Dataset for CDS BCL-2 of organism Taeniopygia guttata

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A674GNG3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=729 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactgggctgccggcgaggacagggcatccctgcctccagatcactccgcttctgctgctgctgcgattgctgctg
ctgcgattgctgctgctgggacttctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctactgct
agccacacgcccccagccgaggggctgcgccctgcaccccaggccgtccacctcgtcctacgccaggcgggggatgagtt
ctcccgacgctaccagagagacttttcccaaatgtctggccagctgcacctgacgccctttacagccaggagccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatg
tgtgtggagagcgtcaacagggagatgtttcccctcgtggacaacattgccacctggatgactgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctgggatgcctttgtggagttgtatggcaacaatatgaggcctttgtttg
atttctcctggatctctctgaagactatcctgagtctggttctggtgggagcttgcatcactcttggcgcttatcttgga
cataagtag
>gnl|bcl2dbcds|A0A674GNG3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=1014 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
cctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgtattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaataagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtctcgaaagactacgaacaggtggagaatgttctcaaaca
ggctcaggagaagttggggccagttgacatgcttgtaaactgtgcaggaacatcagttacaggaaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtcaattacctggggagtgtttacccaagccgagcagtaatcgctaccatg
aaggaacgcagaatgggaaggattgtctttgtatcatcccaggctgggcagttaggcctgtttggatatacagcttattc
tcccacgaaatttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacagtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctaatttctgag
acctcatctgtttgccaagcagaacaagttgccagagttatagtgaaagatgccatacaagggaatttcaacagctctgt
tggatcagatggttacatgctgtcaatattgacaagtggaatgtcaccagtcacttctattactgaaggtcttcagcagg
atgcctttgtggagttgtatggcaacaatatgaggcctttgtttgatttctcctggatctctctgaagactatcctgagt
ctggttctggtgggagcttgcatcactcttggcgcttatcttggacataagtag
>gnl|bcl2dbcds|A0A674GNG3_BCL2-03 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=804 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactgggctgccggcgaggacagggcatccctgcctccagatcactccgcttctgctgctgctgcgattgctgctg
ctgcgattgctgctgctgggacttctgatcacactgggctggtgtctccgcaccccgagccccccggctcggctactgct
agccacacgcccccagccgaggggctgcgccctgcaccccaggccgtccacctcgtcctacgccaggcgggggatgagtt
ctcccgacgctaccagagagacttttcccaaatgtctggccagctgcacctgacgccctttacagccaggagccgcttcg
tggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtgatg
tgtgtggagagcgtcaacagggagatgtttcccctcgtggacaacattgccacctggatgactgagtacctgaaccggca
cctgcacaactggatccaggacaacggaggctggtcacagagagggcagcgtaaaatagctgcgaggcaattcccgtaca
gtaaaatggaagtctctttggctcttcattcaatacaatgtggctcaagaggatatcctgccaaaccaatgataacgagg
gaaataaagtcacttcctcaccagctgtttgattcaggatgcctttgtggagttgtatggcaacaatatgaggcctttgt
ttga
>gnl|bcl2dbcds|A0A674GNG3_BCL2-04 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Taeniopygia guttata GN=BCL-2 (length=999 residues).
atgctgctcctggccgccgccttcatcgtggccttcgtcctcctcctctacatggtgtcgccgcttatcagccccaagtc
cctgaagctgcccggcgcgcacgtcgtggtaactggaggctccagtggaattggaaaatgtattgctattgaatgctata
agcaaggtgctttcataacactgattgcaagggatgagaataagctgttgcagacgaagaaggaaatagaaaagtactct
gttaatgacaagcaggttgtactctgtatttctgttgatgtctcgaaagactacgaacaggtggagaatgttctcaaaca
ggctcaggagaagttggggccagttgacatgcttgtaaactgtgcaggaacatcagttacaggaaaatttgaggatattg
aagtgaattcttttgaaagattaatggcagtcaattacctggggagtgtttacccaagccgagcagtaatcgctaccatg
aaggaacgcagaatgggaaggattgtctttgtatcatcccaggctgggcagttaggcctgtttggatatacagcttattc
tcccacgaaatttgctcttcgagggttggctgaagccctgcaaatggaggtaaaaccttacaatgtctacgtaacagtgg
cctatcctccagatactgatactcctggctttgcagaagaaagtaaaacaaagcccttagagacgaagctaatttctgag
acctcatctgtttgccaagcagaacaagttgccagagttatagtgaaagatgccatacaagggaatttcaacagctctgt
tggatcagatggttacatgctgtcaatattgacaagtggaatgtcaccagtcacttctattactgaaggtcttcagcagg
ttgtttgcatgggcatttttcgcatcattggcctattttacctaggaagttttgacagcatagttcgtcgctgcatgatg
caaagggaaaaatctgaaagtgcagataagaccgagtaa
© 1998-2023Legal notice