Dataset for CDS BAX-like of Organism Laticauda laticaudata

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C5T1U0_BAX-01       -------atggcggcggcagcggcgggtcccgggagggagcaggagctcc
A0A8C5SDR0_BAK1-01      cagtgttctggagaaggc-gaaacatgtcctctggaggatc-----ctgt
A0A8C5SDR0_BAK1-02      cagtgttctggagaaggc-gaaacatgtcctctggaggatc-----ctgt
                                *** *  *** *   *  ****   *  *** *     **  

A0A8C5T1U0_BAX-01       cgcctcgcatggagggcacaagttcagatcaaatccttcagac--aggaa
A0A8C5SDR0_BAK1-01      tatctcttctgcagaggacttggt-agctgaa------cagactgaggag
A0A8C5SDR0_BAK1-02      tatctcttctgcagaggacttggt-agctgaa------cagactgaggag
                           ***   ** ** * **  * * ** * **      *****  **** 

A0A8C5T1U0_BAX-01       ccattcttctcaaaagctttatcagggatcgggtacagtgctgtggagat
A0A8C5SDR0_BAK1-01      gtgttcc-----agagctatgctttccatcgataccagc------aggag
A0A8C5SDR0_BAK1-02      gtgttcc-----agagctatgctttccatcgataccagc------aggag
                           ***      * **** *       ****    ***         ** 

A0A8C5T1U0_BAX-01       tcagaacgcattgaggtgaccatggca---gagcttgaagatgcagaggc
A0A8C5SDR0_BAK1-01      cgggagcaaactgagggggatatgccagttgatccagaaattgctgcaat
A0A8C5SDR0_BAK1-02      cgggagcaaactgagggggatatgccagttgatccagaaattgctgcaat
                           ** *  * ***** *   *** **   ** *  ***  *** *    

A0A8C5T1U0_BAX-01       tcaggcttgtaattccaatacca--aatcgctaagtgagt----gcctgc
A0A8C5SDR0_BAK1-01      tcag---caggagccaaatagcatcaacaatcaggtgggtcgacgcttag
A0A8C5SDR0_BAK1-02      tcag---caggagccaaatagcatcaacaatcaggtgggtcgacgcttag
                        ****       *  * **** **  **     * *** **    ** *  

A0A8C5T1U0_BAX-01       gccggattggagatgagctggatgga------aacacggagctgcagagg
A0A8C5SDR0_BAK1-01      ctatcattgctgatgacatcaatgcacggtatgataaggagttctctgag
A0A8C5SDR0_BAK1-02      ctatcattgctgatgacatcaatgcacggtatgataaggagttctctgag
                             ****  *****  *  *** *       * * **** *      *

A0A8C5T1U0_BAX-01       aagatagaacaagttcagatgtatccccccaagga-----------agt-
A0A8C5SDR0_BAK1-01      atgctg----aagtcc--ttgcagccttccaaggacaatgcatatgagta
A0A8C5SDR0_BAK1-02      atgctg----aagtcc--ttgcagccttccaaggacaatgcatatgagta
                        * * *     **** *   ** * **  *******           *** 

A0A8C5T1U0_BAX-01       tttctttcgagtggctgctgagatgttctcagacggtgcttttaactggg
A0A8C5SDR0_BAK1-01      cttcaccagaatagcctccagtttgtttgaaagcggca---tcaattggg
A0A8C5SDR0_BAK1-02      cttcaccagaatagcctccagtttgtttgaaagcggca---tcaattggg
                         ***    ** * **  *     ****   *  ***     * ** ****

A0A8C5T1U0_BAX-01       gccgtgtggtggcattgttctattttgcatgcaagttagtcctaaaagtg
A0A8C5SDR0_BAK1-01      ggcgtgtgatagcgctgctgggcttcggctacaggatggc-----aatcc
A0A8C5SDR0_BAK1-02      ggcgtgtgatagcgctgctgggcttcggctacaggatggc-----aatcc
                        * ****** * **  ** *    ** *  * ** * * *      **   

A0A8C5T1U0_BAX-01       gtgtatagtaaattaccagagc-----tcctaaggactgtcatcagctgg
A0A8C5SDR0_BAK1-01      atgtataccagcatggcataactggcttcctgagaagaattgcacgttac
A0A8C5SDR0_BAK1-02      atgtataccagcatggcataactggcttcctgagaagaattgcacgttac
                         ******  *   *  ** * *     **** ** *   *     * *  

A0A8C5T1U0_BAX-01       actatggaatata---tccaggaacatgttctgtcctggatccaagccca
A0A8C5SDR0_BAK1-01      atggctgaatttgtgctacacaatcgcattgcacgatggatt---gctca
A0A8C5SDR0_BAK1-02      atggctgaatttgtgctacacaatcgcattgcacgatggatt---gctca
                        *     **** *    * **  * *   **      *****    ** **

A0A8C5T1U0_BAX-01       g---ggaggatgggaaggcctcctctcctttttcggcacccctacatggc
A0A8C5SDR0_BAK1-01      gcaaggaggatgggtgg----------------cagcac----------t
A0A8C5SDR0_BAK1-02      gcaaggaggatgggtaa----------------gtgaac----------c
                        *   **********                     * **           

A0A8C5T1U0_BAX-01       aaaccattgctgtctttattgcgggggtct-----tgactgccgcactga
A0A8C5SDR0_BAK1-01      ggacttgagcaatatttattggaaatacatgttgatgatagccgcagtga
A0A8C5SDR0_BAK1-02      gaa---gaaccatcttcctctagtttgtataaagtctgcttctccattta
                          *      *  * **  *          *           *  ** * *

A0A8C5T1U0_BAX-01       -ccttctgg---aagatgtcttaa---------------------
A0A8C5SDR0_BAK1-01      ttgtgctgggccaattcgttct-acggcgcttcttcaatgactga
A0A8C5SDR0_BAK1-02      ggcaactgg---aatctattctgatgg-----cctcaat--ctag
                             ****   **    *  * *                     

© 1998-2023Legal notice