L1-      a-------------------------------------------------
M4A558_BCL2L1-01        a-------------------------------------------------
A0A3P9QFB3_BCL2L1-      a-------------------------------------------------
A0A3B3XN57_BCL2L1-      a-------------------------------------------------
A0A087YBW4_BCL2L1-      a-------------------------------------------------
A0A3B3VWI7_BCL2L1-      a-------------------------------------------------
A0A1A8A2S0_BCL2L1-      g-------------------------------------------------
A0A672JL90_BCL2L1-      a-------------------------------------------------
A0A672Z262_BCL2L1-      a-------------------------------------------------
A0A3Q3BEB7_BCL2L1-      a-------------------------------------------------
A0A0F7L1T6_BCL2L1-      a-------------------------------------------------
H2U5I3_BCL2L1-01        a-------------------------------------------------
A0A8C2ZH46_BCL2L1-      a-------------------------------------------------
G3P7B4_BCL2L1-01        a-------------------------------------------------
A0A3Q3FUB6_BCL2L1-      a-------------------------------------------------
A0A3Q3X5M5_BCL2L1-      a-------------------------------------------------
A0A665VSD7_BCL2L1-      a-------------------------------------------------
A0A8D3CTR5_BCL2L1-      a-------------------------------------------------
A0A3Q1JZ46_BCL2L1-      t-------------------------------------------------
A0A3B5B4X7_BCL2L1-      a-------------------------------------------------
A0A3Q1EVP6_BCL2L1-      a-------------------------------------------------
A0A6G7K5D7_BCL2L1-      a-------------------------------------------------
A0A3Q1BQA0_BCL2L1-      a-------------------------------------------------
A0A3P8U812_BCL2L1-      a-------------------------------------------------
A0A3Q3NFM4_BCL2L1-      a-------------------------------------------------
A0A4W6EST2_BCL2L1-      a-------------------------------------------------
A0A3B4V9K8_BCL2L1-      a-------------------------------------------------
A0A3B4XS24_BCL2L1-      a-------------------------------------------------
A0A510BW31_BCL2L1-      a-------------------------------------------------
A0A8D0AAQ8_BCL2L1-      a-------------------------------------------------
A0A8C4IRU9_BCL2L1-      a-------------------------------------------------
E6ZFR0_BCL2L1-01        a-------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        ------------------------------------------------aa
A0A346RRN1_BCL2L1-      ------------------------------------------------aa
A0A8C4STP1_BCL2L1-      ctccactcctgagaatgaacaagatgtgctacatgt-----------caa
A0A8C4XBF6_BCL2L1-      -----------agagtgaactggatgtattacaggt-----------caa
Q90ZH2_BCL2L1-01        -----------------------------------------------taa
Q2TAP5_BCL2L1-01        -----------------------------------------------taa
Q91828_BCL2L1-01        -----------------------------------------------taa
A0A8C5WFB8_BCL2L1-      --------tggggagcagcctgc--------cgcacgc------------
A0A4X2KZ04_BCL2L1-      --------agaaggg---ac------------agaaa------------c
F6WA14_BCL2L1-01        --------agaaggg---gc------------agagat---------acc
A0A7N4P3X2_BCL2L1-      --------agaaggg---ac------------agagat---------acc
A0A7N4P3X2_BCL2L1-      --------agaaggg---ac------------agagat---------acc
A0A8C5YLY6_BCL2L1-      --------agaaagg---gctgaatcagaagaggggcc---------cag
A0A8D2IA38_BCL2L1-      --------agaaagg---gctgaatcagaagaggggtc---------cag
A0A8D2IA38_BCL2L1-      --------agaaagg---gctgaatcagaagaggggtc---------cag
G3SPN0_BCL2L1-01        --------ggaaggc---actgaatccgagatggagat---------ccc
O35843_BCL2L1-01        --------agaagaa---actgaagcagagagggagac---------ccc
Q7TS62_BCL2L1-02        --------agaagaa---actgaaccagaaagggagac---------ccc
Q7TS62_BCL2L1-03        --------agaagaa---actgaaccagaaagggagac---------ccc
Q5HZH3_BCL2L1-02        --------agaagaa---actgaagcagagagggagac---------ccc
A0A8C6G6C7_BCL2L1-      --------agaagac---actgaagcagagagggagac---------ccc
Q7TS62_BCL2L1-01        --------agaagaa---actgaaccagaaagggagac---------ccc
A0A6I9LMY5_BCL2L1-      --------agaagga---actgattccgagagggagac---------ccc
B2Z3Z4_BCL2L1-01        --------agaagga---actgaatcagagagggagac---------ccc
A0A8C6W748_BCL2L1-      --------agaagga---actgaatcagagagggagac---------ccc
H0X6V2_BCL2L1-01        --------agaaggg---aatgaatcagagctggagac---------ccc
A0A286Y5D6_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A8D2AGI2_BCL2L1-      --------agaagga---actgaatcagaggtggagac---------ccc
A0A287CZ07_BCL2L1-      --------agaaggg---actgaatcagaggtggagac---------ccc
A0A8C9UNM3_BCL2L1-      --------agaaggg---actgaatcagaggtggagac---------ccc
A0A8D2I760_BCL2L1-      --------agaaggg---actgaatcagaggtggagac---------ccc
A0A8C2YUU6_BCL2L1-      --------agaaggg---gctgaatcagagacggagac---------ccc
A0A8C2YUU6_BCL2L1-      --------agaaggg---gctgaatcagagacggagac---------ccc
A0A8C2YUU6_BCL2L1-      --------agaaggg---gctgaatcagagacggagac---------ccc
G1P9D2_BCL2L1-01        --------agaaggg---actgaatcagaggtggagac---------ccc
A0A8C5NZI4_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A3Q2H0F6_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A8B9XQH5_BCL2L1-      --------agaaggg---acagaatcagatatggaaac---------ccc
Q05KJ0_BCL2L1-01        --------agaaggg---acagaatcagatatggaaac---------ccc
Q05KJ0_BCL2L1-02        --------agaaggg---acagaatcagatatggaaac---------ccc
A0A8C6DX24_BCL2L1-      --------agaaggg---acagaatcagatatggaaac---------ccc
A0A452FWV3_BCL2L1-      --------agaaggg---acagaatcagatatggaaac---------ccc
Q9MZS7_BCL2L1-01        --------agaaggg---acagaatcagatatggaaac---------ccc
A0A8C3WJH5_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D1ALD6_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A4X1SQU7_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D0XF62_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
O77737_BCL2L1-01        --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D0J6V8_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D0J6V8_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D0J6V8_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D0J6V8_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D0J6V8_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A4X1SQU7_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A4X1SQU7_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A4X1SQU7_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A4X1SRM7_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D0XF62_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8D1ALD6_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A4X1SQU7_BCL2L1-      --------agaaggg---actgaatcagaagcggaaac---------ccc
A0A8C4L2X1_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A3Q2H0F6_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A250YD48_BCL2L1-      --------agaaggg---attgaatcagaggtggagac---------ccc
A0A1L5BWY3_BCL2L1-      --------agaaggg---attgaatcagaggtggagac---------ccc
A0A8B7FNN3_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A8B7FNN3_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A8B7FNN3_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A8B7FNN3_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K6G3C5_BCL2L1-      --------agaagcg---actgaatcggagatggagac---------ccc
A0A2K6G3C5_BCL2L1-      --------agaagcg---actgaatcggagatggagac---------ccc
E2IV76_BCL2L1-01        --------agaaggg---actgaatcggagatggaaac---------ccc
A0A8C8YN28_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A8I3ZZI7_BCL2L1-      --------agaaggg---actgattcggagatggagac---------ccc
A0A5F7ZJK5_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K6UWY8_BCL2L1-      --------agaaggg---actgattcggagatggagac---------ccc
E2IV77_BCL2L1-01        --------agaaggg---actgattcggagatggagac---------ccc
A0A2K6UWY8_BCL2L1-      --------agaaggg---actgattcggagatggagac---------ccc
A0A8I3ZZI7_BCL2L1-      --------agaaggg---actgattcggagatggagac---------ccc
A0A2K5EBP4_BCL2L1-      --------agaaggg---actgattcggagatggagac---------ccc
A0A2K5EBP4_BCL2L1-      --------agaaggg---actgattcggagatggagac---------ccc
E2IV75_BCL2L1-01        --------agaaggg---actgattcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A6D2VXZ3_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
G1RER8_BCL2L1-01        --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A7I2V597_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2R8Z9D7_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2R8Z9D7_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5H963_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5H963_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
Q2PFS6_BCL2L1-01        ------------------------------atggagac---------ccc
A0A8C9GFE0_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K6QFA2_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5M8B1_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5M8B1_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5VPG2_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A8I5MVB8_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A8D2ERY7_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5YR37_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5YR37_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5VPG2_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A5F7ZJK5_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A5F7ZJK5_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A5F7ZJK5_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A5F7ZJK5_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A0D9RJZ8_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
I7GKS6_BCL2L1-01        --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K6QFA2_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K6QFA2_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A2K5YR37_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A5F5XYW0_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A8C7BPR9_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A5F5XYW0_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A8B8VBB9_BCL2L1-      --------agaaggg---actgaatcagacatggaaac---------ccc
A0A8C6F2V6_BCL2L1-      --------agaaggg---actgaatcagacatggaaac---------ccc
A0A8C9BM97_BCL2L1-      --------agaaggg---actgaatcagacatggaaac---------ccc
M3Z2H9_BCL2L1-01        --------agaaggg---actgaatcagagatggagac---------ccc
A0A8C7BPR9_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A5F5XYW0_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A8C0TGM4_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
Q76LT7_BCL2L1-01        --------agaaggg---actgaatcagagatggagac---------ccc
Q8SQ42_BCL2L1-01        --------agaaggg---actgaatcagagatggagac---------ccc
A0A673UUI0_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A452SDS4_BCL2L1-      --------agaagga---actgaatcagagatggagac---------ccc
A0A384D3U1_BCL2L1-      --------agaagga---actgaatcagagatggagac---------ccc
A0A8C9D5N1_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A8C9M2S8_BCL2L1-      --------agaaggg---actgaatcggagatggagac---------ccc
A0A667HK09_BCL2L1-      --------agaaggg---actgaatcagagatggagac---------ccc
A0A3Q1LRT3_BCL2L1-      --------ccagtgg---a-----tcag----------------------
A0A4W2D608_BCL2L1-      --------agaaggg---agagagtcagata-------------------
A0A4W2D608_BCL2L1-      --------agaaggg---agagagtcagata-------------------
A0A4W2F845_BCL2L1-      --------ccagtgg---a-----tcag----------------------
A0A4W2F845_BCL2L1-      --------ccagtgg---a-----tcag----------------------
A0A8B9WB42_BCL2L1-      --------ccagtgg---a-----tcag----------------------
A0A8C6FN58_BCL2L1-      --------agaaggg---acagaatcagatatggaaac---------cct
A0A452E1B1_BCL2L1-      --------agaaggg---acagaatcagatatggaaac---------ccc
W5PSA5_BCL2L1-01        --------agaaggg---acagaatcagatatggaaac---------ccc
A0A8B9X9C2_BCL2L1-      --------ggaaggg---acaaaatcagatatggaaac---------ccc
A0A452FHY1_BCL2L1-      --------agaaggg---acaaaatcagatatggaaac---------ccc
A0A452FHY1_BCL2L1-      --------agaaggg---acaaaatcagatatggaaac---------ccc
H3ANS8_BCL2L1-01        --------ggaggagaccgc-gcgaggg--------aa---------gca
W5MG74_BCL2L1-01        --------tgaggcg---------gtgg----------------------
H9GHK7_BCL2L1-01        --------aaacgag---------acgg---------------------g
A0A6I8PIR3_BCL2L1-      --------ggccgagggggccgaggggg---------------------g
A0A8D0HVA8_BCL2L1-      --------agaaggg---gcagcgatgg---------------------g
A0A8D0HVA8_BCL2L1-      --------agaaggg---gcagcgatgg---------------------g
A0A8D0HVA8_BCL2L1-      --------agaaggg---gcagcgatgg---------------------g
A0A7M4EJG9_BCL2L1-      --------agaagag---gaggacatgg---------------------c
A0A670IBZ4_BCL2L1-      --------agacgag---------atgg---------------------a
A0A8D0E1K1_BCL2L1-      --------cgagggg---------atga---------------------g
A0A8D2L5P2_BCL2L1-      --------cgacgag---------atgg---------------------g
A0A8C6V6T2_BCL2L1-      --------cggcgag---------atgg---------g---------cag
A0A8C5RX62_BCL2L1-      --------cggcgag---------atgg---gcggtag---------cag
A0A670Z9Y4_BCL2L1-      --------cggcgag---------atgggcagcggcag---------cgg
A0A8C8S850_BCL2L1-      --------cgaggag---atagagatgg---------------------c
K7F655_BCL2L1-01        --------agaagag---gcggagatgg---------------------c
A0A8C0IVL6_BCL2L1-      --------agaagag---gctgagatgg---------------------c
A0A8C4W8N7_BCL2L1-      --------agaagag---gctgagatgg---------------------c
A0A8C3RIU8_BCL2L1-      --------agaggag---gctgagatgg---------------------c
A0A8C3IUT0_BCL2L1-      --------agaagag---gctgagatgg---------------------c
A0A8C3IUT0_BCL2L1-      --------agaagag---gctgagatgg---------------------c
A0A8C3IUT0_BCL2L1-      --------agaagag---gctgagatgg---------------------c
A0A8C3IUT0_BCL2L1-      --------agaagag---gctgagatgg---------------------c
A0A674J5J7_BCL2L1-      --------agaagag---gctgagatgg---------------------c
A0A8B9CUX0_BCL2L1-      --------ggcggag---gccgacacgg---------------------a
A0A8B9DB39_BCL2L1-      --------ggcggag---gccgacacgg---------------------a
A0A493TIA6_BCL2L1-      --------ttccgag---gccgccgc------------------------
A0A8C3CGW6_BCL2L1-      --------ggccgag---gccgacgc------------------------
A0A8B9SM69_BCL2L1-      --------ttccgag---gccgccgc------------------------
A0A8B9V5I0_BCL2L1-      --------ttccgag---gccgccgc------------------------
A0A8C7ECQ9_BCL2L1-      --------ggtagac---cccgaggtgg---------------------a
A0A669P0Q7_BCL2L1-      --------agcagag---gcagagatgg---------------------a
A0A8C2T2M7_BCL2L1-      --------ggcagag---gcagagatgg---------------------a
A0A8C9EN38_BCL2L1-      --------ggcagag---gcagagatgg---------------------a
A0A8C3LRK6_BCL2L1-      --------agcagag---gcagagatgg---------------------a
G1N5N5_BCL2L1-01        --------agcagag---gcagagatgg---------------------a
A0A8B9NWH6_BCL2L1-      --------ggtagag---gctgggatgg---------------------c
A0A8B9NWH6_BCL2L1-      --------ggtagag---gctgggatgg---------------------c
A0A8C4JDK2_BCL2L1-      --------ggtagag---gccgggatgg---------------------c
A0A8C4JDK2_BCL2L1-      --------ggtagag---gccgggatgg---------------------c
A0A8C5JFI3_BCL2L1-      --------aggggaggaggacgagatgg---------------------a
A0A8D2M680_BCL2L1-      --------aggggaggaggacgagatgg---------------------a
A0A803VLI1_BCL2L1-      --------aggggaggaggacgagatgg---------------------a
A0A8C5U1E1_BCL2L1-      --------aggggaggaggacgacatgg---------------------a
A0A8C3U3Q2_BCL2L1-      --------aggggaggaggacgagatgg---------------------a
A0A8C0U194_BCL2L1-      --------aggggaggaggacgagatgg---------------------a
H0Z8G3_BCL2L1-01        --------aggggaggaggacgagatgg---------------------a
Q4U2V6_BCL2L1-01        --------aggggaggaggacgagatgg---------------------a
A0A8C9NN65_BCL2L1-      --------aggggaggaggacgagatgg---------------------a
A0A8C3XCF2_BCL2L1-      --------aggggaggaggacgaggtgg---------------------a
A0A8D2NN48_BCL2L1-      --------aggggaggaggacgaggtgg---------------------a
A0A8C0FL84_BCL2L1-      --------agtggaggacgccgagatgg---------------------a
A0A8C0AYR5_BCL2L1-      --------agcagaggaggccgagatgg---------------------a
A0A8C4TWS5_BCL2L1-      --------agcagaggaggccgagatgg---------------------a
A0A8C3KQJ2_BCL2L1-      --------ggcagaggaggacgagatgg---------------------a
A0A8C8A4L8_BCL2L1-      --------agtggaggacgccgagatgg---------------------a
A0A8D0FHG7_BCL2L1-      --------agtggaggacgccgagatgg---------------------a
A0A8B9N2I0_BCL2L1-      --------agcagaggaggccgagatgg---------------------a
A0A663ECL2_BCL2L1-      --------agcagaggaggccgagatgg---------------------a
A0A8C0AYR5_BCL2L1-      --------agcagaggaggccgagatgg---------------------a
A0A8B9FKI5_BCL2L1-      --------agctgaggaggtagagatgg---------------------a
A0A672UKR0_BCL2L1-      --------agccgaggaggtggagatgg---------------------a
A0A3B5K6B9_BCL2L1-      --------tgatg-ggcagtttgta--actactcagtt---------caa
H3CH49_BCL2L1-01        --------tgaag-ggcagtttgga--accacccagtc---------caa
A0A059PJI5_BCL2L1-      aacgc---ggtgggagcgggagagtcggagacgccgacagcagtcgttaa
A0A8C5B4N8_BCL2L1-      ----------aag-tccaacaggattggtaa----------------taa
D2ITA2_BCL2L1-02        ----------aag-tccaacaggattggtaa----------------taa
C1BLI0_BCL2L1-01        ---------------------------aagaccaatgtctccccagttaa
A0A3B3ZMX9_BCL2L1-      --------tcttggacttggggataggggcgtagacag---------g-g
A0A3B3ZMX9_BCL2L1-      --------tctgggactgggggacaggagcgtggacag---------gaa
A0A667Y1V0_BCL2L1-      --------cgacg------------------ccgacgccgtcatctctaa
A0A3P8XFS0_BCL2L1-      --------agagg------------------ctactgc---------aaa
A0A3P8XFS0_BCL2L1-      --------agagg------------------ctactgc---------aaa
A0A4W5LYF9_BCL2L1-      --------tgaag------------------ccattgc---------aaa
A0A6F8ZUL6_BCL2L1-      --------agaag------------------ccattgc---------aaa
A0A674C4N2_BCL2L1-      --------tgaag------------------ccattgc---------aaa
A0A8C7RD80_BCL2L1-      --------tgaag------------------ccattgc---------aaa
A0A8C7CBC7_BCL2L1-      --------tgaag------------------ccattgc---------aaa
A0A8C7CBC7_BCL2L1-      --------tgaag------------------ccattgc---------aaa
A0A8C8GSY4_BCL2L1-      --------tgaag------------------ccattgc---------aaa
A0A8C8GSY4_BCL2L1-      --------tgaag------------------ccattgc---------aaa
A0A6F9CY91_BCL2L1-      --------tgagg------------------ccattgc---------aaa
A0A060XE41_BCL2L1-      --------tgagg------------------ccattgc---------aaa
A0A286MU87_BCL2L1-      --------tgagg------------------ccattgc---------aaa
A0A8C8J941_BCL2L1-      --------tgagg------------------ccatttc---------aaa
A0A8C7FX38_BCL2L1-      --------tgagg------------------ccattgc---------aaa
A0A4W5JPK5_BCL2L1-      --------tgagg------------------ccattgc---------aaa
C0HAD8_BCL2L1-01        --------tgacg------------------ccattgc---------aaa
A0A673Z4J6_BCL2L1-      --------tgagg------------------ccattgc---------aaa
A0A3B3QRZ2_BCL2L1-      cg------cgagggggttatggtaacagcaactcatgt---------caa
A0A3P8UWG7_BCL2L1-      gg------cgcag-agcagcggaca--agtacgcacgc---------caa
A0A345BSW9_BCL2L1-      a---atggtgagggggcggcaggaacgacgaccctcgt---------taa
B2GRK1_BCL2L1-01        a---atggcgagggggcagcaggagcgacaactcttgt---------taa
B2GRK1_BCL2L1-02        a---atggcgagggggcagcaggagcgacaactcttgt---------taa
Q90Z98_BCL2L1-01        a---atggcgagggggcagcaggagcgacaactcttgt---------taa
A0A672K8R2_BCL2L1-      aatgatgatgaggcggcagcaggaatgacgaacctcgt---------taa
A0A8C1JXA4_BCL2L1-      aatgatgatgaggaggcagcaggaacaacgaccctcgt---------taa
A0A673M4N6_BCL2L1-      aatgatgatgaggcggcagcaggaacaacgaccctcgt---------taa
A0A673M4N6_BCL2L1-      aatgatgatgaggcggcagcaggaacaacgaccctcgt---------taa
A0A671QPE4_BCL2L1-      aatgatgatgaggaggcagcaggaacgacgaccctcgt---------taa
A0A672N8N5_BCL2L1-      aatgatgatgaggaggcagcaggaacgacaaccctcgt---------taa
A0A671K7W7_BCL2L1-      aatgatgatgaggcggcagcaggaacgacgaacctcat---------taa
A0A671K7W7_BCL2L1-      aatgatgatgaggcggcagcaggaacgacgaacctcat---------taa
A0A673IGS5_BCL2L1-      aatgatgatgaggcggcagcaggaacaacgaccctcgt---------taa
A0A8C5D4L1_BCL2L1-      --------aaaag-gccagc-------ccgactgccgg---------taa
A0A8C5D4L1_BCL2L1-      --------aaaag-gccagc-------ccgactgccgg---------taa
A0A8C5D4L1_BCL2L1-      --------aaaag-gccagc-------ccgactgccgg---------taa
A0A4W4GHX3_BCL2L1-      --------gatgg-tgcggaggccgcggcaacgccgacggcagtggccaa
A0A3B4DTL9_BCL2L1-      aa------cgcag-agggggcggcg--gtgacgcccacggcagttgtcaa
A0A3B1JJ42_BCL2L1-      aa------tgcag-aggcggccggg--gtgactcccaccgcagtcgttaa
A0A8B9LKW7_BCL2L1-      aa------cgcag-aggcggccgcg--gtgactcccaccgcagtcgttaa
A0A8C9SVL8_BCL2L1-      aacgg---ggagg-aggcgttggcc--gccgctcatgc---------gaa
A0A8C4CMF6_BCL2L1-      --------cagga-gggcgcaggtgtgacggcgctgtc---------caa
A0A3B3TFR4_BCL2L1-      --------ggcga-agcagcaggcgctgtggctcatgc---------caa
A0A3P8XYL5_BCL2L1-      --------gaggt-ggcagcagtca---ccatgcaccc---------caa
A0A6F9B188_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A4W5R2W6_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A4W5R2W6_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A674C578_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A674C578_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A8C7IJ10_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A8C8D057_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A8C7P574_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A8C7IJ10_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A8C8D057_BCL2L1-      --------ggggg-ggcggcagtca---cgacacaccc---------caa
A0A6F9BJ02_BCL2L1-      --------gggag-tgcggcagtca---tgacatacgt---------caa
A0A4W5NQ40_BCL2L1-      --------ggggg-tgcggcagtca---tgacatatgt---------caa
A0A8C7UB69_BCL2L1-      --------ggggg-tgcggcagtca---tgacatacgt---------c--
A0A8C7J9N8_BCL2L1-      --------ggggg-tgcggcagtca---tgacatacgt---------c--
A0A8C8FJG7_BCL2L1-      --------ggggg-tgcggcagtca---tgacatacgt---------c--
B5XAY3_BCL2L1-01        --------ggggg-tgcggcagtcc---taacatacgt---------c--
A0A674C337_BCL2L1-      --------ggggg-tgctgcagtca---taacatacgt---------c--
A0A8C9SET9_BCL2L1-      ggcactaccgagg-ttgggaggg--------ctcgcac---------caa
A0A8C5G971_BCL2L1-      gc------agagg-atgagcggacg--gacacgcagtc---------caa
A0A8C5FC81_BCL2L1-      gg------ccccg-cccgcgtcccc--gcgccgcacgc---------caa
A0A665VM40_BCL2L1-      gt------tgaag-aacaaagggta--gcaacgcattc---------caa
A0A3Q3WIW8_BCL2L1-      ga------tgagg-aacagcgggta--gcgacacacgc---------caa
A0A3B5PQJ0_BCL2L1-      ga------cgacg-agcagacgtta--gagacacacgc---------taa
A0A3P9N9Y4_BCL2L1-      ga------cgacg-agcagacgttg--gagacgcacgc---------taa
A0A3B3WI27_BCL2L1-      ga------cgacg-agcagacgttg--gagacgcacgc---------taa
A0A087X9B7_BCL2L1-      ga------cgacg-agcagacgttg--gagacgcacgc---------taa
A0A3B3TUS7_BCL2L1-      ga------cgacg-agcagacgttg--gagacgcacgc---------taa
A0A3Q2FR43_BCL2L1-      ga------cgacg-agcgtacgccg--gagacgcacgc---------taa
A0A3Q3B3X5_BCL2L1-      ga------ggacg-cagagatgaca--gagacacacgc---------caa
A0A667ZHE8_BCL2L1-      gc------cgagg-aacagcgggta--gcgacacatgc---------caa
A0A3Q3G2E1_BCL2L1-      gg------tgagg-aacagcaggta--gcgacgcacgc---------caa
A0A3Q3G2E1_BCL2L1-      gg------tgagg-aacagcaggta--gcgacgcacgc---------caa
A0A3Q3G2E1_BCL2L1-      gg------tgagg-aacagcaggta--gcgacgcacgc---------caa
A0A3Q3MX20_BCL2L1-      gg------tgagg-aacagcggata--gcaacgcatgc---------caa
A0A0D6DR75_BCL2L1-      gc------tgagg-aacagcggata--gcgacgcacgc---------caa
A0A3Q1GZ93_BCL2L1-      ag------tgagg-aacagcggata--gcaacgcacgc---------caa
A0A4W6BQD5_BCL2L1-      ag------tgagg-aagagcggata--gcaacacacgc---------caa
A0A3B4V3T1_BCL2L1-      gt------tgagg-aacagcggata--gcgacgcacgc---------caa
A0A3B4XU17_BCL2L1-      gt------tgagg-aacagcggata--gcgacgcacgc---------caa
A0A673BZP5_BCL2L1-      gg------tgagg-aacagcgggta--agtacgcatgc---------caa
A0A671WXV0_BCL2L1-      ---------------------------gcgacgcacgc---------caa
A0A219P0Y3_BCL2L1-      gg------tgagg-agcagcgggta--gcgacacacgc---------caa
A0A8C9WU15_BCL2L1-      gt------tgagg-aggagagggta--gcgacgcacgc---------caa
A0A1A7ZDF6_BCL2L1-      ggggg---tgagg-aggagaggaca--gagacacacgc---------caa
A0A8F0MQ26_BCL2L1-      gg------tgagg-aacagcgggta--gcaacgcacgc---------caa
A0A672IDC1_BCL2L1-      gg------ccccg-accagcggacg--gagacgcacgc---------caa
A0A672IDC1_BCL2L1-      gg------ccccg-accagcggacg--gagacgcacgc---------caa
A0A3Q0RTF8_BCL2L1-      ga------tgagg-aacagcgaata--gatacacacgc---------caa
A0A668RI12_BCL2L1-      ga------tgagg-aacagcgaata--gacacacacgc---------caa
I3IZK7_BCL2L1-01        ga------tgagg-aacagcgaata--gacacacacgc---------caa
A0A3Q4N4B5_BCL2L1-      ga------tgagg-aacagcgaata--gacacacacgc---------caa
A0A3Q2X557_BCL2L1-      ga------tgagg-aacagcgaata--gacacacacgc---------caa
A0A3P8P0F1_BCL2L1-      ga------tgagg-aacagcgaata--gacacacacgc---------caa
A0A3P9D632_BCL2L1-      ga------tgagg-aacagcgaata--gacacacacgc---------caa
A0A3P9D632_BCL2L1-      ga------tgagg-aacagcgaata--gacacacacgc---------caa
A0A3B4FNX1_BCL2L1-      ga------tgagg-aacagcgaata--gacacacacgc---------caa
A0A8C2ZZ68_BCL2L1-      ggcgatgccgagg-aacagcgggta--gcgacgcacgc---------taa
G3NJY1_BCL2L1-01        gc------tggtg-ggcagcgggga--gcgacgcactc---------caa
A0A3B3DHA1_BCL2L1-      gg------cgagg-agcagagcaca--gagacgcacgc---------caa
A0A3P9JYH1_BCL2L1-      gg------cgagg-agcagagcacg--gagacgcacgc---------caa
A0A3B3IB64_BCL2L1-      gg------cgagg-agcagagcacg--gagacgcacgc---------caa
A0A8C7YJI1_BCL2L1-      gg------cgagg-agcacagcacg--gagacgcacgc---------caa
C3VIT1_BCL2L1-01        gg------cgagg-agcagagcaca--gagacgcacgc---------caa
A0A3B4Z3X2_BCL2L1-      gc------tgagg-aacagcggaca--gagacacacgc---------caa
A0A3B4Z3X2_BCL2L1-      gc------tgagg-aacagcggaca--gagacacacgc---------caa
A0A3Q1FR00_BCL2L1-      gg------agagg-accagcggaca--gagacacacgc---------caa
A0A3Q1FR00_BCL2L1-      gg------agagg-accagcggaca--gagacacacgc---------caa
A0A3Q1DHJ3_BCL2L1-      gg------agagg-aacagcggaca--gagacacacgc---------caa
A0A3Q1DHJ3_BCL2L1-      gg------agagg-aacagcggaca--gagacacacgc---------caa
A0A3Q1DHJ3_BCL2L1-      gg------agagg-aacagcggaca--gagacacacgc---------caa
A0A3P8TL99_BCL2L1-      gg------agagg-aacagcggaca--gagacacacgc---------caa
A0A3P8TL99_BCL2L1-      gg------agagg-aacagcggaca--gagacacacgc---------caa
A0A8C6UPI9_BCL2L1-      --------tggaaacaagg-cagcttgtgtcctg--------------aa
A0A3B4BFZ8_BCL2L1-      --------gggcaacaagg-cagctaatgtcccg--------------aa
A0A3B3E2W4_BCL2L1-      --------ag------aggaccgctctgctacctg------------caa
A0A3P9MKK4_BCL2L1-      --------ag------aggaccactccgctgcccg------------gaa
A0A3P9MKK4_BCL2L1-      --------ag------aggaccactccgctgcccg------------gaa
A0A3B3I2Q5_BCL2L1-      --------ag------aggaccactccgatgcccg------------gaa
A0A3B3I2Q5_BCL2L1-      --------ag------aggaccactccgatgcccg------------gaa
A0A3P9I2N4_BCL2L1-      --------ag------aggaccactccgctgcccg------------gaa
A0A3P9I2N4_BCL2L1-      --------ag------aggaccactccgctgcccg------------gaa
A0A8C7XSQ2_BCL2L1-      --------ag------aggaccactccactgcccg------------gaa
A0A8C7XSQ2_BCL2L1-      --------ag------aggaccactccactgcccg------------gaa
A0A3P8VMA1_BCL2L1-      --------aggtgaggaggtcaccacagcgtccag------------taa
A0A3Q2C6K4_BCL2L1-      --------gggagacaaggacgcctcggcttccag------------caa
A0A3B5MGS2_BCL2L1-      --------ttgggaaggggacagccgggtccctcg------------caa
M4A558_BCL2L1-01        --------ttgggaaggggacagccgggtccctag------------caa
A0A3P9QFB3_BCL2L1-      --------ttgggacggggacagccggggccctag------------caa
A0A3B3XN57_BCL2L1-      --------ttgggacggggacagccggggccctag------------caa
A0A087YBW4_BCL2L1-      --------ttgggatggggacagccggggccctag------------caa
A0A3B3VWI7_BCL2L1-      --------ttgggatggggacagccggggccctag------------caa
A0A1A8A2S0_BCL2L1-      --------ggaggactgggacaattcagctgctag------------caa
A0A672JL90_BCL2L1-      --------ggaagaccaggccagctcatcggccag------------caa
A0A672Z262_BCL2L1-      --------aggagacaaggccaacaccactgtctc------------taa
A0A3Q3BEB7_BCL2L1-      --------g------aaggccagctcggctcccag------------taa
A0A0F7L1T6_BCL2L1-      --------gggagaaaagaggagccccgctgcttc------------caa
H2U5I3_BCL2L1-01        --------gggagaaaagaggagccccgctgcttc------------caa
A0A8C2ZH46_BCL2L1-      --------gggagacgaagccgacccagcatccag------------taa
G3P7B4_BCL2L1-01        --------gggagacaaggccaactcggcgtccg----------------
A0A3Q3FUB6_BCL2L1-      --------gggagacatggaaaactctgctgccag------------taa
A0A3Q3X5M5_BCL2L1-      --------aggagacaaggccagctctgctgccag------------aaa
A0A665VSD7_BCL2L1-      --------aggagacaaggccaactcagctgctag------------gaa
A0A8D3CTR5_BCL2L1-      --------gggagacaaggccaactcagctgccag------------caa
A0A3Q1JZ46_BCL2L1-      --------gggagacagacccaactcagcagctgc------------taa
A0A3B5B4X7_BCL2L1-      --------gggagacaagaccaactctgctgccag------------taa
A0A3Q1EVP6_BCL2L1-      --------tggggacaaggccagctcagcctccag------------taa
A0A6G7K5D7_BCL2L1-      --------tggggacaaggccaactcagcttccag------------taa
A0A3Q1BQA0_BCL2L1-      --------tggggacaaggccaactcagcttccag------------taa
A0A3P8U812_BCL2L1-      --------tggggacaaggccaactcagcttccag------------taa
A0A3Q3NFM4_BCL2L1-      --------gggagacatgaccggtgcagctgccac------------caa
A0A4W6EST2_BCL2L1-      --------gggagataagaccaactcagctgccag------------taa
A0A3B4V9K8_BCL2L1-      --------gggagacaaggccaactcagctgccag------------taa
A0A3B4XS24_BCL2L1-      --------gggagacaaggccagctcagctgccag------------taa
A0A510BW31_BCL2L1-      --------gcgagacaaggccagctcagctgccag------------taa
A0A8D0AAQ8_BCL2L1-      --------aggagacaaggccaactcagctgccag------------taa
A0A8C4IRU9_BCL2L1-      --------gggagacaaggccaactcagctgccag------------aaa
E6ZFR0_BCL2L1-01        --------gggagacaaggccaactcagctgccag------------aaa
                                                                          

R4JQR8_BCL2L1-01        ctgtcctacgt----------------tagact-----------------
A0A346RRN1_BCL2L1-      ctgtccctcgt----------------tggaag-----------------
A0A8C4STP1_BCL2L1-      tggctctgtca------------g---tggaacagaaaatggaggcagct
A0A8C4XBF6_BCL2L1-      tgggac---------------------tggaataatcaat------agct
Q90ZH2_BCL2L1-01        tggaa-cttct------------acttcagag-----------------c
Q2TAP5_BCL2L1-01        tggaa-cttct------------acttcagag-----------------c
Q91828_BCL2L1-01        tggaaccttct------------acttcagag-----------------c
A0A8C5WFB8_BCL2L1-      -----------------------g---cagga--------------ggac
A0A4X2KZ04_BCL2L1-      tagtactgtga------------a---tggta--------------gccc
F6WA14_BCL2L1-01        tagtactgtga------------a---tggca--------------gtcc
A0A7N4P3X2_BCL2L1-      tagtactgtga------------a---tggca--------------gccc
A0A7N4P3X2_BCL2L1-      tagtactgtga------------a---tggca--------------gccc
A0A8C5YLY6_BCL2L1-      caatgccacca------------g---cggca--------------accc
A0A8D2IA38_BCL2L1-      caatgccacca------------a---cagca--------------accc
A0A8D2IA38_BCL2L1-      caatgccacca------------a---cagca--------------accc
G3SPN0_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
O35843_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
Q7TS62_BCL2L1-02        cagtgccatca------------a---tggca--------------accc
Q7TS62_BCL2L1-03        cagtgccatca------------a---tggca--------------accc
Q5HZH3_BCL2L1-02        cagtgccatca------------a---tggca--------------accc
A0A8C6G6C7_BCL2L1-      cagtgccatca------------a---tggca--------------accc
Q7TS62_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A6I9LMY5_BCL2L1-      cagtgccgtca------------a---tggca--------------accc
B2Z3Z4_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A8C6W748_BCL2L1-      cagtgccatca------------a---tggca--------------accc
H0X6V2_BCL2L1-01        cagtgccatta------------a---tggca--------------accc
A0A286Y5D6_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8D2AGI2_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A287CZ07_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C9UNM3_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8D2I760_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C2YUU6_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C2YUU6_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C2YUU6_BCL2L1-      cagtgccatca------------a---tggca--------------accc
G1P9D2_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A8C5NZI4_BCL2L1-      cagtgctatca------------a---tggta--------------accc
A0A3Q2H0F6_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8B9XQH5_BCL2L1-      cagtgccatca------------a---tggca--------------acgc
Q05KJ0_BCL2L1-01        cagtgccatca------------a---tggca--------------acgc
Q05KJ0_BCL2L1-02        cagtgccatca------------a---tggca--------------acgc
A0A8C6DX24_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A452FWV3_BCL2L1-      cagtgccatca------------a---tggca--------------accc
Q9MZS7_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A8C3WJH5_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8D1ALD6_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A4X1SQU7_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8D0XF62_BCL2L1-      tagtgccatca------------a---tggca--------------accc
O77737_BCL2L1-01        tagtgccatca------------a---tggca--------------accc
A0A8D0J6V8_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8D0J6V8_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8D0J6V8_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8D0J6V8_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8D0J6V8_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A4X1SQU7_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A4X1SQU7_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A4X1SQU7_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A4X1SRM7_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8D0XF62_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8D1ALD6_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A4X1SQU7_BCL2L1-      tagtgccatca------------a---tggca--------------accc
A0A8C4L2X1_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A3Q2H0F6_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A250YD48_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A1L5BWY3_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8B7FNN3_BCL2L1-      cagtgccatta------------a---tggca--------------accc
A0A8B7FNN3_BCL2L1-      cagtgccatta------------a---tggca--------------accc
A0A8B7FNN3_BCL2L1-      cagtgccatta------------a---tggca--------------accc
A0A8B7FNN3_BCL2L1-      cagtgccatta------------a---tggca--------------accc
A0A2K6G3C5_BCL2L1-      cagtgccatta------------a---tggca--------------accc
A0A2K6G3C5_BCL2L1-      cagtgccatta------------a---tggca--------------accc
E2IV76_BCL2L1-01        cagtgccatta------------a---tggca--------------accc
A0A8C8YN28_BCL2L1-      cagtgccatta------------a---tggca--------------accc
A0A8I3ZZI7_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A5F7ZJK5_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K6UWY8_BCL2L1-      cagtgccatca------------a---tggca--------------accc
E2IV77_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A2K6UWY8_BCL2L1-      cagtgccatca------------a---t----------------------
A0A8I3ZZI7_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5EBP4_BCL2L1-      cagtgccatca------------a---t----------------------
A0A2K5EBP4_BCL2L1-      cagtgccatca------------a---tggca--------------accc
E2IV75_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A6D2VXZ3_BCL2L1-      cagtgccatca------------a---tggca--------------accc
G1RER8_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A7I2V597_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2R8Z9D7_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2R8Z9D7_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5H963_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5H963_BCL2L1-      cagtgccatca------------a---tggca--------------accc
Q2PFS6_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A8C9GFE0_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K6QFA2_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5M8B1_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5M8B1_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5VPG2_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8I5MVB8_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8D2ERY7_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5YR37_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5YR37_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5VPG2_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A5F7ZJK5_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A5F7ZJK5_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A5F7ZJK5_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A5F7ZJK5_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A0D9RJZ8_BCL2L1-      cagtgccatca------------a---tggca--------------accc
I7GKS6_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A2K6QFA2_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K6QFA2_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A2K5YR37_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A5F5XYW0_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C7BPR9_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A5F5XYW0_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8B8VBB9_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C6F2V6_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C9BM97_BCL2L1-      cagtgccatca------------a---tggca--------------accc
M3Z2H9_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A8C7BPR9_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A5F5XYW0_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C0TGM4_BCL2L1-      cagtgccatca------------a---tggca--------------accc
Q76LT7_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
Q8SQ42_BCL2L1-01        cagtgccatca------------a---tggca--------------accc
A0A673UUI0_BCL2L1-      cagtgccgtca------------a---tggca--------------accc
A0A452SDS4_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A384D3U1_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C9D5N1_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A8C9M2S8_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A667HK09_BCL2L1-      cagtgccatca------------a---tggca--------------accc
A0A3Q1LRT3_BCL2L1-      ---------------------------tggca--------------accc
A0A4W2D608_BCL2L1-      ---------------------------tggaa--------------accc
A0A4W2D608_BCL2L1-      ---------------------------tggaa--------------accc
A0A4W2F845_BCL2L1-      ---------------------------tggca--------------accc
A0A4W2F845_BCL2L1-      ---------------------------tggca--------------accc
A0A8B9WB42_BCL2L1-      ---------------------------tggca--------------accc
A0A8C6FN58_BCL2L1-      aaaagccatca------------a---tggca--------------accc
A0A452E1B1_BCL2L1-      cagcgccatca------------g---tggca--------------accc
W5PSA5_BCL2L1-01        cagtgccatca------------g---tggca--------------accc
A0A8B9X9C2_BCL2L1-      -aatgccatca------------a---tgaca--------------accc
A0A452FHY1_BCL2L1-      -aatgccgtca------------a---tgcca--------------accc
A0A452FHY1_BCL2L1-      -aatgccgtca------------a---tgcca--------------accc
H3ANS8_BCL2L1-01        cagactcccga------------gg--agggg--------------gcca
W5MG74_BCL2L1-01        ----gttc-------------------gggga--------------gccc
H9GHK7_BCL2L1-01        gaacaccctca------------a---tggga--------------gccc
A0A6I8PIR3_BCL2L1-      c--------------------------cgggc--------------ggcc
A0A8D0HVA8_BCL2L1-      gagtgtgccta------------a---tggga--------------gccc
A0A8D0HVA8_BCL2L1-      gagtgtgccta------------a---tggga--------------gccc
A0A8D0HVA8_BCL2L1-      gagtgtgccta------------a---tggga--------------gccc
A0A7M4EJG9_BCL2L1-      aagtgtcccga------------a---tggga--------------gtcc
A0A670IBZ4_BCL2L1-      cagcgtcccca------------a---tggga--------------gtcc
A0A8D0E1K1_BCL2L1-      cggcgtcccca------------a---cggga--------------gccc
A0A8D2L5P2_BCL2L1-      gggcgtcctca------------a---cggga--------------gccc
A0A8C6V6T2_BCL2L1-      cggcgtcctga------------acggcggga--------------gccc
A0A8C5RX62_BCL2L1-      cggtgtcctga------------atggtggga--------------gccc
A0A670Z9Y4_BCL2L1-      cggcgtcctga------------acggcggga--------------gccc
A0A8C8S850_BCL2L1-      aagcgtcccta------------a---tggga--------------gtcc
K7F655_BCL2L1-01        aagcgtcccta------------a---tggga--------------gtcc
A0A8C0IVL6_BCL2L1-      aagtgtcccta------------a---tggga--------------gtcc
A0A8C4W8N7_BCL2L1-      aagtgtcccta------------a---tggga--------------gtcc
A0A8C3RIU8_BCL2L1-      aagcgtcccta------------a---tggga--------------gtcc
A0A8C3IUT0_BCL2L1-      aagcgtcccta------------a---tggga--------------gtcc
A0A8C3IUT0_BCL2L1-      aagcgtcccta------------a---tggga--------------gtcc
A0A8C3IUT0_BCL2L1-      aagcgtcccta------------a---tggga--------------gtcc
A0A8C3IUT0_BCL2L1-      aagcgtcccta------------a---tggga--------------gtcc
A0A674J5J7_BCL2L1-      aagcgtcccta------------a---tggga--------------gtcc
A0A8B9CUX0_BCL2L1-      cggggtgctca------------a---cggga--------------gccc
A0A8B9DB39_BCL2L1-      cggggtgctca------------a---cggga--------------gccc
A0A493TIA6_BCL2L1-      ---ggtgctca------------a---cggga--------------gccc
A0A8C3CGW6_BCL2L1-      ---ggtgctca------------a---cggga--------------gccc
A0A8B9SM69_BCL2L1-      ---ggtgctca------------a---cggga--------------gccc
A0A8B9V5I0_BCL2L1-      ---ggtgctca------------a---cggga--------------gccc
A0A8C7ECQ9_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A669P0Q7_BCL2L1-      cagcgtcctca------------a---tggga--------------gccc
A0A8C2T2M7_BCL2L1-      cagcgtcctca------------a---cggga--------------gccc
A0A8C9EN38_BCL2L1-      cagcgtcctca------------a---tggga--------------gccc
A0A8C3LRK6_BCL2L1-      cagcgtcctca------------a---tggga--------------gccc
G1N5N5_BCL2L1-01        cagcgtcctca------------a---tggga--------------gccc
A0A8B9NWH6_BCL2L1-      cggtgtcctta------------a---tggga--------------gccc
A0A8B9NWH6_BCL2L1-      cggtgtcctta------------a---tggga--------------gccc
A0A8C4JDK2_BCL2L1-      cggtgtcctca------------a---cggga--------------gccc
A0A8C4JDK2_BCL2L1-      cggtgtcctca------------a---cggga--------------gccc
A0A8C5JFI3_BCL2L1-      cggggtcctca------------a---cggga--------------gccc
A0A8D2M680_BCL2L1-      cggggtcctca------------a---cggga--------------gccc
A0A803VLI1_BCL2L1-      cggcgtgctca------------a---cggaa--------------gccc
A0A8C5U1E1_BCL2L1-      cggtgtcctca------------a---tggga--------------gccc
A0A8C3U3Q2_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A8C0U194_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
H0Z8G3_BCL2L1-01        cggggtcctca------------a---cggga--------------gccc
Q4U2V6_BCL2L1-01        cggggtcctca------------a---cggga--------------gccc
A0A8C9NN65_BCL2L1-      cggggtcctca------------a---cggga--------------gccc
A0A8C3XCF2_BCL2L1-      tggcgtcctca------------a---tggga--------------gccc
A0A8D2NN48_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A8C0FL84_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A8C0AYR5_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A8C4TWS5_BCL2L1-      cggcgtcctca------------a---tggga--------------gccc
A0A8C3KQJ2_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A8C8A4L8_BCL2L1-      cggtgtcctca------------a---cggga--------------gccc
A0A8D0FHG7_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A8B9N2I0_BCL2L1-      cggcgtcctca------------a---tggga--------------gccc
A0A663ECL2_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A8C0AYR5_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A8B9FKI5_BCL2L1-      cggcgtcctca------------a---tggga--------------gccc
A0A672UKR0_BCL2L1-      cggcgtcctca------------a---cggga--------------gccc
A0A3B5K6B9_BCL2L1-      tggaactttta------------a---tggtgcaag--------------
H3CH49_BCL2L1-01        tggaactttta------------a---tggggcaag--------------
A0A059PJI5_BCL2L1-      tggcaccctaa------------a---cgggaccggatc-----------
A0A8C5B4N8_BCL2L1-      tgggttacggttgaacg------a---cggtaacgg--------------
D2ITA2_BCL2L1-02        tgggttacggttgaacg------a---cggtaacgg--------------
C1BLI0_BCL2L1-01        tggatctgttgaaaatg------a---ccgaaattgcata------ggca
A0A3B3ZMX9_BCL2L1-      ctcggctgcagagagaa------a---cagaggtggacag------tacg
A0A3B3ZMX9_BCL2L1-      ctccacccc------------------ctcacttag--------------
A0A667Y1V0_BCL2L1-      tggctcactggccaaca------g---caggaccggcgcc------ggcc
A0A3P8XFS0_BCL2L1-      tgggtctgtggggaacg------g---caggaacagcaga------cgca
A0A3P8XFS0_BCL2L1-      tgggtctgtggggaacg------g---caggaacagcaga------cgca
A0A4W5LYF9_BCL2L1-      tgggtctttggggaaca------a---caggaacggcaga------agca
A0A6F8ZUL6_BCL2L1-      tgggtctttggggaaca------a---caggaatggcaga------agca
A0A674C4N2_BCL2L1-      tgggtctttgggaaaca------a---caggaacggcaga------agca
A0A8C7RD80_BCL2L1-      tgggtctttggggaaca------a---caggaacggcaga------agca
A0A8C7CBC7_BCL2L1-      tgggtctttggggaaca------a---caggaacggcaga------agca
A0A8C7CBC7_BCL2L1-      tgggtctttggggaaca------a---caggaacggcaga------agca
A0A8C8GSY4_BCL2L1-      tgggtctttggggaaca------a---caggaacggcaga------agca
A0A8C8GSY4_BCL2L1-      tgggtctttggggaaca------a---caggaacggcaga------agca
A0A6F9CY91_BCL2L1-      tgggtctgtggggaaca------a---caggaacagcaga------agca
A0A060XE41_BCL2L1-      tgggtctgtggggaact------a---ccggaacagcaga------agca
A0A286MU87_BCL2L1-      tgggtctgtggggaact------a---ccggaacagcaga------agca
A0A8C8J941_BCL2L1-      tgggtctgtggggaact------a---ctggaacagcaga------agca
A0A8C7FX38_BCL2L1-      tgggtctgtggggaact------a---ctggaacagcaga------agca
A0A4W5JPK5_BCL2L1-      tgggtctgtggggaaca------a---caggaacagcaga------agca
C0HAD8_BCL2L1-01        tgggtctgtgg------------------ggaacagcaga------agca
A0A673Z4J6_BCL2L1-      tgggtctgtgg------------------ggaacagcaga------agca
A0A3B3QRZ2_BCL2L1-      tgggtcggtcattgctg------g---cggcaccagca------------
A0A3P8UWG7_BCL2L1-      cgggactgtaa------------a---cggcacaag--------------
A0A345BSW9_BCL2L1-      cggctccatga------------a---caga-------------------
B2GRK1_BCL2L1-01        tggcaccatga------------a---tagaacgaacgct------agtt
B2GRK1_BCL2L1-02        tggcaccatga------------a---tagaacgaacgct------agtt
Q90Z98_BCL2L1-01        tggcaccatga------------a---tagaacgaacgct------agtt
A0A672K8R2_BCL2L1-      tggctccctaa------------a---cggaacaagtact------ggtt
A0A8C1JXA4_BCL2L1-      tggctccctga------------a---cggaacaagtact------ggtt
A0A673M4N6_BCL2L1-      tggctccctaa------------a---cggaacaagtact------ggtt
A0A673M4N6_BCL2L1-      tggctccctaa------------a---cggaacaagtact------ggtt
A0A671QPE4_BCL2L1-      tggctccctga------------a---cggaacaagtact------ggtt
A0A672N8N5_BCL2L1-      tggctccctga------------a---cggaacaagtact------ggtt
A0A671K7W7_BCL2L1-      tggctccctaa------------a---cggaacaagtact------ggtt
A0A671K7W7_BCL2L1-      tggctccctaa------------a---cggaacaagtact------ggtt
A0A673IGS5_BCL2L1-      tggctccctaa------------a---cggaacaagtact------ggtt
A0A8C5D4L1_BCL2L1-      cggcctccagg------------a---cagagacggggtg------a---
A0A8C5D4L1_BCL2L1-      cggcctccagg------------a---cagagacggggtg------a---
A0A8C5D4L1_BCL2L1-      cggcctccagg------------a---cagagacggggtg------a---
A0A4W4GHX3_BCL2L1-      tggctct----------------a---cggca--ag--------------
A0A3B4DTL9_BCL2L1-      cggatccgtaa------------a---tgggacaag--------------
A0A3B1JJ42_BCL2L1-      cgggtccgtaa------------a---tgggacgag--------------
A0A8B9LKW7_BCL2L1-      cgggtccgtaa------------a---tgggacgag--------------
A0A8C9SVL8_BCL2L1-      cgggtctgcga------------a---cggagggagtcgg------g---
A0A8C4CMF6_BCL2L1-      cggctcagtga------------a---cggaacaagcgcg------t---
A0A3B3TFR4_BCL2L1-      tggatcggtca------------g---tagcgggaa--------------
A0A3P8XYL5_BCL2L1-      tggcacaatga------------a---tgggacgag--------------
A0A6F9B188_BCL2L1-      cggcacagtaa------------a---cgggacgag--------------
A0A4W5R2W6_BCL2L1-      cggcacagtga------------a---cgggacgag--------------
A0A4W5R2W6_BCL2L1-      cggcacagtga------------a---cgggacgag--------------
A0A674C578_BCL2L1-      cggcgcagcga------------a---cgggacgag--------------
A0A674C578_BCL2L1-      cggcgcagcga------------a---cgggacgag--------------
A0A8C7IJ10_BCL2L1-      tggcacagtga------------a---cgggacgag--------------
A0A8C8D057_BCL2L1-      tggcacagtga------------a---cgggacgag--------------
A0A8C7P574_BCL2L1-      cggcacagtga------------a---cgggacgag--------------
A0A8C7IJ10_BCL2L1-      tggcacagtga------------a---cgggacgag--------------
A0A8C8D057_BCL2L1-      tggcacagtga------------a---cgggacgag--------------
A0A6F9BJ02_BCL2L1-      ctgcacaatga------------a---cgggacgag--------------
A0A4W5NQ40_BCL2L1-      cggcacagtga------------a---cgggacgag--------------
A0A8C7UB69_BCL2L1-      ----------a------------a---cgggacgag--------------
A0A8C7J9N8_BCL2L1-      ----------a------------a---cgggacgag--------------
A0A8C8FJG7_BCL2L1-      ----------a------------a---cgggacgag--------------
B5XAY3_BCL2L1-01        ----------a------------a---cgggacgag--------------
A0A674C337_BCL2L1-      ----------a------------a---cgggacgag--------------
A0A8C9SET9_BCL2L1-      cggcgcggtga------------g---cagg-------------------
A0A8C5G971_BCL2L1-      tggaactttga------------a---cg---------------------
A0A8C5FC81_BCL2L1-      cggcacgccga------------a---cggcaccac--------------
A0A665VM40_BCL2L1-      cggaactttta------------a---tggcacaag--------------
A0A3Q3WIW8_BCL2L1-      tgggactttta------------a---cggtacgag--------------
A0A3B5PQJ0_BCL2L1-      tgggactttta------------a---cgggacgag--------------
A0A3P9N9Y4_BCL2L1-      tgggactttta------------a---cgggacaag--------------
A0A3B3WI27_BCL2L1-      tgggactttta------------a---cgggacaag--------------
A0A087X9B7_BCL2L1-      tgggactttta------------a---cgggacaag--------------
A0A3B3TUS7_BCL2L1-      tgggactttta------------a---cgggacaag--------------
A0A3Q2FR43_BCL2L1-      cgggactttta------------a---cgggaccag--------------
A0A3Q3B3X5_BCL2L1-      tgggactttta------------a---cgggactag--------------
A0A667ZHE8_BCL2L1-      cgggacactca------------a---cggcacgag--------------
A0A3Q3G2E1_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3Q3G2E1_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3Q3G2E1_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3Q3MX20_BCL2L1-      cgggactttta------------a---tggcacaag--------------
A0A0D6DR75_BCL2L1-      cggtactttta------------a---cggaagaag--------------
A0A3Q1GZ93_BCL2L1-      cgggactttta------------a---tggtagaag--------------
A0A4W6BQD5_BCL2L1-      cggaactttta------------a---cagcacgag--------------
A0A3B4V3T1_BCL2L1-      tggaactttta------------a---tggcacaag--------------
A0A3B4XU17_BCL2L1-      tggaactttta------------a---tggcacgag--------------
A0A673BZP5_BCL2L1-      cgggactttta------------a---tggcacaag--------------
A0A671WXV0_BCL2L1-      tgggactttta------------a---cggcatgag--------------
A0A219P0Y3_BCL2L1-      cgggactttta------------a---tggcatgag--------------
A0A8C9WU15_BCL2L1-      cgggactttga------------a---cggcacgag--------------
A0A1A7ZDF6_BCL2L1-      tgggaccttta------------a---caggacgag--------------
A0A8F0MQ26_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A672IDC1_BCL2L1-      cgggactttta------------c---cagcaggag--------------
A0A672IDC1_BCL2L1-      cgggactttta------------c---cagcaggag--------------
A0A3Q0RTF8_BCL2L1-      tgggactttta------------a---tggcacaag--------------
A0A668RI12_BCL2L1-      tgggactttta------------a---tggcacgag--------------
I3IZK7_BCL2L1-01        tgggactttta------------a---tggcacgag--------------
A0A3Q4N4B5_BCL2L1-      tgggactttta------------a---tggcacgag--------------
A0A3Q2X557_BCL2L1-      tgggactttta------------a---tggcacgag--------------
A0A3P8P0F1_BCL2L1-      tgggactttta------------a---tggcacgag--------------
A0A3P9D632_BCL2L1-      tgggactttta------------a---tggcacgag--------------
A0A3P9D632_BCL2L1-      tgggactttta------------a---tggcacgag--------------
A0A3B4FNX1_BCL2L1-      tgggactttta------------a---tggcaccag--------------
A0A8C2ZZ68_BCL2L1-      cgggactttca------------a---tggcacaag--------------
G3NJY1_BCL2L1-01        cgggactttca------------a---cggcacgag--------------
A0A3B3DHA1_BCL2L1-      cgggacgttta------------a---cgggacgag--------------
A0A3P9JYH1_BCL2L1-      cgggacgttta------------a---cgggacaac--------------
A0A3B3IB64_BCL2L1-      cgggacgttta------------a---cgggacaac--------------
A0A8C7YJI1_BCL2L1-      cgggacgttta------------a---cgggacaac--------------
C3VIT1_BCL2L1-01        cgggactttta------------c---cgggaccag--------------
A0A3B4Z3X2_BCL2L1-      cgggactttta------------a---tggcacgag--------------
A0A3B4Z3X2_BCL2L1-      cgggactttta------------a---tggcacgag--------------
A0A3Q1FR00_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3Q1FR00_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3Q1DHJ3_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3Q1DHJ3_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3Q1DHJ3_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3P8TL99_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A3P8TL99_BCL2L1-      cgggactttta------------a---cggcacgag--------------
A0A8C6UPI9_BCL2L1-      cggtctgctgtctaacc------------ccaatggcagt------agac
A0A3B4BFZ8_BCL2L1-      tggtatgctaacaaacc------------ggaatggcaac------agac
A0A3B3E2W4_BCL2L1-      cggcacactggtcaaca------g---cgaggac------------ggcc
A0A3P9MKK4_BCL2L1-      tggcaggccggtcagca------g---tgaggac------------tgcc
A0A3P9MKK4_BCL2L1-      tggcaggccggtcagca------g---tgaggac------------tgcc
A0A3B3I2Q5_BCL2L1-      tcgcaggctggtcagca------g---tgaggac------------ggcc
A0A3B3I2Q5_BCL2L1-      tcgcaggctggtcagca------g---tgaggac------------ggcc
A0A3P9I2N4_BCL2L1-      cggcaggcaggtcagca------g---tgaggac------------ggcc
A0A3P9I2N4_BCL2L1-      cggcaggcaggtcagca------g---tgaggac------------ggcc
A0A8C7XSQ2_BCL2L1-      cggcaggccggtcagca------g---tgaggac------------ggcc
A0A8C7XSQ2_BCL2L1-      cggcaggccggtcagca------g---tgaggac------------ggcc
A0A3P8VMA1_BCL2L1-      tggc-----gttcctca---------------------------------
A0A3Q2C6K4_BCL2L1-      tggcccacttttcaaca------g---caggccc------------agcc
A0A3B5MGS2_BCL2L1-      tggcccgctggtcaaca------g---ctgggcc------------gggc
M4A558_BCL2L1-01        tggccggctggtcaaca------g---ccgggcc------------gggc
A0A3P9QFB3_BCL2L1-      tggcccgctggtcaaca------g---ccgggct------------ggct
A0A3B3XN57_BCL2L1-      tggcccgctggtcaaca------g---ctgggcc------------ggct
A0A087YBW4_BCL2L1-      tggtccgctggtcaaca------g---ctgggcc------------ggct
A0A3B3VWI7_BCL2L1-      tggtccgctggtcaaca------g---ctgggcc------------ggct
A0A1A8A2S0_BCL2L1-      tggccggctggtcagca------g---cagggac------------agcc
A0A672JL90_BCL2L1-      tggctcggtgttcagcg------g---cagtg------------------
A0A672Z262_BCL2L1-      tggcttattggcgaaca------g---taggaacggaggt------ggac
A0A3Q3BEB7_BCL2L1-      cggcttgctggtcaaca------g---tagggac------------ggcc
A0A0F7L1T6_BCL2L1-      tggcctgctggtccgca------g---caggaacaggggt------gg--
H2U5I3_BCL2L1-01        tggcctgctggtccgca------g---caggaacaggggt------gg--
A0A8C2ZH46_BCL2L1-      cggctcgctggtcaacggcgggga---cggggacggggcc------ggcc
G3P7B4_BCL2L1-01        ----ttcctggac----------g---cgggagcagcgcc------ggcc
A0A3Q3FUB6_BCL2L1-      tggctttttggtcaaca------g---caggaaccgggcc------ggcc
A0A3Q3X5M5_BCL2L1-      tggcttgctggtcaaca------g---cagtagtaggggt------ggac
A0A665VSD7_BCL2L1-      tggcctacctgtcatca------g---tgggagcatgctg------agtt
A0A8D3CTR5_BCL2L1-      tggcttgttggtcgacg------g---cggcaac----------------
A0A3Q1JZ46_BCL2L1-      cggcctgccggtcagca------g---gag---------t------ggcg
A0A3B5B4X7_BCL2L1-      cggcttgctggtgaaca------g---caga-------------------
A0A3Q1EVP6_BCL2L1-      cggcttgctggtgaaca------a---caga-------------------
A0A6G7K5D7_BCL2L1-      cggcttgctggtgaaca------g---caga-------------------
A0A3Q1BQA0_BCL2L1-      tggcttgctggtgaaca------g---caga-------------------
A0A3P8U812_BCL2L1-      cggcttgctggtgaaca------g---caga-------------------
A0A3Q3NFM4_BCL2L1-      cggcttgctggtcaaca------g---caggtatgtcagc------ggcc
A0A4W6EST2_BCL2L1-      cggcttgctggtcaaca------g---cagggacaggtgt------ggtc
A0A3B4V9K8_BCL2L1-      tggcttgttggtcaaca------g---cagtgacaggtgt------ggtc
A0A3B4XS24_BCL2L1-      tggcttgttggtcaaca------g---cagtgacaggtgt------ggtc
A0A510BW31_BCL2L1-      cggcttgctggtcaaca------g---caggaatgggggc------agcc
A0A8D0AAQ8_BCL2L1-      cggcctgctggtcaaca------g---ccgaaatgggggc------ggcc
A0A8C4IRU9_BCL2L1-      cggcttgctggcca------------------------------------
E6ZFR0_BCL2L1-01        cggcttgctggccagca------------agaacacaagt------ggcc
                                                                          

R4JQR8_BCL2L1-01        ---------------------------------------------tgcca
A0A346RRN1_BCL2L1-      ---------------------------------------------tccca
A0A8C4STP1_BCL2L1-      cttctgcag------------------------------------accac
A0A8C4XBF6_BCL2L1-      tcccagcca------------------------------------ctcca
Q90ZH2_BCL2L1-01        gccccgggg-----------------------------------------
Q2TAP5_BCL2L1-01        gccccgggg-----------------------------------------
Q91828_BCL2L1-01        gccccgggg-----------------------------------------
A0A8C5WFB8_BCL2L1-      attctggaa-----------------------------------------
A0A4X2KZ04_BCL2L1-      ctcttggca-------------c-------cctgct---------gacaa
F6WA14_BCL2L1-01        ctcttggca-------------c-------cctgct---------gacag
A0A7N4P3X2_BCL2L1-      ctcttggca-------------c-------cctgct---------gacag
A0A7N4P3X2_BCL2L1-      ctcttggca-------------c-------cctgct---------gacag
A0A8C5YLY6_BCL2L1-      atcccggca-------------t-------cagggg---------gacag
A0A8D2IA38_BCL2L1-      atcccggca-------------t-------cagggg---------gacag
A0A8D2IA38_BCL2L1-      atcccggca-------------t-------cagggg---------gacag
G3SPN0_BCL2L1-01        atcccggca-------------c-------ctggca---------gacag
O35843_BCL2L1-01        atcctggca-------------c-------ctggcg---------gatag
Q7TS62_BCL2L1-02        atcctggca-------------c-------ctggcg---------gatag
Q7TS62_BCL2L1-03        atcctggca-------------c-------ctggcg---------gatag
Q5HZH3_BCL2L1-02        atcctggca-------------c-------ctggcg---------gatag
A0A8C6G6C7_BCL2L1-      atcctggca-------------c-------ctggcg---------gatag
Q7TS62_BCL2L1-01        atcctggca-------------c-------ctggcg---------gatag
A0A6I9LMY5_BCL2L1-      atcctggcg-------------c-------ctggcc---------gacag
B2Z3Z4_BCL2L1-01        atcctggca-------------c-------ctggcg---------gacag
A0A8C6W748_BCL2L1-      atcctggca-------------t-------ctggtg---------gacag
H0X6V2_BCL2L1-01        atcctggca-------------c-------ctggct---------gacag
A0A286Y5D6_BCL2L1-      atcctggca-------------c-------ctaact---------gatag
A0A8D2AGI2_BCL2L1-      atcctggca-------------c-------ctgacg---------gacag
A0A287CZ07_BCL2L1-      atcctggca-------------t-------ctggcc---------gacag
A0A8C9UNM3_BCL2L1-      atcctggca-------------t-------ctggcc---------gacag
A0A8D2I760_BCL2L1-      atcctggca-------------t-------ctggcc---------gacag
A0A8C2YUU6_BCL2L1-      atcctggca-------------c-------ctggcg---------gatag
A0A8C2YUU6_BCL2L1-      atcctggca-------------c-------ctggcg---------gatag
A0A8C2YUU6_BCL2L1-      atcctggca-------------c-------ctggcg---------gatag
G1P9D2_BCL2L1-01        atcctggca-------------c-------ctggtg---------gacag
A0A8C5NZI4_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A3Q2H0F6_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8B9XQH5_BCL2L1-      atcctggca-------------c-------ctggcg---------gatag
Q05KJ0_BCL2L1-01        atcctggca-------------c-------ctggcg---------gatag
Q05KJ0_BCL2L1-02        atcctggca-------------c-------ctggcg---------gatag
A0A8C6DX24_BCL2L1-      atcctggca-------------c-------ctggcg---------gatag
A0A452FWV3_BCL2L1-      atcttggca-------------c-------ctggcg---------gatag
Q9MZS7_BCL2L1-01        atcttggca-------------c-------ctggcg---------gatag
A0A8C3WJH5_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8D1ALD6_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A4X1SQU7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8D0XF62_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
O77737_BCL2L1-01        atcctggca-------------c-------ctggcg---------gacag
A0A8D0J6V8_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8D0J6V8_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8D0J6V8_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8D0J6V8_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8D0J6V8_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A4X1SQU7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A4X1SQU7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A4X1SQU7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A4X1SRM7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8D0XF62_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8D1ALD6_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A4X1SQU7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8C4L2X1_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A3Q2H0F6_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A250YD48_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A1L5BWY3_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A8B7FNN3_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8B7FNN3_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8B7FNN3_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A8B7FNN3_BCL2L1-      atcct---------------------------------------------
A0A2K6G3C5_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A2K6G3C5_BCL2L1-      atcct---------------------------------------------
E2IV76_BCL2L1-01        atcctggca-------------c-------ctggca---------gacag
A0A8C8YN28_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A8I3ZZI7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A5F7ZJK5_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A2K6UWY8_BCL2L1-      agcctggca-------------c-------ctggcg---------gacag
E2IV77_BCL2L1-01        agcctggca-------------c-------ctggcg---------gacag
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
E2IV75_BCL2L1-01        atcctggca-------------c-------ctggcg---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A6D2VXZ3_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
G1RER8_BCL2L1-01        atcctggca-------------c-------ctggcg---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A7I2V597_BCL2L1-      atcctggca-------------c-------ctggca---------gacag
A0A2R8Z9D7_BCL2L1-      atcctggca-------------c-------ctggcg---------gacag
A0A2R8Z9D7_BCL2L1-      atcct---------------------------------------------
A0A2K5H963_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A2K5H963_BCL2L1-      atcct---------------------------------------------
Q2PFS6_BCL2L1-01        atcctggca-------------c-------ctggtg---------gacag
A0A8C9GFE0_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A2K6QFA2_BCL2L1-      atcct---------------------------------------------
A0A2K5M8B1_BCL2L1-      atcct---------------------------------------------
A0A2K5M8B1_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A2K5VPG2_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A8I5MVB8_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A8D2ERY7_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A2K5YR37_BCL2L1-      atcctgg-------------------------------------------
A0A2K5YR37_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A2K5VPG2_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A5F7ZJK5_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A5F7ZJK5_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A5F7ZJK5_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A5F7ZJK5_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A0D9RJZ8_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
I7GKS6_BCL2L1-01        atcctgg-------------------------------------------
A0A2K6QFA2_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A2K6QFA2_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A2K5YR37_BCL2L1-      atcctggca-------------c-------ctggtg---------gacag
A0A5F5XYW0_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A8C7BPR9_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A5F5XYW0_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A8B8VBB9_BCL2L1-      gtcctggca-------------c-------ctggca---------gacag
A0A8C6F2V6_BCL2L1-      gtcctggca-------------c-------ctggca---------gacag
A0A8C9BM97_BCL2L1-      gtcctggca-------------c-------ctggca---------gacag
M3Z2H9_BCL2L1-01        atcctggca-------------c-------ctggcg---------gacag
A0A8C7BPR9_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A5F5XYW0_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A8C0TGM4_BCL2L1-      atcctggca-------------c-------ttggca---------gacag
Q76LT7_BCL2L1-01        atcctggca-------------c-------ttggca---------gacag
Q8SQ42_BCL2L1-01        atcctggca-------------c-------ttggca---------gacag
A0A673UUI0_BCL2L1-      atcctggca-------------c-------ttggca---------gacag
A0A452SDS4_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A384D3U1_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A8C9D5N1_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A8C9M2S8_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A667HK09_BCL2L1-      atcctggca-------------c-------ttggcg---------gacag
A0A3Q1LRT3_BCL2L1-      atcctggca-------------c-------ctggca---------gatag
A0A4W2D608_BCL2L1-      ----------------------------------cc---------aatag
A0A4W2D608_BCL2L1-      ----------------------------------cc---------aatag
A0A4W2F845_BCL2L1-      atcctggca-------------c-------ctggca---------gatag
A0A4W2F845_BCL2L1-      atcctggca-------------c-------ctggca---------gatag
A0A8B9WB42_BCL2L1-      atcctggca-------------c-------ctggca---------gatag
A0A8C6FN58_BCL2L1-      atcctggca-------------c-------ctagca---------gatag
A0A452E1B1_BCL2L1-      atcctggca-------------c-------ctggca---------gatag
W5PSA5_BCL2L1-01        atcctggca-------------c-------ctggca---------gatag
A0A8B9X9C2_BCL2L1-      atctt---------------------------------------------
A0A452FHY1_BCL2L1-      atcttggca-------------c-------ctggcg---------catag
A0A452FHY1_BCL2L1-      atcttggca-------------c-------ctggcg---------catag
H3ANS8_BCL2L1-01        ttccaggca-------------tggacccacccaac---------ggcag
W5MG74_BCL2L1-01        gaacgcaga-------------g-------gagcgt---------acgaa
H9GHK7_BCL2L1-01        ttcttggca-------------t-------cccagc---------cccag
A0A6I8PIR3_BCL2L1-      c-------------------------------------------------
A0A8D0HVA8_BCL2L1-      atcctggca-------------t-------cccagt---------gccag
A0A8D0HVA8_BCL2L1-      atcctggca-------------t-------cccagt---------gccag
A0A8D0HVA8_BCL2L1-      atcctggca-------------t-------cccagt---------gccag
A0A7M4EJG9_BCL2L1-      gtcctggca-------------t-------cccact---------gccag
A0A670IBZ4_BCL2L1-      gtcttggca-------------t-------caaagt---------accag
A0A8D0E1K1_BCL2L1-      ctcgtgggc-------------c-------tccggc---------agcag
A0A8D2L5P2_BCL2L1-      ctcttggca-------------c-------accggc---------agcag
A0A8C6V6T2_BCL2L1-      ctcctggca-------------c-------cccagc---------cccag
A0A8C5RX62_BCL2L1-      ctcctggca-------------c-------cccagc---------cccag
A0A670Z9Y4_BCL2L1-      ctcctggca-------------c-------cccagc---------cccag
A0A8C8S850_BCL2L1-      atcctggca-------------t-------cagggt---------gccag
K7F655_BCL2L1-01        atcctggca-------------t-------ccaggt---------gccag
A0A8C0IVL6_BCL2L1-      atcctggca-------------t-------ccgggt---------gccag
A0A8C4W8N7_BCL2L1-      atcctggca-------------t-------cagggt---------gccag
A0A8C3RIU8_BCL2L1-      atcctggca-------------t-------ccgggt---------gccag
A0A8C3IUT0_BCL2L1-      atcctggca-------------c-------ccgggt---------gccag
A0A8C3IUT0_BCL2L1-      atcctggca-------------c-------ccgggt---------gccag
A0A8C3IUT0_BCL2L1-      atcctggca-------------c-------ccgggt---------gccag
A0A8C3IUT0_BCL2L1-      atcctggca-------------c-------ccgggt---------gccag
A0A674J5J7_BCL2L1-      atcctggca-------------t-------ccgggt---------gccag
A0A8B9CUX0_BCL2L1-      gtcctggca-------------c-------ccgccc---------gccag
A0A8B9DB39_BCL2L1-      gtcctggca-------------c-------ccgccc---------gccag
A0A493TIA6_BCL2L1-      ctcctggca-------------c-------ccccca---------gccgg
A0A8C3CGW6_BCL2L1-      ctcctggca-------------c-------ccgccc---------gccgg
A0A8B9SM69_BCL2L1-      ctcctggca-------------c-------ccccca---------gccgg
A0A8B9V5I0_BCL2L1-      ctcctggca-------------c-------ccccca---------gccgg
A0A8C7ECQ9_BCL2L1-      gtcctggca-------------c-------cccccg---------ggcag
A0A669P0Q7_BCL2L1-      atcctggca-------------c-------ccgcct---------gccgg
A0A8C2T2M7_BCL2L1-      atcgtggca-------------c-------ccgcct---------gccgg
A0A8C9EN38_BCL2L1-      gtcctggca-------------c-------cctcct---------gccgg
A0A8C3LRK6_BCL2L1-      gtcctggca-------------c-------ccgcct---------gccgg
G1N5N5_BCL2L1-01        atcctggca-------------c-------ccgcct---------gccgg
A0A8B9NWH6_BCL2L1-      atcctggca-------------c-------ccccct---------gctag
A0A8B9NWH6_BCL2L1-      atcctggca-------------c-------ccccct---------gctag
A0A8C4JDK2_BCL2L1-      gtcctggca-------------c-------ccccct---------gccag
A0A8C4JDK2_BCL2L1-      gtcctggca-------------c-------ccccct---------gccag
A0A8C5JFI3_BCL2L1-      ctcctggca-------------c-------gcagcc---------accag
A0A8D2M680_BCL2L1-      ctcctggca-------------c-------gcagcc---------agcag
A0A803VLI1_BCL2L1-      ctcctggca-------------c-------gcaccc---------accag
A0A8C5U1E1_BCL2L1-      ctcctggca-------------c-------gcaccc---------accag
A0A8C3U3Q2_BCL2L1-      ctcctggca-------------c-------gcaccc---------accag
A0A8C0U194_BCL2L1-      ctcctggca-------------t-------gcaccc---------accag
H0Z8G3_BCL2L1-01        ctcctggca-------------c-------gcggcc---------accag
Q4U2V6_BCL2L1-01        ctcctggca-------------c-------gcggcc---------accag
A0A8C9NN65_BCL2L1-      ctcctggca-------------c-------gcggcc---------accag
A0A8C3XCF2_BCL2L1-      ctcctggca-------------c-------gcgcct---------accag
A0A8D2NN48_BCL2L1-      ctcctggca-------------c-------gcgccg---------accag
A0A8C0FL84_BCL2L1-      ctcctggca-------------c-------ccgccc---------gccag
A0A8C0AYR5_BCL2L1-      ctcctggca-------------c-------ccgccc---------gccag
A0A8C4TWS5_BCL2L1-      ctcttggca-------------c-------ccgccc---------gccag
A0A8C3KQJ2_BCL2L1-      ctcctggca-------------c-------caaccc---------gccag
A0A8C8A4L8_BCL2L1-      ctcctggca-------------c-------ccgccc---------gccag
A0A8D0FHG7_BCL2L1-      ctcctggca-------------c-------ccgccc---------gccag
A0A8B9N2I0_BCL2L1-      ctcctggca-------------c-------ccgcct---------gccag
A0A663ECL2_BCL2L1-      ctcctggca-------------c-------ccgccc---------gccag
A0A8C0AYR5_BCL2L1-      ctcctggca-------------c-------ccgccc---------gccag
A0A8B9FKI5_BCL2L1-      ctcctggca-------------c-------ccgccc---------gccag
A0A672UKR0_BCL2L1-      ctcctggca-------------c-------cctccc---------gccag
A0A3B5K6B9_BCL2L1-      -ccctggaa-------------c-------accccc---------agca-
H3CH49_BCL2L1-01        -tcctggaa-------------c-------cccccc---------agcac
A0A059PJI5_BCL2L1-      -ggcaggca-------------c-------tccacc---------g----
A0A8C5B4N8_BCL2L1-      --------------------------------------------------
D2ITA2_BCL2L1-02        --------------------------------------------------
C1BLI0_BCL2L1-01        gtctgggga-----------------------------------------
A0A3B3ZMX9_BCL2L1-      gaactcaga---------------------cttgac---------tccgc
A0A3B3ZMX9_BCL2L1-      --actcaga---------------------cttgac---------tccgc
A0A667Y1V0_BCL2L1-      agccgggga-----------------------------------------
A0A3P8XFS0_BCL2L1-      atttgggaa-----------------------------------------
A0A3P8XFS0_BCL2L1-      atttgggaa-----------------------------------------
A0A4W5LYF9_BCL2L1-      atttgggta-----------------------------------------
A0A6F8ZUL6_BCL2L1-      atttgggta-----------------------------------------
A0A674C4N2_BCL2L1-      atttgggta-----------------------------------------
A0A8C7RD80_BCL2L1-      atttgggta-----------------------------------------
A0A8C7CBC7_BCL2L1-      atttgggta-----------------------------------------
A0A8C7CBC7_BCL2L1-      atttgggta-----------------------------------------
A0A8C8GSY4_BCL2L1-      atttgggta-----------------------------------------
A0A8C8GSY4_BCL2L1-      atttgggta-----------------------------------------
A0A6F9CY91_BCL2L1-      atttaggga-----------------------------------------
A0A060XE41_BCL2L1-      atttggcga-----------------------------------------
A0A286MU87_BCL2L1-      atttggcga-----------------------------------------
A0A8C8J941_BCL2L1-      atttggcga-----------------------------------------
A0A8C7FX38_BCL2L1-      atttggcga-----------------------------------------
A0A4W5JPK5_BCL2L1-      atttggcga-----------------------------------------
C0HAD8_BCL2L1-01        atttggcga-----------------------------------------
A0A673Z4J6_BCL2L1-      acttggcaa-----------------------------------------
A0A3B3QRZ2_BCL2L1-      -gccaggtg----------------------tcccc---------agtgc
A0A3P8UWG7_BCL2L1-      -ttctggga-------------c-------gccgcc---------tgcat
A0A345BSW9_BCL2L1-      --------a-------------c-------cccacc---------acaat
B2GRK1_BCL2L1-01        ccactggga-------------c-------cccacc---------acaat
B2GRK1_BCL2L1-02        ccactggga-------------c-------cccacc---------acaat
Q90Z98_BCL2L1-01        ccactggga-------------c-------cccacc---------acaat
A0A672K8R2_BCL2L1-      ccactggga-------------c-------cccacc---------aaggt
A0A8C1JXA4_BCL2L1-      ccactggga-------------c-------cccacc---------aaggt
A0A673M4N6_BCL2L1-      ccactggga-------------c-------cccacc---------aaggt
A0A673M4N6_BCL2L1-      ccactggga-------------c-------cccacc---------aaggt
A0A671QPE4_BCL2L1-      ccactggga-------------c-------cccacc---------aaggt
A0A672N8N5_BCL2L1-      ccactggga-------------c-------cccgcc---------aaggt
A0A671K7W7_BCL2L1-      ccactggga-------------c-------cccacc---------aaggt
A0A671K7W7_BCL2L1-      ccactggga-------------c-------cccacc---------aaggt
A0A673IGS5_BCL2L1-      ccactggga-------------c-------cccacc---------aaggt
A0A8C5D4L1_BCL2L1-      -tccca----------------c-------ctcgcc---------a----
A0A8C5D4L1_BCL2L1-      -tccca----------------c-------ctcgcc---------a----
A0A8C5D4L1_BCL2L1-      -tccca----------------c-------ctcgcc---------a----
A0A4W4GHX3_BCL2L1-      -cccca----------------c-------ccggtt---------gccgg
A0A3B4DTL9_BCL2L1-      -tcacggtc-----------------------------------------
A0A3B1JJ42_BCL2L1-      -tcacggtg-----------------------------------------
A0A8B9LKW7_BCL2L1-      -tcacggtg-----------------------------------------
A0A8C9SVL8_BCL2L1-      -gattgggg-----------------------------------------
A0A8C4CMF6_BCL2L1-      -tgccggcatccgccgagctgtc-------cccgct---------gctgt
A0A3B3TFR4_BCL2L1-      -ctctgtgg------------------------gcc---------agggt
A0A3P8XYL5_BCL2L1-      -tcctggga-------------c-------t---cc---------aac--
A0A6F9B188_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A4W5R2W6_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A4W5R2W6_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A674C578_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A674C578_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A8C7IJ10_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A8C8D057_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A8C7P574_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A8C7IJ10_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A8C8D057_BCL2L1-      -tcctggga-------------c-------t---cc---------acc--
A0A6F9BJ02_BCL2L1-      -tcctggta-------------c-------tccacc---------acc--
A0A4W5NQ40_BCL2L1-      -tcccggga-------------c-------tccacc---------acc--
A0A8C7UB69_BCL2L1-      -tcccggta-------------c-------tcctcc---------acc--
A0A8C7J9N8_BCL2L1-      -tcccggta-------------c-------tcctcc---------acc--
A0A8C8FJG7_BCL2L1-      -tcccggta-------------c-------tcctcc---------acc--
B5XAY3_BCL2L1-01        -tcccggga-------------c-------tccacc---------acc--
A0A674C337_BCL2L1-      -tcccggga-------------c-------tccacc---------acc--
A0A8C9SET9_BCL2L1-      -----ggcg-------------c-------ctctcc---------tggac
A0A8C5G971_BCL2L1-      -----------------------------------------------cgt
A0A8C5FC81_BCL2L1-      -caccgccg-------------c-------cgccgc---------cacgc
A0A665VM40_BCL2L1-      -ttctggaa-------------c-------ccggtc---------agagt
A0A3Q3WIW8_BCL2L1-      -tcccggga-------------c-------ccctcc---------aaggt
A0A3B5PQJ0_BCL2L1-      -tccaggat-------------c-------ccc-----------------
A0A3P9N9Y4_BCL2L1-      -tccaggat-------------c-------ccc-----------------
A0A3B3WI27_BCL2L1-      -tccaggat-------------c-------ccc-----------------
A0A087X9B7_BCL2L1-      -tccaggat-------------c-------ccc-----------------
A0A3B3TUS7_BCL2L1-      -tccaggat-------------c-------ccc-----------------
A0A3Q2FR43_BCL2L1-      -tccaggct-------------c-------ccc-----------------
A0A3Q3B3X5_BCL2L1-      -tcctggga-------------c-------cccgcc---------ggcgt
A0A667ZHE8_BCL2L1-      -tccgggca-------------c-------cccgcc---------ggcat
A0A3Q3G2E1_BCL2L1-      -tcctggaa-------------c-------cccccc---------agcgt
A0A3Q3G2E1_BCL2L1-      -tcctggaa-------------c-------cccccc---------agcgt
A0A3Q3G2E1_BCL2L1-      -tcctggaa-------------c-------cccccc---------agcgt
A0A3Q3MX20_BCL2L1-      -tcctggga-------------c-------cccccc---------agcgt
A0A0D6DR75_BCL2L1-      -tcctggaa-------------c-------cccccc---------agcat
A0A3Q1GZ93_BCL2L1-      -tcccggga-------------c-------cccccc---------agcgt
A0A4W6BQD5_BCL2L1-      -tcctggga-------------c-------ccctcc---------agcgt
A0A3B4V3T1_BCL2L1-      -tcctggga-------------c-------ccgtgc---------agagt
A0A3B4XU17_BCL2L1-      -tcctggga-------------c-------ccgtcc---------agagt
A0A673BZP5_BCL2L1-      -tcctggga-------------c-------ccctcc---------agcat
A0A671WXV0_BCL2L1-      -tcctggca-------------c-------accccc---------agcat
A0A219P0Y3_BCL2L1-      -tcccggga-------------c-------cccgcc---------agcat
A0A8C9WU15_BCL2L1-      -tcccggga-------------c-------cccacc---------agcgt
A0A1A7ZDF6_BCL2L1-      -tcccggga-------------c-------cccagc---------ggcgt
A0A8F0MQ26_BCL2L1-      -tcccggta-------------c-------ccctcc---------aggat
A0A672IDC1_BCL2L1-      -cagcggga-------------g-------cccgcc---------gccgt
A0A672IDC1_BCL2L1-      -cagcggga-------------g-------cccgcc---------gccgt
A0A3Q0RTF8_BCL2L1-      -tcccggta-------------c-------cccgcc---------agcgt
A0A668RI12_BCL2L1-      -tcccggga-------------c-------ccctcc---------ggcat
I3IZK7_BCL2L1-01        -tcccggga-------------c-------ccctcc---------ggcat
A0A3Q4N4B5_BCL2L1-      -tcccggga-------------c-------cccacc---------ggcat
A0A3Q2X557_BCL2L1-      -tcccggga-------------c-------cccacc---------ggcat
A0A3P8P0F1_BCL2L1-      -tcccggga-------------c-------cccacc---------ggcat
A0A3P9D632_BCL2L1-      -tcccggga-------------c-------cccacc---------ggcat
A0A3P9D632_BCL2L1-      -tcccggga-------------c-------cccacc---------ggcat
A0A3B4FNX1_BCL2L1-      -tcccggga-------------c-------cccacc---------ggcat
A0A8C2ZZ68_BCL2L1-      -tcccggga-------------c-------cccacc---------ggcat
G3NJY1_BCL2L1-01        -tcccggga-------------c-------cccgcc---------ggcgt
A0A3B3DHA1_BCL2L1-      -tcccggga-------------c-------cccgcc---------gctat
A0A3P9JYH1_BCL2L1-      -tcccggga-------------c-------cccgcc---------gctct
A0A3B3IB64_BCL2L1-      -tcccggga-------------c-------cccgcc---------gctct
A0A8C7YJI1_BCL2L1-      -tcccggga-------------c-------cccgcc---------gctct
C3VIT1_BCL2L1-01        -tcccggga-------------c-------cccgcc---------ggtgt
A0A3B4Z3X2_BCL2L1-      -tcccggga-------------c-------cccgcc---------gccgt
A0A3B4Z3X2_BCL2L1-      -tcccggga-------------c-------cccgcc---------gccgt
A0A3Q1FR00_BCL2L1-      -tcccggga-------------c-------cccccc---------gccgt
A0A3Q1FR00_BCL2L1-      -tcccggga-------------c-------cccccc---------gccgt
A0A3Q1DHJ3_BCL2L1-      -tcccggga-------------c-------cccccc---------gccgt
A0A3Q1DHJ3_BCL2L1-      -tcccggga-------------c-------cccccc---------gccgt
A0A3Q1DHJ3_BCL2L1-      -tcccggga-------------c-------cccccc---------gccgt
A0A3P8TL99_BCL2L1-      -tcccggga-------------c-------cccccc---------gccgt
A0A3P8TL99_BCL2L1-      -tcccggga-------------c-------cccccc---------gccgt
A0A8C6UPI9_BCL2L1-      gaactctga---------------------gctccc---------agtct
A0A3B4BFZ8_BCL2L1-      aaacactgg---------------------cctcac---------tgcct
A0A3B3E2W4_BCL2L1-      agctgaaga---------------------agtcct---------gcccc
A0A3P9MKK4_BCL2L1-      agctgagga---------------------ggtcct---------gtccc
A0A3P9MKK4_BCL2L1-      agctgagga---------------------ggtcct---------gtccc
A0A3B3I2Q5_BCL2L1-      ggctgagga---------------------ggtcct---------gtccc
A0A3B3I2Q5_BCL2L1-      ggctgagga---------------------ggtcct---------gtccc
A0A3P9I2N4_BCL2L1-      agctgagga---------------------ggtcct---------gtccc
A0A3P9I2N4_BCL2L1-      agctgagga---------------------ggtcct---------gtccc
A0A8C7XSQ2_BCL2L1-      agctgagga---------------------ggtcct---------gtccc
A0A8C7XSQ2_BCL2L1-      agctgagga---------------------ggtcct---------gtccc
A0A3P8VMA1_BCL2L1-      -------ga---------------------ctccttcagctgtgctgcag
A0A3Q2C6K4_BCL2L1-      cccccggga---------------------agcctc---------gggcc
A0A3B5MGS2_BCL2L1-      acccgggga---------------------aaccca---------ggggc
M4A558_BCL2L1-01        ccccgggga---------------------agccca---------ggggc
A0A3P9QFB3_BCL2L1-      cccggggga---------------------agtccc---------agggc
A0A3B3XN57_BCL2L1-      ccccaggga---------------------agtccc---------aggac
A0A087YBW4_BCL2L1-      ccccaggga---------------------agtccc---------gggac
A0A3B3VWI7_BCL2L1-      ccccaggga---------------------agtccc---------gggac
A0A1A8A2S0_BCL2L1-      caccaggga---------------------agactt---------gtgcc
A0A672JL90_BCL2L1-      ---ctgggc---------------------ggtccc---------agtct
A0A672Z262_BCL2L1-      aggcagtgg---------------------tgtcgc---------tgccc
A0A3Q3BEB7_BCL2L1-      agtcgggga---------------------agaaga------tctggccc
A0A0F7L1T6_BCL2L1-      -------ag---------------------cgtctc---------catcc
H2U5I3_BCL2L1-01        -------ag---------------------cgtctc---------catcc
A0A8C2ZH46_BCL2L1-      cgtcgggga---------------------cgtcat---------cgcct
G3P7B4_BCL2L1-01        agccgggga---------------------tgtcgtcgccaccgccgcca
A0A3Q3FUB6_BCL2L1-      agtcagtga---------------------tgtcat---------catcc
A0A3Q3X5M5_BCL2L1-      ------------------------------tgtctc---------cttcc
A0A665VSD7_BCL2L1-      acactagga---------------------cccccc---------caccc
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      agctgggga---------------------actcgt---------cacct
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      ggccgggga---------------------tgtcat---------catcc
A0A4W6EST2_BCL2L1-      agcaggggg---------------------cgccat---------cgccc
A0A3B4V9K8_BCL2L1-      agcccggga---------------------cgtcct---------cgccc
A0A3B4XS24_BCL2L1-      agcccggga---------------------cgtcct---------cgccc
A0A510BW31_BCL2L1-      agccgggga---------------------cttcat---------caccc
A0A8D0AAQ8_BCL2L1-      agccaggga---------------------tgtcgt---------tgccc
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        agccgggga---------------------cgtctt---------cgtcc
                                                                          

R4JQR8_BCL2L1-01        ccat----------------------------------------------
A0A346RRN1_BCL2L1-      cctt----------------------------------------------
A0A8C4STP1_BCL2L1-      tcgc---------------------ctgatgg------------------
A0A8C4XBF6_BCL2L1-      gcat---------------------ctaatgg------------------
Q90ZH2_BCL2L1-01        ----------------------------------------aaggggc---
Q2TAP5_BCL2L1-01        ----------------------------------------aaggggc---
Q91828_BCL2L1-01        ----------------------------------------aaggggc---
A0A8C5WFB8_BCL2L1-      -------------------------gcactga-----------aagt---
A0A4X2KZ04_BCL2L1-      ccat---------------------gcagtga--------gtggggc---
F6WA14_BCL2L1-01        ccgt---------------------gctgtga--------gtggggc---
A0A7N4P3X2_BCL2L1-      ccgt---------------------gcagtga--------gtggggc---
A0A7N4P3X2_BCL2L1-      ccgt---------------------gcagtga--------gtggggc---
A0A8C5YLY6_BCL2L1-      tccc---------------------atggtga--------gtggagc---
A0A8D2IA38_BCL2L1-      tccc---------------------atggtga--------gtggagc---
A0A8D2IA38_BCL2L1-      tccc---------------------atggtga--------gtggagc---
G3SPN0_BCL2L1-01        ccct---------------------gcggtga--------atggagc---
O35843_BCL2L1-01        cccg---------------------gccgtga--------atggagc---
Q7TS62_BCL2L1-02        cccc---------------------gcggtga--------atggagc---
Q7TS62_BCL2L1-03        cccc---------------------gcggtga--------atggagc---
Q5HZH3_BCL2L1-02        cccg---------------------gccgtga--------atggagc---
A0A8C6G6C7_BCL2L1-      cccc---------------------gccgtga--------atggagc---
Q7TS62_BCL2L1-01        cccc---------------------gcggtga--------atggagc---
A0A6I9LMY5_BCL2L1-      cccc---------------------gcggtga--------acggagc---
B2Z3Z4_BCL2L1-01        cccc---------------------gcggtaa--------atggagc---
A0A8C6W748_BCL2L1-      cccc---------------------gcggtga--------atggagc---
H0X6V2_BCL2L1-01        cccc---------------------acggtga--------atggagc---
A0A286Y5D6_BCL2L1-      tccc---------------------acggtga--------atggggc---
A0A8D2AGI2_BCL2L1-      cccg---------------------gcggtga--------atggagc---
A0A287CZ07_BCL2L1-      cccc---------------------gcgataa--------atggagc---
A0A8C9UNM3_BCL2L1-      cccc---------------------gcggtaa--------atggagc---
A0A8D2I760_BCL2L1-      cccc---------------------gcggtaa--------atggagc---
A0A8C2YUU6_BCL2L1-      ccgc---------------------acggtga--------atggggc---
A0A8C2YUU6_BCL2L1-      ccgc---------------------acggtga--------atggggc---
A0A8C2YUU6_BCL2L1-      ccgc---------------------acggtga--------atggggc---
G1P9D2_BCL2L1-01        ccct---------------------gcggtga--------atggagc---
A0A8C5NZI4_BCL2L1-      cccg---------------------gctgtga--------atggagc---
A0A3Q2H0F6_BCL2L1-      cccc---------------------acgggga--------atggagc---
A0A8B9XQH5_BCL2L1-      ccct---------------------gctgtga--------atggagc---
Q05KJ0_BCL2L1-01        ccct---------------------gctgtga--------atggagc---
Q05KJ0_BCL2L1-02        ccct---------------------gctgtga--------atggagc---
A0A8C6DX24_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A452FWV3_BCL2L1-      ccct---------------------gcggtga--------atggagc---
Q9MZS7_BCL2L1-01        ccct---------------------gcggtga--------atggagc---
A0A8C3WJH5_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D1ALD6_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A4X1SQU7_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D0XF62_BCL2L1-      cccc---------------------gcggtga--------atggagc---
O77737_BCL2L1-01        cccc---------------------gcggtga--------atggagc---
A0A8D0J6V8_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D0J6V8_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D0J6V8_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D0J6V8_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D0J6V8_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A4X1SQU7_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A4X1SQU7_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A4X1SQU7_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A4X1SRM7_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D0XF62_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D1ALD6_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A4X1SQU7_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8C4L2X1_BCL2L1-      cccc---------------------acgggga--------atggagc---
A0A3Q2H0F6_BCL2L1-      cccc---------------------acgggga--------atggagc---
A0A250YD48_BCL2L1-      cccc---------------------gcagtga--------atggagc---
A0A1L5BWY3_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8B7FNN3_BCL2L1-      cccc---------------------ccagtga--------atggagc---
A0A8B7FNN3_BCL2L1-      cccc---------------------ccagtga--------atggagc---
A0A8B7FNN3_BCL2L1-      cccc---------------------ccagtga--------atggagc---
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      cccc---------------------ccagcga--------atggagc---
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        ccct---------------------ccagcga--------atggagc---
A0A8C8YN28_BCL2L1-      ccct---------------------ccagcga--------atggagc---
A0A8I3ZZI7_BCL2L1-      ccca---------------------gtggtga--------atggagc---
A0A5F7ZJK5_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2K6UWY8_BCL2L1-      cccc---------------------gcggtga--------atggagc---
E2IV77_BCL2L1-01        cccc---------------------gcggtga--------atggagc---
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      ccca---------------------gtggtga--------atggagc---
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      cccc---------------------gcggtga--------atggagc---
E2IV75_BCL2L1-01        cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A6D2VXZ3_BCL2L1-      cccc---------------------gcggtga--------atggagc---
G1RER8_BCL2L1-01        cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A7I2V597_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2R8Z9D7_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        cccc---------------------gcggtga--------atggagc---
A0A8C9GFE0_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2K5VPG2_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8I5MVB8_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A8D2ERY7_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2K5VPG2_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A5F7ZJK5_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A5F7ZJK5_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A5F7ZJK5_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A5F7ZJK5_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A0D9RJZ8_BCL2L1-      cccc---------------------gcggtga--------atggagc---
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2K6QFA2_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A2K5YR37_BCL2L1-      cccc---------------------gcggtga--------atggagc---
A0A5F5XYW0_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A8C7BPR9_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A5F5XYW0_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A8B8VBB9_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A8C6F2V6_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A8C9BM97_BCL2L1-      ccct---------------------gcggtga--------atggagc---
M3Z2H9_BCL2L1-01        ccct---------------------gcggtga--------atggagc---
A0A8C7BPR9_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A5F5XYW0_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A8C0TGM4_BCL2L1-      ccct---------------------gcggtga--------atggagc---
Q76LT7_BCL2L1-01        ccct---------------------gcggtga--------atggagc---
Q8SQ42_BCL2L1-01        ccct---------------------gcggtga--------atggagc---
A0A673UUI0_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A452SDS4_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A384D3U1_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A8C9D5N1_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A8C9M2S8_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A667HK09_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A3Q1LRT3_BCL2L1-      cccc---------------------acagtga--------atggagc---
A0A4W2D608_BCL2L1-      cccc---------------------acagtga--------atggagc---
A0A4W2D608_BCL2L1-      cccc---------------------acagtga--------atggagc---
A0A4W2F845_BCL2L1-      cccc---------------------acagtga--------atggagc---
A0A4W2F845_BCL2L1-      cccc---------------------acagtga--------atggagc---
A0A8B9WB42_BCL2L1-      cccc---------------------acagtga--------atggagc---
A0A8C6FN58_BCL2L1-      ccct---------------------gcagtga--------agggagc---
A0A452E1B1_BCL2L1-      ctct---------------------gtggtga--------atggagc---
W5PSA5_BCL2L1-01        ccct---------------------gtggtga--------atggagc---
A0A8B9X9C2_BCL2L1-      ---------------------------------------------gc---
A0A452FHY1_BCL2L1-      ccct---------------------gcggtga--------atggagc---
A0A452FHY1_BCL2L1-      ccct---------------------gcggtga--------atggagc---
H3ANS8_BCL2L1-01        ccaccctcatgcaggactcaatggtgcggtta--------acgg-gt---
W5MG74_BCL2L1-01        cggc---------------------gcggcca--------atggcgg---
H9GHK7_BCL2L1-01        ccat---------------------gtcatca--------atggggc---
A0A6I8PIR3_BCL2L1-      -----------------------------------------cggcgg---
A0A8D0HVA8_BCL2L1-      tccc---------------------atagtga--------acggggc---
A0A8D0HVA8_BCL2L1-      tccc---------------------atagtga--------acggggc---
A0A8D0HVA8_BCL2L1-      tccc---------------------atagtga--------acggggc---
A0A7M4EJG9_BCL2L1-      ccac---------------------gtagtga--------atggggc---
A0A670IBZ4_BCL2L1-      cccg---------------------gtcgtaa--------atggggc---
A0A8D0E1K1_BCL2L1-      cccg---------------------gtgacga--------acggggc---
A0A8D2L5P2_BCL2L1-      cccg---------------------gtcgtca--------atggggc---
A0A8C6V6T2_BCL2L1-      cccg---------------------gtggtca--------acggggc---
A0A8C5RX62_BCL2L1-      cccg---------------------gtggtca--------acggggc---
A0A670Z9Y4_BCL2L1-      cccg---------------------gtggtca--------acggggc---
A0A8C8S850_BCL2L1-      ccac---------------------atggtga--------atggggc---
K7F655_BCL2L1-01        ccac---------------------gtagtga--------acggggc---
A0A8C0IVL6_BCL2L1-      ccac---------------------atagtga--------atggggc---
A0A8C4W8N7_BCL2L1-      ccac---------------------atagtga--------atggggc---
A0A8C3RIU8_BCL2L1-      ccac---------------------atagtga--------atggggc---
A0A8C3IUT0_BCL2L1-      ccac---------------------gtggtga--------atggggc---
A0A8C3IUT0_BCL2L1-      ccac---------------------gtggtga--------atggggc---
A0A8C3IUT0_BCL2L1-      ccac---------------------gtggtga--------atggggc---
A0A8C3IUT0_BCL2L1-      ccac---------------------gtggtga--------atggggc---
A0A674J5J7_BCL2L1-      ccac---------------------gtggtga--------atggggc---
A0A8B9CUX0_BCL2L1-      ccag---------------------gtagtga--------acggcgc---
A0A8B9DB39_BCL2L1-      ccag---------------------gtagtga--------acggcgc---
A0A493TIA6_BCL2L1-      ccag---------------------gtagtga--------acggcgc---
A0A8C3CGW6_BCL2L1-      ccag---------------------gtagtga--------acggcgc---
A0A8B9SM69_BCL2L1-      ccag---------------------gtagtga--------acggcgc---
A0A8B9V5I0_BCL2L1-      ccag---------------------gtagtga--------acggcgc---
A0A8C7ECQ9_BCL2L1-      ccac---------------------atagtaa--------acggagc---
A0A669P0Q7_BCL2L1-      ccac---------------------gtagtga--------atggagc---
A0A8C2T2M7_BCL2L1-      ccac---------------------gtagtga--------atggagc---
A0A8C9EN38_BCL2L1-      ccac---------------------gtagtga--------atggagc---
A0A8C3LRK6_BCL2L1-      ccac---------------------gtagtga--------atggagc---
G1N5N5_BCL2L1-01        ccac---------------------gtagtga--------atggagc---
A0A8B9NWH6_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A8B9NWH6_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A8C4JDK2_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8C4JDK2_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8C5JFI3_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A8D2M680_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A803VLI1_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A8C5U1E1_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A8C3U3Q2_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A8C0U194_BCL2L1-      ccac---------------------atagtga--------acggagc---
H0Z8G3_BCL2L1-01        ccac---------------------atagtga--------atggagc---
Q4U2V6_BCL2L1-01        ccac---------------------atagtga--------atggagc---
A0A8C9NN65_BCL2L1-      ccac---------------------atagtga--------atggagc---
A0A8C3XCF2_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A8D2NN48_BCL2L1-      ccac---------------------atagtga--------acggagc---
A0A8C0FL84_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8C0AYR5_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8C4TWS5_BCL2L1-      ccac---------------------gtagtga--------atggagc---
A0A8C3KQJ2_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8C8A4L8_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8D0FHG7_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8B9N2I0_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A663ECL2_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8C0AYR5_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A8B9FKI5_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A672UKR0_BCL2L1-      ccac---------------------gtagtga--------acggagc---
A0A3B5K6B9_BCL2L1-      -------------------------acaagtc--------tggca-----
H3CH49_BCL2L1-01        cctc---------------------ccagcac--------cagcagtcat
A0A059PJI5_BCL2L1-      ----------------------------------------cgatcgc---
A0A8C5B4N8_BCL2L1-      ----------------------------------------caatggc---
D2ITA2_BCL2L1-02        ----------------------------------------caatggc---
C1BLI0_BCL2L1-01        --------------------------------------------------
A0A3B3ZMX9_BCL2L1-      ctct---------------------gattctg--------cccccgt---
A0A3B3ZMX9_BCL2L1-      ctct---------------------gattctg--------ccccc-----
A0A667Y1V0_BCL2L1-      ----------------------------------------cgccgtc---
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A3P8XFS0_BCL2L1-      --------------------------------------------------
A0A4W5LYF9_BCL2L1-      --------------------------------------------------
A0A6F8ZUL6_BCL2L1-      --------------------------------------------------
A0A674C4N2_BCL2L1-      --------------------------------------------------
A0A8C7RD80_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C7CBC7_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A8C8GSY4_BCL2L1-      --------------------------------------------------
A0A6F9CY91_BCL2L1-      --------------------------------------------------
A0A060XE41_BCL2L1-      --------------------------------------------------
A0A286MU87_BCL2L1-      --------------------------------------------------
A0A8C8J941_BCL2L1-      --------------------------------------------------
A0A8C7FX38_BCL2L1-      --------------------------------------------------
A0A4W5JPK5_BCL2L1-      --------------------------------------------------
C0HAD8_BCL2L1-01        --------------------------------------------------
A0A673Z4J6_BCL2L1-      --------------------------------------------------
A0A3B3QRZ2_BCL2L1-      ctga---------------------gcagccg--------ctccatt---
A0A3P8UWG7_BCL2L1-      ctcc---------------------actgcgg--------cagcagc---
A0A345BSW9_BCL2L1-      cccc---------------------c-----g--------ctacatc---
B2GRK1_BCL2L1-01        cccc---------------------t-----g--------cttcatc---
B2GRK1_BCL2L1-02        cccc---------------------t-----g--------cttcatc---
Q90Z98_BCL2L1-01        cccc---------------------t-----g--------cttcatc---
A0A672K8R2_BCL2L1-      cccc---------------------c-----g--------cttcaac---
A0A8C1JXA4_BCL2L1-      cccc---------------------c-----a--------cttcagc---
A0A673M4N6_BCL2L1-      cccc---------------------c-----g--------cttcaac---
A0A673M4N6_BCL2L1-      cccc---------------------c-----g--------cttcaac---
A0A671QPE4_BCL2L1-      cccc---------------------c-----g--------cttcaac---
A0A672N8N5_BCL2L1-      cccc---------------------c-----g--------cttcaac---
A0A671K7W7_BCL2L1-      cccc---------------------c-----a--------cttcaac---
A0A671K7W7_BCL2L1-      cccc---------------------c-----a--------cttcaac---
A0A673IGS5_BCL2L1-      cccc---------------------c-----g--------cttcaac---
A0A8C5D4L1_BCL2L1-      ----------------------------------------cggcgat---
A0A8C5D4L1_BCL2L1-      ----------------------------------------cggcgat---
A0A8C5D4L1_BCL2L1-      ----------------------------------------cggcgat---
A0A4W4GHX3_BCL2L1-      cctc---------------------gcctgggccaa----gggcggc---
A0A3B4DTL9_BCL2L1-      ----------------------------------------cagcgg----
A0A3B1JJ42_BCL2L1-      ----------------------------------------cggcag----
A0A8B9LKW7_BCL2L1-      ----------------------------------------cggcag----
A0A8C9SVL8_BCL2L1-      ----------------------------------------cagccgc--c
A0A8C4CMF6_BCL2L1-      cccc---------------------ggtgctgtccgggaacggtagcggt
A0A3B3TFR4_BCL2L1-      gctc---------------------ccc------------tggaagg---
A0A3P8XYL5_BCL2L1-      -------------------------------a--------caacagt---
A0A6F9B188_BCL2L1-      -------------------------------g--------cgacagt---
A0A4W5R2W6_BCL2L1-      -------------------------------g--------cgacagt---
A0A4W5R2W6_BCL2L1-      -------------------------------g--------cgacagt---
A0A674C578_BCL2L1-      -------------------------------g--------cgacagt---
A0A674C578_BCL2L1-      -------------------------------g--------cgacagt---
A0A8C7IJ10_BCL2L1-      -------------------------------g--------cgacagt---
A0A8C8D057_BCL2L1-      -------------------------------g--------cgacagt---
A0A8C7P574_BCL2L1-      -------------------------------g--------cgacagt---
A0A8C7IJ10_BCL2L1-      -------------------------------g--------cgacagt---
A0A8C8D057_BCL2L1-      -------------------------------g--------cgacagt---
A0A6F9BJ02_BCL2L1-      -------------------------------a--------cggcagt---
A0A4W5NQ40_BCL2L1-      -------------------------------a--------cagcagt---
A0A8C7UB69_BCL2L1-      -------------------------------a--------cggcagt---
A0A8C7J9N8_BCL2L1-      -------------------------------a--------cggcagt---
A0A8C8FJG7_BCL2L1-      -------------------------------a--------cggcagt---
B5XAY3_BCL2L1-01        -------------------------------a--------cggcagt---
A0A674C337_BCL2L1-      -------------------------------a--------cggcagt---
A0A8C9SET9_BCL2L1-      cagc---------------------gac---g--------ctgccgg--a
A0A8C5G971_BCL2L1-      ctcc---------------------ggt---g--------cagcagc--a
A0A8C5FC81_BCL2L1-      cccc---------------------cccatcg--------cccccgccca
A0A665VM40_BCL2L1-      cccc---------------------aca---g--------gggcagc--a
A0A3Q3WIW8_BCL2L1-      cccc---------------------gct---g--------cggctgc--a
A0A3B5PQJ0_BCL2L1-      -------------------------------t--------aggcggc--a
A0A3P9N9Y4_BCL2L1-      -------------------------------g--------aggcggc--a
A0A3B3WI27_BCL2L1-      -------------------------------g--------aggcggc--a
A0A087X9B7_BCL2L1-      -------------------------------g--------aggcggc--a
A0A3B3TUS7_BCL2L1-      -------------------------------g--------aggcggc--a
A0A3Q2FR43_BCL2L1-      -------------------------------g--------cggcgac---
A0A3Q3B3X5_BCL2L1-      cccc---------------------act---g--------aggcagc--a
A0A667ZHE8_BCL2L1-      cgcc---------------------ctt---g--------cggcggg--a
A0A3Q3G2E1_BCL2L1-      cccc---------------------acaccgg--------cagcagc--a
A0A3Q3G2E1_BCL2L1-      cccc---------------------acaccgg--------cagcagc--a
A0A3Q3G2E1_BCL2L1-      cccc---------------------acaccgg--------cagcagc--a
A0A3Q3MX20_BCL2L1-      cccc---------------------gct---g--------cgacaag--a
A0A0D6DR75_BCL2L1-      cccc---------------------gct---c--------aggcaac--a
A0A3Q1GZ93_BCL2L1-      cccc---------------------gct---g--------cggcaac--a
A0A4W6BQD5_BCL2L1-      cccc---------------------act---g--------cggcagc--a
A0A3B4V3T1_BCL2L1-      cccc---------------------gca---g--------cggcagc--a
A0A3B4XU17_BCL2L1-      cccc---------------------gca---g--------cggcagc--a
A0A673BZP5_BCL2L1-      ctcc---------------------tgt---g--------cggcagc---
A0A671WXV0_BCL2L1-      cccc---------------------tct---t--------cggcagc--a
A0A219P0Y3_BCL2L1-      cccc---------------------gct---g--------cggcagc--a
A0A8C9WU15_BCL2L1-      cccc---------------------gct---g--------cggcagc--a
A0A1A7ZDF6_BCL2L1-      cccc---------------------gct---a--------cggcagc--a
A0A8F0MQ26_BCL2L1-      cccc---------------------gcc---g--------cggcagc--a
A0A672IDC1_BCL2L1-      cccc---------------------gct---g--------cggcagctgg
A0A672IDC1_BCL2L1-      cccc---------------------gct---g--------cggcagctgg
A0A3Q0RTF8_BCL2L1-      cccc---------------------gca---g--------cggcagc--a
A0A668RI12_BCL2L1-      cccc---------------------gca---g--------cggcagc--a
I3IZK7_BCL2L1-01        cccc---------------------gca---g--------cggcagc--a
A0A3Q4N4B5_BCL2L1-      cccc---------------------gcagcgg--------cggcagc--a
A0A3Q2X557_BCL2L1-      cccc---------------------gcagcgg--------cggcagc--a
A0A3P8P0F1_BCL2L1-      cccc---------------------gcagcgg--------cggcagc--a
A0A3P9D632_BCL2L1-      cccc---------------------gcagcgg--------cggcagc--a
A0A3P9D632_BCL2L1-      cccc---------------------gcagcgg--------cggcagc--a
A0A3B4FNX1_BCL2L1-      cccc---------------------gcagcgg--------cggcagc--a
A0A8C2ZZ68_BCL2L1-      cccc---------------------gct---g--------cgaccgc--a
G3NJY1_BCL2L1-01        cccc---------------------gct---g--------ctccagc--a
A0A3B3DHA1_BCL2L1-      cccc---------------------gct---g--------cgtcagc--a
A0A3P9JYH1_BCL2L1-      cccc---------------------gct---g--------cgagagc--a
A0A3B3IB64_BCL2L1-      cccc---------------------gct---g--------cgagagc--a
A0A8C7YJI1_BCL2L1-      cccc---------------------gct---g--------cgagagc--a
C3VIT1_BCL2L1-01        cccc---------------------tct---g--------aggcagc--a
A0A3B4Z3X2_BCL2L1-      cccc-----------------------------------------gc--g
A0A3B4Z3X2_BCL2L1-      cccc-----------------------------------------gc--g
A0A3Q1FR00_BCL2L1-      cccc-----------------------------------------gc--g
A0A3Q1FR00_BCL2L1-      cccc-----------------------------------------gc--g
A0A3Q1DHJ3_BCL2L1-      cccc-----------------------------------------gc--g
A0A3Q1DHJ3_BCL2L1-      cccc-----------------------------------------gc--g
A0A3Q1DHJ3_BCL2L1-      cccc-----------------------------------------gc--g
A0A3P8TL99_BCL2L1-      cccc-----------------------------------------gc--g
A0A3P8TL99_BCL2L1-      cccc-----------------------------------------gc--g
A0A8C6UPI9_BCL2L1-      c------------------------atgatca------------------
A0A3B4BFZ8_BCL2L1-      cctg---------------------atgatca------------------
A0A3B3E2W4_BCL2L1-      tgtt---------------------gtgctag------------------
A0A3P9MKK4_BCL2L1-      tgtt---------------------gtgctag------------------
A0A3P9MKK4_BCL2L1-      tgtt---------------------gtgctag------------------
A0A3B3I2Q5_BCL2L1-      tgtt---------------------gtgctag------------------
A0A3B3I2Q5_BCL2L1-      tgtt---------------------gtgctag------------------
A0A3P9I2N4_BCL2L1-      tgtt---------------------gtgctag------------------
A0A3P9I2N4_BCL2L1-      tgtt---------------------gtgctag------------------
A0A8C7XSQ2_BCL2L1-      tgtt---------------------gtgctag------------------
A0A8C7XSQ2_BCL2L1-      tgtt---------------------gtgctag------------------
A0A3P8VMA1_BCL2L1-      cact---------------------gcagtgg------------------
A0A3Q2C6K4_BCL2L1-      cccc---------------------atggaag------------------
A0A3B5MGS2_BCL2L1-      cctc---------------------cggccgg------------------
M4A558_BCL2L1-01        ccaa---------------------tggccgg------------------
A0A3P9QFB3_BCL2L1-      cctc---------------------c------------------------
A0A3B3XN57_BCL2L1-      cctc---------------------ccaccgg------------------
A0A087YBW4_BCL2L1-      cctc---------------------ccaccgg------------------
A0A3B3VWI7_BCL2L1-      cctc---------------------ccaccgg------------------
A0A1A8A2S0_BCL2L1-      cccc---------------------gtggtgg------------------
A0A672JL90_BCL2L1-      ccac---------------------gcgccga------------------
A0A672Z262_BCL2L1-      ccca---------------------gtggtga------------------
A0A3Q3BEB7_BCL2L1-      cgcc---------------------gcagcga------------------
A0A0F7L1T6_BCL2L1-      gcag---------------------gtgctgg------------------
H2U5I3_BCL2L1-01        gcag---------------------gtgctgg------------------
A0A8C2ZH46_BCL2L1-      ccgt---------------------ccggtga------------------
G3P7B4_BCL2L1-01        ccgt---------------------ccggtga------------------
A0A3Q3FUB6_BCL2L1-      ccac---------------------acaccga------------------
A0A3Q3X5M5_BCL2L1-      acag---------------------gtgctga------------------
A0A665VSD7_BCL2L1-      ccac---------------------catgtga------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      ccgt---------------------gtaagag------------------
A0A3B5B4X7_BCL2L1-      ---------------------------ggcgg------------------
A0A3Q1EVP6_BCL2L1-      ---------------------------gacgg------------------
A0A6G7K5D7_BCL2L1-      ---------------------------ggcgg------------------
A0A3Q1BQA0_BCL2L1-      ---------------------------ggtgg------------------
A0A3P8U812_BCL2L1-      ---------------------------ggtgg------------------
A0A3Q3NFM4_BCL2L1-      ccac---------------------atggagg------------------
A0A4W6EST2_BCL2L1-      ctgc---------------------gtggtgg------------------
A0A3B4V9K8_BCL2L1-      ccgc---------------------atggtgg------------------
A0A3B4XS24_BCL2L1-      ccgc---------------------atggtgg------------------
A0A510BW31_BCL2L1-      ccgc---------------------atggtga------------------
A0A8D0AAQ8_BCL2L1-      ccac---------------------gtggtga------------------
A0A8C4IRU9_BCL2L1-      -------------------------gcgctga------------------
E6ZFR0_BCL2L1-01        tcag---------------------gcgctga------------------
                                                                          

R4JQR8_BCL2L1-01        --------------------------------------------------
A0A346RRN1_BCL2L1-      --------------------------------------------------
A0A8C4STP1_BCL2L1-      --------------------------------------------------
A0A8C4XBF6_BCL2L1-      --------------------------------------------------
Q90ZH2_BCL2L1-01        --------------------------------------------------
Q2TAP5_BCL2L1-01        --------------------------------------------------
Q91828_BCL2L1-01        --------------------------------------------------
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      -------------------------------------ca------cagg-
F6WA14_BCL2L1-01        -------------------------------------ca------cagg-
A0A7N4P3X2_BCL2L1-      -------------------------------------ca------cagg-
A0A7N4P3X2_BCL2L1-      -------------------------------------ca------cagg-
A0A8C5YLY6_BCL2L1-      -------------------------------------cg------ctgg-
A0A8D2IA38_BCL2L1-      -------------------------------------cg------ctgg-
A0A8D2IA38_BCL2L1-      -------------------------------------cg------ctgg-
G3SPN0_BCL2L1-01        -------------------------------------ta------ctgg-
O35843_BCL2L1-01        -------------------------------------ca------ctgg-
Q7TS62_BCL2L1-02        -------------------------------------ca------ctgg-
Q7TS62_BCL2L1-03        -------------------------------------ca------ctgg-
Q5HZH3_BCL2L1-02        -------------------------------------ca------ctgg-
A0A8C6G6C7_BCL2L1-      -------------------------------------ca------ctgg-
Q7TS62_BCL2L1-01        -------------------------------------ca------ctgg-
A0A6I9LMY5_BCL2L1-      -------------------------------------ca------ctgg-
B2Z3Z4_BCL2L1-01        -------------------------------------ca------ctgg-
A0A8C6W748_BCL2L1-      -------------------------------------ca------ctgg-
H0X6V2_BCL2L1-01        -------------------------------------ca------ctgg-
A0A286Y5D6_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D2AGI2_BCL2L1-      -------------------------------------ca------ctgg-
A0A287CZ07_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C9UNM3_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D2I760_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C2YUU6_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C2YUU6_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C2YUU6_BCL2L1-      -------------------------------------ca------ctgg-
G1P9D2_BCL2L1-01        -------------------------------------ca------ctgg-
A0A8C5NZI4_BCL2L1-      -------------------------------------ca------ctgg-
A0A3Q2H0F6_BCL2L1-      -------------------------------------ca------ctgg-
A0A8B9XQH5_BCL2L1-      -------------------------------------ca------ctgg-
Q05KJ0_BCL2L1-01        -------------------------------------ca------ctgg-
Q05KJ0_BCL2L1-02        -------------------------------------ca------ctgg-
A0A8C6DX24_BCL2L1-      -------------------------------------ca------ctgg-
A0A452FWV3_BCL2L1-      -------------------------------------ca------ccgg-
Q9MZS7_BCL2L1-01        -------------------------------------ca------ccgg-
A0A8C3WJH5_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D1ALD6_BCL2L1-      -------------------------------------ca------ctgg-
A0A4X1SQU7_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D0XF62_BCL2L1-      -------------------------------------ca------ctgg-
O77737_BCL2L1-01        -------------------------------------ca------ctgg-
A0A8D0J6V8_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D0J6V8_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D0J6V8_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D0J6V8_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D0J6V8_BCL2L1-      -------------------------------------ca------ctgg-
A0A4X1SQU7_BCL2L1-      -------------------------------------ca------ctgg-
A0A4X1SQU7_BCL2L1-      -------------------------------------ca------ctgg-
A0A4X1SQU7_BCL2L1-      -------------------------------------ca------ctgg-
A0A4X1SRM7_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D0XF62_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D1ALD6_BCL2L1-      -------------------------------------ca------ctgg-
A0A4X1SQU7_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C4L2X1_BCL2L1-      -------------------------------------ca------ctgg-
A0A3Q2H0F6_BCL2L1-      -------------------------------------ca------ctgg-
A0A250YD48_BCL2L1-      -------------------------------------ca------ctgg-
A0A1L5BWY3_BCL2L1-      -------------------------------------ca------ctgg-
A0A8B7FNN3_BCL2L1-      -------------------------------------ca------ctgg-
A0A8B7FNN3_BCL2L1-      -------------------------------------ca------ctgg-
A0A8B7FNN3_BCL2L1-      -------------------------------------ca------ctgg-
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        -------------------------------------ca------ctgg-
A0A8C8YN28_BCL2L1-      -------------------------------------ca------ctgg-
A0A8I3ZZI7_BCL2L1-      -------------------------------------ca------cggg-
A0A5F7ZJK5_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K6UWY8_BCL2L1-      -------------------------------------ca------cggg-
E2IV77_BCL2L1-01        -------------------------------------ca------cggg-
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      -------------------------------------ca------cggg-
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      -------------------------------------ca------cggg-
E2IV75_BCL2L1-01        -------------------------------------ca------cggg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A6D2VXZ3_BCL2L1-      -------------------------------------ca------ctgg-
G1RER8_BCL2L1-01        -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A7I2V597_BCL2L1-      -------------------------------------ca------ctgg-
A0A2R8Z9D7_BCL2L1-      -------------------------------------ca------ctgg-
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        -------------------------------------ca------ctgg-
A0A8C9GFE0_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K5VPG2_BCL2L1-      -------------------------------------ca------ctgg-
A0A8I5MVB8_BCL2L1-      -------------------------------------ca------ctgg-
A0A8D2ERY7_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K5VPG2_BCL2L1-      -------------------------------------ca------ctgg-
A0A5F7ZJK5_BCL2L1-      -------------------------------------ca------ctgg-
A0A5F7ZJK5_BCL2L1-      -------------------------------------ca------ctgg-
A0A5F7ZJK5_BCL2L1-      -------------------------------------ca------ctgg-
A0A5F7ZJK5_BCL2L1-      -------------------------------------ca------ctgg-
A0A0D9RJZ8_BCL2L1-      -------------------------------------ca------ctgg-
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K6QFA2_BCL2L1-      -------------------------------------ca------ctgg-
A0A2K5YR37_BCL2L1-      -------------------------------------ca------ctgg-
A0A5F5XYW0_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C7BPR9_BCL2L1-      -------------------------------------ca------ctgg-
A0A5F5XYW0_BCL2L1-      -------------------------------------ca------ctgg-
A0A8B8VBB9_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C6F2V6_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C9BM97_BCL2L1-      -------------------------------------ca------ctgg-
M3Z2H9_BCL2L1-01        -------------------------------------ca------ctgg-
A0A8C7BPR9_BCL2L1-      -------------------------------------ca------ctgg-
A0A5F5XYW0_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C0TGM4_BCL2L1-      -------------------------------------ca------ctgg-
Q76LT7_BCL2L1-01        -------------------------------------ca------ctgg-
Q8SQ42_BCL2L1-01        -------------------------------------ca------ctgg-
A0A673UUI0_BCL2L1-      -------------------------------------ca------ctgg-
A0A452SDS4_BCL2L1-      -------------------------------------ca------ctgg-
A0A384D3U1_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C9D5N1_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C9M2S8_BCL2L1-      -------------------------------------ca------ctgg-
A0A667HK09_BCL2L1-      -------------------------------------ca------ctgg-
A0A3Q1LRT3_BCL2L1-      -------------------------------------ca------ctgg-
A0A4W2D608_BCL2L1-      -------------------------------------ca------ctgg-
A0A4W2D608_BCL2L1-      -------------------------------------ca------ctgg-
A0A4W2F845_BCL2L1-      -------------------------------------ca------ctgg-
A0A4W2F845_BCL2L1-      -------------------------------------ca------ctgg-
A0A8B9WB42_BCL2L1-      -------------------------------------ca------ctgg-
A0A8C6FN58_BCL2L1-      -------------------------------------ca------ctgg-
A0A452E1B1_BCL2L1-      -------------------------------------ca------ctgg-
W5PSA5_BCL2L1-01        -------------------------------------ca------ctgg-
A0A8B9X9C2_BCL2L1-      -------------------------------------ca------ctgg-
A0A452FHY1_BCL2L1-      -------------------------------------ca------ctgg-
A0A452FHY1_BCL2L1-      -------------------------------------ca------ctgg-
H3ANS8_BCL2L1-01        -------------------------------------tg------ccggc
W5MG74_BCL2L1-01        -------------------------------------gggggggcccgtg
H9GHK7_BCL2L1-01        -------------------------------------ct------caga-
A0A6I8PIR3_BCL2L1-      -------------------------------------cg------gcgg-
A0A8D0HVA8_BCL2L1-      -------------------------------------tg------ctgg-
A0A8D0HVA8_BCL2L1-      -------------------------------------tg------ctgg-
A0A8D0HVA8_BCL2L1-      -------------------------------------tg------ctgg-
A0A7M4EJG9_BCL2L1-      -------------------------------------tg------ctgg-
A0A670IBZ4_BCL2L1-      -------------------------------------ta------ctgg-
A0A8D0E1K1_BCL2L1-      -------------------------------------ga------ccgg-
A0A8D2L5P2_BCL2L1-      -------------------------------------ga------cggg-
A0A8C6V6T2_BCL2L1-      -------------------------------------ag------ccggc
A0A8C5RX62_BCL2L1-      -------------------------------------ag------ccagc
A0A670Z9Y4_BCL2L1-      -------------------------------------gg------ccagc
A0A8C8S850_BCL2L1-      -------------------------------------tg------ccgg-
K7F655_BCL2L1-01        -------------------------------------tg------ccgg-
A0A8C0IVL6_BCL2L1-      -------------------------------------tg------ctgg-
A0A8C4W8N7_BCL2L1-      -------------------------------------tg------ctgg-
A0A8C3RIU8_BCL2L1-      -------------------------------------tg------ccgg-
A0A8C3IUT0_BCL2L1-      -------------------------------------tg------ccgg-
A0A8C3IUT0_BCL2L1-      -------------------------------------tg------ccgg-
A0A8C3IUT0_BCL2L1-      -------------------------------------tg------ccgg-
A0A8C3IUT0_BCL2L1-      -------------------------------------tg------ccgg-
A0A674J5J7_BCL2L1-      -------------------------------------tg------ccgg-
A0A8B9CUX0_BCL2L1-      -------------------------------------cg------ccgt-
A0A8B9DB39_BCL2L1-      -------------------------------------cg------ccgt-
A0A493TIA6_BCL2L1-      -------------------------------------cg------ccgt-
A0A8C3CGW6_BCL2L1-      -------------------------------------cg------ccgt-
A0A8B9SM69_BCL2L1-      -------------------------------------cg------ccgt-
A0A8B9V5I0_BCL2L1-      -------------------------------------cg------ccgt-
A0A8C7ECQ9_BCL2L1-      -------------------------------------cg------ctgt-
A0A669P0Q7_BCL2L1-      -------------------------------------ca------ccgt-
A0A8C2T2M7_BCL2L1-      -------------------------------------ca------ccgt-
A0A8C9EN38_BCL2L1-      -------------------------------------ca------ccgt-
A0A8C3LRK6_BCL2L1-      -------------------------------------ca------ccgt-
G1N5N5_BCL2L1-01        -------------------------------------cg------ccgt-
A0A8B9NWH6_BCL2L1-      -------------------------------------cg------ctgt-
A0A8B9NWH6_BCL2L1-      -------------------------------------cg------ctgt-
A0A8C4JDK2_BCL2L1-      -------------------------------------cg------ccgt-
A0A8C4JDK2_BCL2L1-      -------------------------------------cg------ccgt-
A0A8C5JFI3_BCL2L1-      -------------------------------------ca------ccgt-
A0A8D2M680_BCL2L1-      -------------------------------------ca------ccgt-
A0A803VLI1_BCL2L1-      -------------------------------------ct------ccgt-
A0A8C5U1E1_BCL2L1-      -------------------------------------ca------ccgt-
A0A8C3U3Q2_BCL2L1-      -------------------------------------ct------ccgt-
A0A8C0U194_BCL2L1-      -------------------------------------ca------ccgt-
H0Z8G3_BCL2L1-01        -------------------------------------ca------ccgt-
Q4U2V6_BCL2L1-01        -------------------------------------ca------ccgt-
A0A8C9NN65_BCL2L1-      -------------------------------------ca------ccgt-
A0A8C3XCF2_BCL2L1-      -------------------------------------ca------ccgt-
A0A8D2NN48_BCL2L1-      -------------------------------------ca------ccgt-
A0A8C0FL84_BCL2L1-      -------------------------------------cg------ccgt-
A0A8C0AYR5_BCL2L1-      -------------------------------------cg------ccat-
A0A8C4TWS5_BCL2L1-      -------------------------------------tg------ccgt-
A0A8C3KQJ2_BCL2L1-      -------------------------------------ca------ccgt-
A0A8C8A4L8_BCL2L1-      -------------------------------------cg------ccgt-
A0A8D0FHG7_BCL2L1-      -------------------------------------cg------ccgt-
A0A8B9N2I0_BCL2L1-      -------------------------------------cg------ccat-
A0A663ECL2_BCL2L1-      -------------------------------------cg------ccac-
A0A8C0AYR5_BCL2L1-      -------------------------------------cg------ccat-
A0A8B9FKI5_BCL2L1-      -------------------------------------tg------ccat-
A0A672UKR0_BCL2L1-      -------------------------------------cg------ccgt-
A0A3B5K6B9_BCL2L1-      --------------------------------------------------
H3CH49_BCL2L1-01        --------------------------------------------------
A0A059PJI5_BCL2L1-      -------------------------------------cg------actt-
A0A8C5B4N8_BCL2L1-      ------------------------------------cag------ttgg-
D2ITA2_BCL2L1-02        ------------------------------------cag------ttgg-
C1BLI0_BCL2L1-01        -------------------------------------ta------tctt-
A0A3B3ZMX9_BCL2L1-      -------------------------------------cc------acag-
A0A3B3ZMX9_BCL2L1-      --------------------------------------------------
A0A667Y1V0_BCL2L1-      --------------------------------------g------cctc-
A0A3P8XFS0_BCL2L1-      -------------------------------------ag------ccct-
A0A3P8XFS0_BCL2L1-      -------------------------------------ag------ccct-
A0A4W5LYF9_BCL2L1-      -------------------------------------ag------cctt-
A0A6F8ZUL6_BCL2L1-      -------------------------------------ag------cctt-
A0A674C4N2_BCL2L1-      -------------------------------------ag------cctt-
A0A8C7RD80_BCL2L1-      -------------------------------------tg------cctt-
A0A8C7CBC7_BCL2L1-      -------------------------------------tg------cctt-
A0A8C7CBC7_BCL2L1-      -------------------------------------tg------cctt-
A0A8C8GSY4_BCL2L1-      -------------------------------------tg------cctt-
A0A8C8GSY4_BCL2L1-      -------------------------------------tg------cctt-
A0A6F9CY91_BCL2L1-      -------------------------------------ag------ccct-
A0A060XE41_BCL2L1-      -------------------------------------ag------ccct-
A0A286MU87_BCL2L1-      -------------------------------------ag------ccct-
A0A8C8J941_BCL2L1-      -------------------------------------ag------ccct-
A0A8C7FX38_BCL2L1-      -------------------------------------ag------ccct-
A0A4W5JPK5_BCL2L1-      -------------------------------------ag------ccct-
C0HAD8_BCL2L1-01        -------------------------------------ag------ccct-
A0A673Z4J6_BCL2L1-      -------------------------------------ag------ccct-
A0A3B3QRZ2_BCL2L1-      -------------------------------------cc------ccat-
A0A3P8UWG7_BCL2L1-      -------------------------------------at------tcgg-
A0A345BSW9_BCL2L1-      ------------------------------------ccc------ccag-
B2GRK1_BCL2L1-01        ------------------------------------ccc------ccag-
B2GRK1_BCL2L1-02        ------------------------------------ccc------ccag-
Q90Z98_BCL2L1-01        ------------------------------------ccc------ccag-
A0A672K8R2_BCL2L1-      ------------------------------------ccc------ccag-
A0A8C1JXA4_BCL2L1-      ------------------------------------ccc------ccag-
A0A673M4N6_BCL2L1-      ------------------------------------ccc------ccag-
A0A673M4N6_BCL2L1-      ------------------------------------ccc------ccag-
A0A671QPE4_BCL2L1-      ------------------------------------ccc------ccag-
A0A672N8N5_BCL2L1-      ------------------------------------ccc------ccag-
A0A671K7W7_BCL2L1-      ------------------------------------ccc------ccag-
A0A671K7W7_BCL2L1-      ------------------------------------ccc------ccag-
A0A673IGS5_BCL2L1-      ------------------------------------ccc------ccag-
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A8C5D4L1_BCL2L1-      --------------------------------------------------
A0A4W4GHX3_BCL2L1-      --------------------------------------------------
A0A3B4DTL9_BCL2L1-      -------------------------------------gg------tcgc-
A0A3B1JJ42_BCL2L1-      -------------------------------------gg------tcgc-
A0A8B9LKW7_BCL2L1-      -------------------------------------gg------tcgc-
A0A8C9SVL8_BCL2L1-      cc-----------------------------------cg------ttgc-
A0A8C4CMF6_BCL2L1-      gg-----------------------------------tg------gcgc-
A0A3B3TFR4_BCL2L1-      -------------------------------------cg------ccac-
A0A3P8XYL5_BCL2L1-      -------------------------------------cc------cccc-
A0A6F9B188_BCL2L1-      -------------------------------------ct------cccc-
A0A4W5R2W6_BCL2L1-      -------------------------------------ct------cccc-
A0A4W5R2W6_BCL2L1-      -------------------------------------ct------cccc-
A0A674C578_BCL2L1-      -------------------------------------ct------cccc-
A0A674C578_BCL2L1-      -------------------------------------ct------cccc-
A0A8C7IJ10_BCL2L1-      -------------------------------------ct------cccc-
A0A8C8D057_BCL2L1-      -------------------------------------ct------cccc-
A0A8C7P574_BCL2L1-      -------------------------------------ct------cccc-
A0A8C7IJ10_BCL2L1-      -------------------------------------ct------cccc-
A0A8C8D057_BCL2L1-      -------------------------------------ct------cccc-
A0A6F9BJ02_BCL2L1-      -------------------------------------ca------cccc-
A0A4W5NQ40_BCL2L1-      -------------------------------------cg------cccc-
A0A8C7UB69_BCL2L1-      -------------------------------------cg------cccc-
A0A8C7J9N8_BCL2L1-      -------------------------------------cg------cccc-
A0A8C8FJG7_BCL2L1-      -------------------------------------cg------cccc-
B5XAY3_BCL2L1-01        -------------------------------------cg------cccc-
A0A674C337_BCL2L1-      -------------------------------------ca------cccc-
A0A8C9SET9_BCL2L1-      gc------------------------------------c------ccgc-
A0A8C5G971_BCL2L1-      ga-----------------------------------gg------ttgc-
A0A8C5FC81_BCL2L1-      cc----------------------gcgcctccgccccgg------cgcc-
A0A665VM40_BCL2L1-      ac-----------------------------------ac------ttgg-
A0A3Q3WIW8_BCL2L1-      ac------------------------------------------------
A0A3B5PQJ0_BCL2L1-      cc-----------------------------------ag------gcgg-
A0A3P9N9Y4_BCL2L1-      ac-----------------------------------ag------gcgg-
A0A3B3WI27_BCL2L1-      ac-----------------------------------ag------gcgg-
A0A087X9B7_BCL2L1-      ac-----------------------------------ag------gcgg-
A0A3B3TUS7_BCL2L1-      ac-----------------------------------ag------gcgg-
A0A3Q2FR43_BCL2L1-      -------------------------------------ag------cagg-
A0A3Q3B3X5_BCL2L1-      ac-----------------------------------cg------ctgc-
A0A667ZHE8_BCL2L1-      gc-----------------------------------gg------tcgg-
A0A3Q3G2E1_BCL2L1-      acaac--------------------------------gg------ttac-
A0A3Q3G2E1_BCL2L1-      acaac--------------------------------gg------ttac-
A0A3Q3G2E1_BCL2L1-      acaac--------------------------------gg------ttac-
A0A3Q3MX20_BCL2L1-      ac-----------------------------------at------ttgc-
A0A0D6DR75_BCL2L1-      ac-----------------------------------gg------ttgc-
A0A3Q1GZ93_BCL2L1-      ac-----------------------------------gg------ttgc-
A0A4W6BQD5_BCL2L1-      ac-----------------------------------gg------ttgc-
A0A3B4V3T1_BCL2L1-      ac-----------------------------------gg------ctgc-
A0A3B4XU17_BCL2L1-      ac-----------------------------------gg------ctgc-
A0A673BZP5_BCL2L1-      -------------------------------------gt------ttac-
A0A671WXV0_BCL2L1-      ac-----------------------------------gg------ttgc-
A0A219P0Y3_BCL2L1-      ac-----------------------------------ag------ttgc-
A0A8C9WU15_BCL2L1-      ac-----------------------------------ag------ttgg-
A0A1A7ZDF6_BCL2L1-      gc-----------------------------------cg------ccgg-
A0A8F0MQ26_BCL2L1-      ac-----------------------------------ag------ccgg-
A0A672IDC1_BCL2L1-      gcgctggcggcgggggcggggctggcggcgggggcgggg------ctgg-
A0A672IDC1_BCL2L1-      gc------------------------------------------------
A0A3Q0RTF8_BCL2L1-      ac-----------------------------------ag------ccgc-
A0A668RI12_BCL2L1-      gc-----------------------------------ag------ccgc-
I3IZK7_BCL2L1-01        gc-----------------------------------ag------ccgc-
A0A3Q4N4B5_BCL2L1-      gc-----------------------------------ag------ccgc-
A0A3Q2X557_BCL2L1-      gc-----------------------------------ag------ccgc-
A0A3P8P0F1_BCL2L1-      gc-----------------------------------ag------ccgc-
A0A3P9D632_BCL2L1-      gc-----------------------------------ag------ccgc-
A0A3P9D632_BCL2L1-      gc-----------------------------------ag------ccgc-
A0A3B4FNX1_BCL2L1-      gc-----------------------------------ag------ccgc-
A0A8C2ZZ68_BCL2L1-      ac-----------------------------------gg------ttgc-
G3NJY1_BCL2L1-01        ac-----------------------------------gg------tcgc-
A0A3B3DHA1_BCL2L1-      gc-----------------------------------ag------ttgc-
A0A3P9JYH1_BCL2L1-      ac-----------------------------------ag------ttgc-
A0A3B3IB64_BCL2L1-      ac-----------------------------------ag------ttgc-
A0A8C7YJI1_BCL2L1-      ac-----------------------------------ag------ttgc-
C3VIT1_BCL2L1-01        ac-----------------------------------cg------ttgc-
A0A3B4Z3X2_BCL2L1-      gc-----------------------------------gg------ttgg-
A0A3B4Z3X2_BCL2L1-      gc-----------------------------------gg------ttgg-
A0A3Q1FR00_BCL2L1-      gc-----------------------------------gg------ctgg-
A0A3Q1FR00_BCL2L1-      gc-----------------------------------gg------ctgg-
A0A3Q1DHJ3_BCL2L1-      gc-----------------------------------gg------ctgg-
A0A3Q1DHJ3_BCL2L1-      gc-----------------------------------gg------ctgg-
A0A3Q1DHJ3_BCL2L1-      gc-----------------------------------gg------ctgg-
A0A3P8TL99_BCL2L1-      gc-----------------------------------gg------ctgg-
A0A3P8TL99_BCL2L1-      gc-----------------------------------gg------ctgg-
A0A8C6UPI9_BCL2L1-      --------------------------------------------------
A0A3B4BFZ8_BCL2L1-      --------------------------------------------------
A0A3B3E2W4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3P9MKK4_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3B3I2Q5_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A3P9I2N4_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A8C7XSQ2_BCL2L1-      --------------------------------------------------
A0A3P8VMA1_BCL2L1-      --------------------------------------------------
A0A3Q2C6K4_BCL2L1-      --------------------------------------------------
A0A3B5MGS2_BCL2L1-      --------------------------------------------------
M4A558_BCL2L1-01        --------------------------------------------------
A0A3P9QFB3_BCL2L1-      --------------------------------------------------
A0A3B3XN57_BCL2L1-      --------------------------------------------------
A0A087YBW4_BCL2L1-      --------------------------------------------------
A0A3B3VWI7_BCL2L1-      --------------------------------------------------
A0A1A8A2S0_BCL2L1-      --------------------------------------------------
A0A672JL90_BCL2L1-      --------------------------------------------------
A0A672Z262_BCL2L1-      --------------------------------------------------
A0A3Q3BEB7_BCL2L1-      --------------------------------------------------
A0A0F7L1T6_BCL2L1-      --------------------------------------------------
H2U5I3_BCL2L1-01        --------------------------------------------------
A0A8C2ZH46_BCL2L1-      --------------------------------------------------
G3P7B4_BCL2L1-01        --------------------------------------------------
A0A3Q3FUB6_BCL2L1-      --------------------------------------------------
A0A3Q3X5M5_BCL2L1-      --------------------------------------------------
A0A665VSD7_BCL2L1-      --------------------------------------------------
A0A8D3CTR5_BCL2L1-      --------------------------------------------------
A0A3Q1JZ46_BCL2L1-      --------------------------------------------------
A0A3B5B4X7_BCL2L1-      --------------------------------------------------
A0A3Q1EVP6_BCL2L1-      --------------------------------------------------
A0A6G7K5D7_BCL2L1-      --------------------------------------------------
A0A3Q1BQA0_BCL2L1-      --------------------------------------------------
A0A3P8U812_BCL2L1-      --------------------------------------------------
A0A3Q3NFM4_BCL2L1-      --------------------------------------------------
A0A4W6EST2_BCL2L1-      --------------------------------------------------
A0A3B4V9K8_BCL2L1-      --------------------------------------------------
A0A3B4XS24_BCL2L1-      --------------------------------------------------
A0A510BW31_BCL2L1-      --------------------------------------------------
A0A8D0AAQ8_BCL2L1-      --------------------------------------------------
A0A8C4IRU9_BCL2L1-      --------------------------------------------------
E6ZFR0_BCL2L1-01        --------------------------------------------------
                                                                          

R4JQR8_BCL2L1-01        -----------------------------------------------cac
A0A346RRN1_BCL2L1-      -----------------------------------------------cac
A0A8C4STP1_BCL2L1-      -----------------------------------------------tat
A0A8C4XBF6_BCL2L1-      -----------------------------------------------agt
Q90ZH2_BCL2L1-01        -------------------------------cacgcagggcat----tgt
Q2TAP5_BCL2L1-01        -------------------------------cacgcagggcat----tgt
Q91828_BCL2L1-01        -------------------------------cacgcagggcat----tgt
A0A8C5WFB8_BCL2L1-      --------------------------------------------------
A0A4X2KZ04_BCL2L1-      --aca-cagcagcagcctggatgc-------ccatgagacaatacc-agt
F6WA14_BCL2L1-01        --gca-cagcagcagcctggatgc-------ccatgagacaatacc-agt
A0A7N4P3X2_BCL2L1-      --aca-cagcagcagcctggatgc-------ccatgagacaattcc-tgt
A0A7N4P3X2_BCL2L1-      --aca-cagcagcagcctggatgc-------ccatgagacaattcc-tgt
A0A8C5YLY6_BCL2L1-      --cca-taacaggagtttggatgc-------ccccgacgtggtccc-cat
A0A8D2IA38_BCL2L1-      --cca-taacaggagtttggatgc-------cccagacgtgatccc-cat
A0A8D2IA38_BCL2L1-      --cca-taacaggagtttggatgc-------cccagacgtgatccc-cat
G3SPN0_BCL2L1-01        --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
O35843_BCL2L1-01        --cca-cagcagcagtttggatgc-------gcgggaggtgattcc-cat
Q7TS62_BCL2L1-02        --cca-cagcagcagtttggatgc-------gcgggaggtaatccc-cat
Q7TS62_BCL2L1-03        --cca-cagcagcagtttggatgc-------gcgggaggtaatccc-cat
Q5HZH3_BCL2L1-02        --cca-cagcagcagtttggatgc-------gcgggaggtgattcc-cat
A0A8C6G6C7_BCL2L1-      --cca-cagcagcagtttggatgc-------acgggaggtgatccc-cat
Q7TS62_BCL2L1-01        --cca-cagcagcagtttggatgc-------gcgggaggtaatccc-cat
A0A6I9LMY5_BCL2L1-      --cca-cagcagcagtttggatgc-------gcgggaggtgatccc-cat
B2Z3Z4_BCL2L1-01        --cca-cagcagcagtttggatgc-------acgggaggtgatccc-cat
A0A8C6W748_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggagctgatccc-cat
H0X6V2_BCL2L1-01        --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A286Y5D6_BCL2L1-      --cca-cagcagtagtttggatgc-------ccgggaggtgatccc-cat
A0A8D2AGI2_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A287CZ07_BCL2L1-      --tca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8C9UNM3_BCL2L1-      --tca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8D2I760_BCL2L1-      --tca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8C2YUU6_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgcgaggtgatccc-cat
A0A8C2YUU6_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgcgaggtgatccc-cat
A0A8C2YUU6_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgcgaggtgatccc-cat
G1P9D2_BCL2L1-01        --cca-cagcagtagcttggatgc-------ccgggaggtgattcc-cat
A0A8C5NZI4_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A3Q2H0F6_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaagtgatccc-cat
A0A8B9XQH5_BCL2L1-      --cca-cagcagaagctcggatgc-------ccgggaagtgatccc-cat
Q05KJ0_BCL2L1-01        --cca-cagcagaagctcggatgc-------ccgggaagtgatccc-cat
Q05KJ0_BCL2L1-02        --cca-cagcagaagctcggatgc-------ccgggaagtgatccc-cat
A0A8C6DX24_BCL2L1-      --cca-cagcagaagcttggatgc-------ccgggaagtgatccc-cat
A0A452FWV3_BCL2L1-      --cca-cagcagaagcttggatgc-------ccgggaagtgatccc-cat
Q9MZS7_BCL2L1-01        --cca-cagcagaagcttggatgc-------ccgggaagtgatccc-cat
A0A8C3WJH5_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8D1ALD6_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A4X1SQU7_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8D0XF62_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
O77737_BCL2L1-01        --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8D0J6V8_BCL2L1-      --cca-cagcagcagcttggatgc-------ccggggggtgatccc-cat
A0A8D0J6V8_BCL2L1-      --cca-cagcagcagcttggatgc-------ccggggggtgatccc-cat
A0A8D0J6V8_BCL2L1-      --cca-cagcagcagcttggatgc-------ccggggggtgatccc-cat
A0A8D0J6V8_BCL2L1-      --cca-cagcagcagcttggatgc-------ccggggggtgatccc-cat
A0A8D0J6V8_BCL2L1-      --cca-cagcagcagcttggatgc-------ccggggggtgatccc-cat
A0A4X1SQU7_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A4X1SQU7_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A4X1SQU7_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A4X1SRM7_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8D0XF62_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8D1ALD6_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A4X1SQU7_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8C4L2X1_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaagtgatccc-cat
A0A3Q2H0F6_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaagtgatccc-cat
A0A250YD48_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A1L5BWY3_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8B7FNN3_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8B7FNN3_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8B7FNN3_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8B7FNN3_BCL2L1-      --------------------------------------------------
A0A2K6G3C5_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K6G3C5_BCL2L1-      --------------------------------------------------
E2IV76_BCL2L1-01        --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-tat
A0A8C8YN28_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-tat
A0A8I3ZZI7_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A5F7ZJK5_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K6UWY8_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
E2IV77_BCL2L1-01        --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K6UWY8_BCL2L1-      --------------------------------------------------
A0A8I3ZZI7_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K5EBP4_BCL2L1-      --------------------------------------------------
A0A2K5EBP4_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
E2IV75_BCL2L1-01        --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A6D2VXZ3_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
G1RER8_BCL2L1-01        --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A7I2V597_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2R8Z9D7_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2R8Z9D7_BCL2L1-      --------------------------------------------------
A0A2K5H963_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K5H963_BCL2L1-      --------------------------------------------------
Q2PFS6_BCL2L1-01        --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8C9GFE0_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K6QFA2_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --------------------------------------------------
A0A2K5M8B1_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K5VPG2_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8I5MVB8_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A8D2ERY7_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K5YR37_BCL2L1-      --------------------------------------------------
A0A2K5YR37_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K5VPG2_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A5F7ZJK5_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A5F7ZJK5_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A5F7ZJK5_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A5F7ZJK5_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A0D9RJZ8_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
I7GKS6_BCL2L1-01        --------------------------------------------------
A0A2K6QFA2_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K6QFA2_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A2K5YR37_BCL2L1-      --cca-cagcagcagtttggatgc-------ccgggaggtgatccc-cat
A0A5F5XYW0_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8C7BPR9_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A5F5XYW0_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8B8VBB9_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8C6F2V6_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8C9BM97_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
M3Z2H9_BCL2L1-01        --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8C7BPR9_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A5F5XYW0_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8C0TGM4_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
Q76LT7_BCL2L1-01        --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
Q8SQ42_BCL2L1-01        --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A673UUI0_BCL2L1-      --cca-cagcagcagcttggacgc-------ccgggaggtgatccc-cat
A0A452SDS4_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A384D3U1_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8C9D5N1_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A8C9M2S8_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A667HK09_BCL2L1-      --cca-cagcagcagcttggatgc-------ccgggaggtgatccc-cat
A0A3Q1LRT3_BCL2L1-      --cca-cagcagaagcttggatgc-------ccggaaaatgatccc-cat
A0A4W2D608_BCL2L1-      --cca-cagcagaagcttggatgc-------ccggaaaatgatccc-cat
A0A4W2D608_BCL2L1-      --cca-cagcagaagcttggatgc-------ccggaaaatgatccc-cat
A0A4W2F845_BCL2L1-      --cca-cagcagaagcttggatgc-------ccggaaaatgatccc-cat
A0A4W2F845_BCL2L1-      --cca-cagcagaagcttggatgc-------ccggaaaatgatccc-cat
A0A8B9WB42_BCL2L1-      --cca-cagcagaagcttggatgc-------ccagaaaacgatccc-cat
A0A8C6FN58_BCL2L1-      --cca-cagcagaagcttggacgc-------ccggaaaatgatccc-tgt
A0A452E1B1_BCL2L1-      --tca-cagcagaagcttggacgc-------tgggaaaatgatccc-cac
W5PSA5_BCL2L1-01        --tca-cagcagaagcttggacac-------cgggaaaatgatccc-cat
A0A8B9X9C2_BCL2L1-      --cca-cagcagaagcttggacgc-------ctggaaagtgatccc-cgt
A0A452FHY1_BCL2L1-      --cca-ca-cagaa--------------------gaaagtggt-cc-tgt
A0A452FHY1_BCL2L1-      --cca-ca-cagaa--------------------gaaagtggt-cc-tgt
H3ANS8_BCL2L1-01        tggcagcagcagccgcctggaagc-------ccaggcggtgtcggg-gcc
W5MG74_BCL2L1-01        tcgcg-ccagcccccccaggggat-------c------------------
H9GHK7_BCL2L1-01        --aca-ccccgaactccttgaaga-------ggaggaggaagaaaa-ccc
A0A6I8PIR3_BCL2L1-      --------------------agga-------cgacgac------------
A0A8D0HVA8_BCL2L1-      --gca-caccaacggcgtggaagc-------ccacgaagggctcac-agt
A0A8D0HVA8_BCL2L1-      --gca-caccaacggcgtggaagc-------ccacgaagggctcac-agt
A0A8D0HVA8_BCL2L1-      --gca-caccaacggcgtggaagc-------ccacgaagggctcac-agt
A0A7M4EJG9_BCL2L1-      --aca-caggaacaacctggaagc-------ccaggagagtgttcc-agc
A0A670IBZ4_BCL2L1-      --aca-cccgagcatcctcagtga-------tcttgaagacagccc-aag
A0A8D0E1K1_BCL2L1-      --gca-cccgagcatccttgaa----------------gacaacgc-cag
A0A8D2L5P2_BCL2L1-      --gca-cctgaccatcctcgaaga-------cctggaagacggtcc-ccg
A0A8C6V6T2_BCL2L1-      attca-cccggctctcctggaaga-------gctgggcgacggccc-cca
A0A8C5RX62_BCL2L1-      attca-cccggctctgctggaaga-------gctgagcgacggccc-cca
A0A670Z9Y4_BCL2L1-      attca-cccggccctgctggaaga-------gctgagcgacggccc-cca
A0A8C8S850_BCL2L1-      --gca-cagtcccagccttgaagc-------tcatgaaaggtttcc-agc
K7F655_BCL2L1-01        --gca-cagtaacagccttgaagc-------ccatgaaagggttcc-ggc
A0A8C0IVL6_BCL2L1-      --gca-cagtaacagccttgaagc-------ccatgaaagggttcc-agc
A0A8C4W8N7_BCL2L1-      --gca-cagtaacagccttgaagc-------ccatgaaagggttcc-agc
A0A8C3RIU8_BCL2L1-      --gca-cagtaacagccttgaagc-------ccatgaaagggttcc-ggc
A0A8C3IUT0_BCL2