Dataset for CDS BCL-2 of organism Taeniopygia guttata

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A674GNG3_BCL2-02      atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctcta
A0A674GNG3_BCL2-04      atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctcta
A0A674GNG3_BCL2-01      atg-----------------------------------------------
A0A674GNG3_BCL2-03      atg-----------------------------------------------
                        ***                                               

A0A674GNG3_BCL2-02      catggtgtcgccgcttatcagccccaagtccctgaagctgcccggcgcgc
A0A674GNG3_BCL2-04      catggtgtcgccgcttatcagccccaagtccctgaagctgcccggcgcgc
A0A674GNG3_BCL2-01      ------------gctcat-----------------------ccggggaga
A0A674GNG3_BCL2-03      ------------gctcat-----------------------ccggggaga
                                    *** **                       **** * * 

A0A674GNG3_BCL2-02      acgtcgtggtaactggaggctccagtggaattggaaaatgtattgctatt
A0A674GNG3_BCL2-04      acgtcgtggtaactggaggctccagtggaattggaaaatgtattgctatt
A0A674GNG3_BCL2-01      a--------------gaggctacgat--aaccgggagat-----------
A0A674GNG3_BCL2-03      a--------------gaggctacgat--aaccgggagat-----------
                        *              ****** *  *  **  ** * **           

A0A674GNG3_BCL2-02      gaatgctataagcaaggtgctttc---ataacactgattgcaagggatga
A0A674GNG3_BCL2-04      gaatgctataagcaaggtgctttc---ataacactgattgcaagggatga
A0A674GNG3_BCL2-01      -agtgct------gaagtacatccactataaactctctcagaggggatac
A0A674GNG3_BCL2-03      -agtgct------gaagtacatccactataaactctctcagaggggatac
                         * ****       * ** * * *   ****      *   * *****  

A0A674GNG3_BCL2-02      gaataagctgttgcagacgaaga-aggaaatagaaaagtactctgttaat
A0A674GNG3_BCL2-04      gaataagctgttgcagacgaaga-aggaaatagaaaagtactctgttaat
A0A674GNG3_BCL2-01      gactgggc---tgccggcgaggacagggcat---------ccctg-----
A0A674GNG3_BCL2-03      gactgggc---tgccggcgaggacagggcat---------ccctg-----
                        ** *  **   *** * *** ** ***  **         * ***     

A0A674GNG3_BCL2-02      gacaagcaggttgtactctgtatttctgttgatgtctcgaaagactacga
A0A674GNG3_BCL2-04      gacaagcaggttgtactctgtatttctgttgatgtctcgaaagactacga
A0A674GNG3_BCL2-01      --cctccagat--cactccg--cttctgctgctgctgcga----------
A0A674GNG3_BCL2-03      --cctccagat--cactccg--cttctgctgctgctgcga----------
                          *   *** *   **** *   ***** ** **   ***          

A0A674GNG3_BCL2-02      acaggtggagaatgttctcaaacaggctcaggagaagttggggccagttg
A0A674GNG3_BCL2-04      acaggtggagaatgttctcaaacaggctcaggagaagttggggccagttg
A0A674GNG3_BCL2-01      -------------------------------------ttg----ctgctg
A0A674GNG3_BCL2-03      -------------------------------------ttg----ctgctg
                                                             ***    * * **

A0A674GNG3_BCL2-02      acatgcttgtaaactgtgcaggaacatcagttacaggaaaatttgaggat
A0A674GNG3_BCL2-04      acatgcttgtaaactgtgcaggaacatcagttacaggaaaatttgaggat
A0A674GNG3_BCL2-01      ctgcgattg------------------ctgctgctgggacttctgatcac
A0A674GNG3_BCL2-03      ctgcgattg------------------ctgctgctgggacttctgatcac
                            * ***                  * * * * ** *  * ***  * 

A0A674GNG3_BCL2-02      attgaagtgaattcttttgaaagattaatggcagtcaattacctggggag
A0A674GNG3_BCL2-04      attgaagtgaattcttttgaaagattaatggcagtcaattacctggggag
A0A674GNG3_BCL2-01      actgggctg----------------------------------------g
A0A674GNG3_BCL2-03      actgggctg----------------------------------------g
                        * **   **                                        *

A0A674GNG3_BCL2-02      tgtttacccaagccgag----------cagtaatcgcta-ccatgaagga
A0A674GNG3_BCL2-04      tgtttacccaagccgag----------cagtaatcgcta-ccatgaagga
A0A674GNG3_BCL2-01      tgtctccgcaccccgagccccccggctcggctactgctagccac--acgc
A0A674GNG3_BCL2-03      tgtctccgcaccccgagccccccggctcggctactgctagccac--acgc
                        *** * * **  *****          * *  *  **** ***   * * 

A0A674GNG3_BCL2-02      acgcagaatgggaaggattgt-ctttgtatcatcccaggctgggcagtta
A0A674GNG3_BCL2-04      acgcagaatgggaaggattgt-ctttgtatcatcccaggctgggcagtta
A0A674GNG3_BCL2-01      ccccagcc---gaggggctgcgccctg---caccccaggccgtccacctc
A0A674GNG3_BCL2-03      ccccagcc---gaggggctgcgccctg---caccccaggccgtccacctc
                         * ***     ** **  **  *  **   ** ******* *  **  * 

A0A674GNG3_BCL2-02      ggcctgttt--------ggat--atacagcttattctcccacgaaatttg
A0A674GNG3_BCL2-04      ggcctgttt--------ggat--atacagcttattctcccacgaaatttg
A0A674GNG3_BCL2-01      gtcctacgccaggcgggggatgagttctcccgacgctaccagagagactt
A0A674GNG3_BCL2-03      gtcctacgccaggcgggggatgagttctcccgacgctaccagagagactt
                        * ***            ****   * *  *  *  ** ***   *   * 

A0A674GNG3_BCL2-02      ctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaat
A0A674GNG3_BCL2-04      ctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaat
A0A674GNG3_BCL2-01      ttcccaaatgtctggccag----ctgc-------------acctgacgcc
A0A674GNG3_BCL2-03      ttcccaaatgtctggccag----ctgc-------------acctgacgcc
                         **    * *  ****       ****             **** **   

A0A674GNG3_BCL2-02      gtctacgtaacagtggcctatcctccagatactgatactcctggctttgc
A0A674GNG3_BCL2-04      gtctacgtaacagtggcctatcctccagatactgatactcctggctttgc
A0A674GNG3_BCL2-01      ctttaca----------------gccaggagccgct--tcgtggcggtgg
A0A674GNG3_BCL2-03      ctttaca----------------gccaggagccgct--tcgtggcggtgg
                         * ***                  ****   * * *  ** ****  ** 

A0A674GNG3_BCL2-02      agaagaaagtaaaacaaagcccttagagacgaagctaattt--------c
A0A674GNG3_BCL2-04      agaagaaagtaaaacaaagcccttagagacgaagctaattt--------c
A0A674GNG3_BCL2-01      tggaggagct----------cttccgagatggggttaactggggcagaat
A0A674GNG3_BCL2-03      tggaggagct----------cttccgagatggggttaactggggcagaat
                         * ** *  *          * *  **** *  * *** *          

A0A674GNG3_BCL2-02      tgagacctcatctgtttgccaagcagaacaagttgccagagttata---g
A0A674GNG3_BCL2-04      tgagacctcatctgtttgccaagcagaacaagttgccagagttata---g
A0A674GNG3_BCL2-01      tgtggccttcttcg---------------agtttggcggtgtgatgtgtg
A0A674GNG3_BCL2-03      tgtggccttcttcg---------------agtttggcggtgtgatgtgtg
                        ** * ***  *  *               *  *** * * ** **    *

A0A674GNG3_BCL2-02      tgaaagatgccatacaagggaa--tttcaacagctctgttggatcagatg
A0A674GNG3_BCL2-04      tgaaagatgccatacaagggaa--tttcaacagctctgttggatcagatg
A0A674GNG3_BCL2-01      tggagagcgtca-acagggagatgtttc-----ccctcgtggacaacatt
A0A674GNG3_BCL2-03      tggagagcgtca-acagggagatgtttc-----ccctcgtggacaacatt
                        ** *    * ** *** **  *  ****     * **  ****  * ** 

A0A674GNG3_BCL2-02      gttacatgctgtcaatattgacaagtg-gaatgtcaccagtcacttctat
A0A674GNG3_BCL2-04      gttacatgctgtcaatattgacaagtg-gaatgtcaccagtcacttctat
A0A674GNG3_BCL2-01      gccacctg-----------gatgactgagtacctgaaccggcacctgcac
A0A674GNG3_BCL2-03      gccacctg-----------gatgactgagtacctgaaccggcacctgcac
                        *  ** **           **  * ** * *  * * * * *** *  * 

A0A674GNG3_BCL2-02      tactga----aggtcttcagcag-----------gatgcctttgtgg---
A0A674GNG3_BCL2-04      tactga----aggtcttcagcag-----------gttgtttgcatgg---
A0A674GNG3_BCL2-01      aactggatccaggacaacggaggctgg-------gatgcctttgtgg---
A0A674GNG3_BCL2-03      aactggatccaggacaacggaggctggtcacagagagggcagcgtaaaat
                         ****     *** *  * *  *           *  *      *     

A0A674GNG3_BCL2-02      agttgtatggca--------acaatatga--ggcctttgtttgatttctc
A0A674GNG3_BCL2-04      gcatttttcgca--------tcatt------ggcct-------attttac
A0A674GNG3_BCL2-01      agttgtatggca--------acaatatga--ggcctttgtttgatttctc
A0A674GNG3_BCL2-03      agctgcgaggcaattcccgtacagtaaaatggaagtctctttggctcttc
                           *     ***         ** *      *   *         *   *

A0A674GNG3_BCL2-02      ctgga--------tctctctgaagactatcctga----------------
A0A674GNG3_BCL2-04      ctagg--------aagttttgacagc-atagttc----------------
A0A674GNG3_BCL2-01      ctgga--------tctctctgaagactatcctga----------------
A0A674GNG3_BCL2-03      attcaatacaatgtggctcaagaggatatcctgccaaaccaatgataacg
                         *               *         **  *                  

A0A674GNG3_BCL2-02      -----------------------------gtc------tggttctgg---
A0A674GNG3_BCL2-04      -----------------------------gtcgctgcatgatgcaaa---
A0A674GNG3_BCL2-01      -----------------------------gtc------tggttctgg---
A0A674GNG3_BCL2-03      agggaaataaagtcacttcctcaccagctgtt------tgattcaggatg
                                                     **       ** * *      

A0A674GNG3_BCL2-02      ----tgggagcttgcatcactct----tggcgcttatcttggacataagt
A0A674GNG3_BCL2-04      ----gggaaa--------aatct----gaaagtgcagataagac-cgagt
A0A674GNG3_BCL2-01      ----tgggagcttgcatcactct----tggcgcttatcttggacataagt
A0A674GNG3_BCL2-03      cctttgtggagttgtatggcaacaatatgaggcctttgtttga-------
                             *                         *      *  **       

A0A674GNG3_BCL2-02      ag
A0A674GNG3_BCL2-04      aa
A0A674GNG3_BCL2-01      ag
A0A674GNG3_BCL2-03      --
                          

© 1998-2023Legal notice