Dataset for CDS BCL2L2 of organism Mus spicilegus

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A8C6MXN1_BCL2L2-      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt
A0A8C6MXN1_BCL2L2-      atggcgaccccagcctcaaccccagacacacgggctctagtggctgactt

A0A8C6MXN1_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg
A0A8C6MXN1_BCL2L2-      tgtaggctataagctgaggcagaagggttatgtctgtggagctggccctg

A0A8C6MXN1_BCL2L2-      gagaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga
A0A8C6MXN1_BCL2L2-      gagaaggcccagccgccgacccgctgcaccaagccatgcgggctgctgga

A0A8C6MXN1_BCL2L2-      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca
A0A8C6MXN1_BCL2L2-      gacgagtttgagacccgtttccgccgcaccttctctgacctggccgctca

A0A8C6MXN1_BCL2L2-      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg
A0A8C6MXN1_BCL2L2-      gctacacgtgaccccaggctcagcccagcaacgcttcacccaggtttccg

A0A8C6MXN1_BCL2L2-      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt
A0A8C6MXN1_BCL2L2-      acgaacttttccaagggggccctaactggggccgtcttgtggcattcttt

A0A8C6MXN1_BCL2L2-      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc
A0A8C6MXN1_BCL2L2-      gtctttggggctgccctgtgtgctgagagtgtcaacaaagaaatggagcc

A0A8C6MXN1_BCL2L2-      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc
A0A8C6MXN1_BCL2L2-      tttggtgggacaagtgcaggattggatggtggcctacctggagacacgtc

A0A8C6MXN1_BCL2L2-      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta
A0A8C6MXN1_BCL2L2-      tggctgactggatccacagcagtgggggctgggcggagttcacagctcta

A0A8C6MXN1_BCL2L2-      tacggggacggggccctggaggaggcacggcgtctgcgggaggggaactg
A0A8C6MXN1_BCL2L2-      tacggggacggggccctggaggaggcacggcgtctgcgggaggggaactg

A0A8C6MXN1_BCL2L2-      ggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctgg
A0A8C6MXN1_BCL2L2-      ggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctgg

A0A8C6MXN1_BCL2L2-      taactgtaggggccttttttgctagcaagtga
A0A8C6MXN1_BCL2L2-      taactgtaggggccttttttgctagcaagtga

© 1998-2022Legal notice