Dataset for CDS BCL2L1 of organism Moschus moschiferus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A8C6DX24_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagaaaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcctggcacctggcggatagccctgcggtgaatggagccactggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggtgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaacgcagcagctgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgcttggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A8C6FN58_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Moschus moschiferus GN=BCL2L1 (length=738 residues).
atgtctcagagcaactgggaactagtggttgactttctctcttacaagctttcccagaaaggatacatctggagtcagtt
tagtgatatggaagagaacagaactgagaccacagaagggacagaatcagatatggaaaccctaaaagccatcaatggca
acccatcctggcacctagcagatagccctgcagtgaagggagccactggccacagcagaagcttggacgcccggaaaatg
atccctgtgacaacagtaaagcaagccctggggcaggcaagcaatgagtttgaactgaggtaccaacagacattcagcga
cctgacatcccagctccacatcaccccagggacagcatatcagagctttgaacaggtaataaatgaactcctccgggacg
gggtgagctggagtcgcattgtggcctttttctccttcggtggggcattatgcatgaaaagcatagacaaggagatgcag
gtattggtgagtcaggtcacaacttggatggccacttacctaaatgaccacctagagccttggatccaggagaatggcga
ctgggacacttttgtggaactctacgaaaacaatacagcaaccgagagccagaagggccaagagcgcttcagctgctggt
ccctgatggacatgactgtgtggtatggttctgctgggcttgcttttcaactcataataactattccttttgttatagtc
attcaaattttatactag
© 1998-2022Legal notice