Dataset for CDS BAX-like of Organism Laticauda laticaudata

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C5SDR0_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Laticauda laticaudata GN=BAK1 (length=624 residues).
cagtgttctggagaaggcgaaacatgtcctctggaggatcctgttatctcttctgcagaggacttggtagctgaacagac
tgaggaggtgttccagagctatgctttccatcgataccagcaggagcgggagcaaactgagggggatatgccagttgatc
cagaaattgctgcaattcagcaggagccaaatagcatcaacaatcaggtgggtcgacgcttagctatcattgctgatgac
atcaatgcacggtatgataaggagttctctgagatgctgaagtccttgcagccttccaaggacaatgcatatgagtactt
caccagaatagcctccagtttgtttgaaagcggcatcaattgggggcgtgtgatagcgctgctgggcttcggctacagga
tggcaatccatgtataccagcatggcataactggcttcctgagaagaattgcacgttacatggctgaatttgtgctacac
aatcgcattgcacgatggattgctcagcaaggaggatgggtggcagcactggacttgagcaatatttattggaaatacat
gttgatgatagccgcagtgattgtgctgggccaattcgttctacggcgcttcttcaatgactga
>gnl|bcl2dbcds|A0A8C5SDR0_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Laticauda laticaudata GN=BAK1 (length=612 residues).
cagtgttctggagaaggcgaaacatgtcctctggaggatcctgttatctcttctgcagaggacttggtagctgaacagac
tgaggaggtgttccagagctatgctttccatcgataccagcaggagcgggagcaaactgagggggatatgccagttgatc
cagaaattgctgcaattcagcaggagccaaatagcatcaacaatcaggtgggtcgacgcttagctatcattgctgatgac
atcaatgcacggtatgataaggagttctctgagatgctgaagtccttgcagccttccaaggacaatgcatatgagtactt
caccagaatagcctccagtttgtttgaaagcggcatcaattgggggcgtgtgatagcgctgctgggcttcggctacagga
tggcaatccatgtataccagcatggcataactggcttcctgagaagaattgcacgttacatggctgaatttgtgctacac
aatcgcattgcacgatggattgctcagcaaggaggatgggtaagtgaaccgaagaaccatcttcctctagtttgtataaa
gtctgcttctccatttaggcaactggaatctattctgatggcctcaatctag
>gnl|bcl2dbcds|A0A8C5T1U0_BAX-01 BCL2-associated X gene OS=[Eukaryota] Laticauda laticaudata GN=BAX (length=618 residues).
atggcggcggcagcggcgggtcccgggagggagcaggagctcccgcctcgcatggagggcacaagttcagatcaaatcct
tcagacaggaaccattcttctcaaaagctttatcagggatcgggtacagtgctgtggagattcagaacgcattgaggtga
ccatggcagagcttgaagatgcagaggctcaggcttgtaattccaataccaaatcgctaagtgagtgcctgcgccggatt
ggagatgagctggatggaaacacggagctgcagaggaagatagaacaagttcagatgtatccccccaaggaagttttctt
tcgagtggctgctgagatgttctcagacggtgcttttaactggggccgtgtggtggcattgttctattttgcatgcaagt
tagtcctaaaagtggtgtatagtaaattaccagagctcctaaggactgtcatcagctggactatggaatatatccaggaa
catgttctgtcctggatccaagcccagggaggatgggaaggcctcctctcctttttcggcacccctacatggcaaaccat
tgctgtctttattgcgggggtcttgactgccgcactgaccttctggaagatgtcttaa
© 1998-2023Legal notice