Dataset for CDS BCL2L1 of organism Moschus moschiferus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C6DX24_BCL2L1-      atgtctcagagcaaccgggagctggtggttgactttctctcttacaagct
A0A8C6FN58_BCL2L1-      atgtctcagagcaactgggaactagtggttgactttctctcttacaagct
                        *************** **** ** **************************

A0A8C6DX24_BCL2L1-      ttcccagaaaggatacagctggagtcagtttagtgatgtggaagaaaaca
A0A8C6FN58_BCL2L1-      ttcccagaaaggatacatctggagtcagtttagtgatatggaagagaaca
                        ***************** ******************* ******* ****

A0A8C6DX24_BCL2L1-      gaactgaggccccagaagggacagaatcagatatggaaacccccagtgcc
A0A8C6FN58_BCL2L1-      gaactgagaccacagaagggacagaatcagatatggaaaccctaaaagcc
                        ******** ** ******************************  *  ***

A0A8C6DX24_BCL2L1-      atcaatggcaacccatcctggcacctggcggatagccctgcggtgaatgg
A0A8C6FN58_BCL2L1-      atcaatggcaacccatcctggcacctagcagatagccctgcagtgaaggg
                        ************************** ** *********** ***** **

A0A8C6DX24_BCL2L1-      agccactggccacagcagaagcttggatgcccgggaagtgatccccatgg
A0A8C6FN58_BCL2L1-      agccactggccacagcagaagcttggacgcccggaaaatgatccctgtga
                        *************************** ****** ** *******  ** 

A0A8C6DX24_BCL2L1-      cagcggtgaagcaagccctgagggaggcaggtgatgagtttgaactgagg
A0A8C6FN58_BCL2L1-      caacagtaaagcaagccctggggcaggcaagcaatgagtttgaactgagg
                        ** * ** ************ ** ***** *  *****************

A0A8C6DX24_BCL2L1-      taccgacgggcattcagcgacctgacgtcccagctccacatcaccccagg
A0A8C6FN58_BCL2L1-      taccaacagacattcagcgacctgacatcccagctccacatcaccccagg
                        **** ** * **************** ***********************

A0A8C6DX24_BCL2L1-      gacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
A0A8C6FN58_BCL2L1-      gacagcatatcagagctttgaacaggtaataaatgaactcctccgggacg
                        **************************** * ********* *********

A0A8C6DX24_BCL2L1-      gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactg
A0A8C6FN58_BCL2L1-      gggtgagctggagtcgcattgtggcctttttctccttcggtggggcatta
                        ****** **** *********************************** * 

A0A8C6DX24_BCL2L1-      tgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgc
A0A8C6FN58_BCL2L1-      tgcatgaaaagcatagacaaggagatgcaggtattggtgagtcaggtcac
                        *** ** ***** ****************************** * ** *

A0A8C6DX24_BCL2L1-      aacttggatggccacttacctgaatgaccacctagagccttggatccagg
A0A8C6FN58_BCL2L1-      aacttggatggccacttacctaaatgaccacctagagccttggatccagg
                        ********************* ****************************

A0A8C6DX24_BCL2L1-      agaacggcggctgggacacttttgtggaactctacgggaacaacgcagca
A0A8C6FN58_BCL2L1-      agaatggcgactgggacacttttgtggaactctacgaaaacaatacagca
                        **** **** **************************  *****  *****

A0A8C6DX24_BCL2L1-      gctgagagccggaagggccaggagcgcttcaaccgctggttcctgacggg
A0A8C6FN58_BCL2L1-      accgagagccagaagggccaagagcgcttcagctgctggtccctgatgga
                         * ******* ********* ********** * ****** ***** ** 

A0A8C6DX24_BCL2L1-      catgactgtggctggtgtggttctgcttggctcgctcttcagtcggaaat
A0A8C6FN58_BCL2L1-      catgactgtg--tggtatggttctgctgggcttgcttttcaactcataat
                        **********  **** ********** **** *** ****      ***

A0A8C6DX24_BCL2L1-      ga--------------------------------------
A0A8C6FN58_BCL2L1-      aactattccttttgttatagtcattcaaattttatactag

© 1998-2023Legal notice