Dataset for CDS Unclassified of organism Cyprinus carpio

[Download (right click)]

7 sequence(s)

>gnl|bcl2dbcds|A0A8C1GGG5_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio (length=732 residues).
atgttccctgggagtaaagtttcaaacgacaacggcttttggccatgcatcggaataacagctcttaacgtctccagcag
atccagcaagccactggtaatgccagaactgaaaacccagaacccgtttacaaggaacggactccagggctcggtaccat
cttcgcctgagtcggattgcgagaaaacaccagatgaatacacgtctaaccgtatctacgacgccctggaaatggacaca
cgagagattattgacattttcttaaaaaactttactggattgcctcattctaaacgtgggaataaacaggttctggaaac
gatgaatcgggttgtggaaagtcttgtggtgaagcacgaactggcttacaaaggtatgatcgcacggctgaatctggagc
agaaaggagaagatgtgagttttgttaagactgtggcaacagaactcttcagcgatggcatcacaaactggggtcgcatt
gccagcctgcttacatttggggcaatggtatgcaagcatcagaaggataaaggacttagcaattgtgtgagtctggtggg
gaaagagatctctaactaccttctcacagcccagcgggactggctgctcaaaaacaaagcatgggtgagttttgtaattt
cttttgaatcagtttttattttttcaatgtgtgtatatatatatagttattttttttggatgtcaaatgtgtataaaaaa
gtcatcttttga
>gnl|bcl2dbcds|A0A8C1LYY3_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio (length=639 residues).
atgactttgagtttgatgagaagaacagctacggtgagtctcctcggcgcgcacacggcgctcgcgcccgcgcccgcact
caaagcgcggaccgaggacgagctcgacgggtgcgcggatgaaacggacgccgcgatgaagccgttcagaccgggaacga
acggcctgaaaggactgcatctggacggacgctatgtgtccgcggcggacgggtctctcccgaacacaccggacccgcag
gagttcggttccgccgagctgggtcgcgacacgaggcggcttttactggatttctatcgcacgcacacgggactgtgtcc
gcgggaccggaagcagcatcacgcgttaccgacaatgactcgcgttgtcgcggacattctcctaaagcacgagatcgcgt
acaaaggtaagagcagcgcatgcgcactcgctacacccaaacacagctgcggggttgccaggttcttacaccgaaactcg
ccgctcaaaactaggctaatatgtgtctctctgtgtctgcagcatggatttgtggagtttttccgcgtggaggacgtgga
gtctgtggttcgtaatgctttgatggctgtagtcggatgcgctgggatcggcgccggtctcgctttcctgatccggtga
>gnl|bcl2dbcds|A0A8C1MWW7_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio (length=519 residues).
gtacacagtcttagatatatacaggtcgagatggcacaggagaatgtgtatgataaccgcagtatagtggagaagtacat
ccaccataagctctggaagaaggggtacgtcgccctccacacggtgctacgggaggctggggacgaactggagcggcttt
atcagtcggactttgcggagatgtccaaacagctgcatattacgtccatcacggcgcagcagcgcttcaccgcggtcata
gacgagctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaatg
cgtgaataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaatgggccgctgcacgcct
ggatccaggagaacggcggctgggtatatgcgcataaaaatcggtggatgacagctgctgtctgcagcagagctgaaggc
gtggctctcctgtgcacaactttcaggaactgctgttga
>gnl|bcl2dbcds|A0A8C1MWW7_uncBCL2-02 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio (length=594 residues).
atggagcgactgcgccgagcagacgccacgaaacactcaactcacacacacacacacacacacacacacaactgttcagc
gttaacctttcgcaagtacatccaccataagctctggaagaaggggtacgtgtgggaagtgaacggacacgatgacagcg
tctcgaatggactgatgatggagagcgccctccacacggtgctacgggaggctggggacgaactggagcggctttatcag
tcggactttgcggagatgtccaaacagctgcatattacgtccatcacggcgcagcagcgcttcaccgcggtcatagacga
gctgttcagggacggcgtgaactggggcagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaatgcgtga
ataaggagatgacggcgcatgtggataacatcgcgggctggatgaccgagtatctgaatgggccgctgcacgcctggatc
caggagaacggcggctgggtatatgcgcataaaaatcggtggatgacagctgctgtctgcagcagagctgaaggcgtggc
tctcctgtgcacaactttcaggaactgctgttga
>gnl|bcl2dbcds|A0A8C1MWW7_uncBCL2-03 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio (length=552 residues).
gaggaagtctttccccgcaccagccgctccgcgagagaagaaactcactcggcaagaaacctcttccaccgcacagattc
tgaggagaatgtgtatgataaccgcagtatagtggagaagcaggaggaccgcggcggcacccgtcacgacccgtgcagcg
ccctccacacggtgctacgggaggctggggacgaactggagcggctttatcagtcggactttgcggagatgtccaaacag
ctgcatattacgtccatcacggcgcagcagcgcttcaccgcggtcatagacgagctgttcagggacggcgtgaactgggg
cagaatcatcgcttttttcgagtttggagggaccgtttgtgtcgaatgcgtgaataaggagatgacggcgcatgtggata
acatcgcgggctggatgaccgagtatctgaatgggccgctgcacgcctggatccaggagaacggcggctgggtatcagag
ctgaaggcgtggctctcctgtgcacaactttcaggaactgctgttgattcatgcaaacaggaggatgtttag
>gnl|bcl2dbcds|A0A8C1RYW2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cyprinus carpio (length=687 residues).
atggccaacgaaattcgctttgacaatcggaatattgtggagaaatacatcaatatcaaactttcaaagaagggatatgt
gtggaaatctcaatcttctggggaggacgatgacaccgtcaataaaggagtcgagggctcctctctaaactctgacagga
gactccaggctccctcagccggaggggggaacaactctgaatgcctgatagctcaccgggtcactcgttcagacccttat
tccaggatctaccgggcgctacgcgaggctggagacgagatagaaaggatgtaccagcgtgaatttgaggagatgtccca
ccgcatgatacaacgcaatacaacgcaacgcagcttcttagccgtggcagaagagctctttaaagacggagtgaactggg
ggcggatcatcgctttctttgagtttggtgggaccatgtgtgtggagagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgacagactacctgaacgggccactggaaaactggatcgaggaaaatggaggctgggaagcctt
cgtggagttgtacagtcagcagagagactctgtgttccacccattttcgtacctaacaaaagtacttggattggcagtgc
ttggcttggcaggaatgaccatcggagccttttttgctcagaagtga
>gnl|bcl2dbcds|B2L8N7_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Cyprinus carpio (length=693 residues).
atggctttgagtttggattttaggcgatgggccgctggaagccgcttccagcggagcgcagcaggaatctggctcctaac
ctcatgctggtgcgtgcttcagcgtctgaggacgtgtgctctggtcgcgctgtgctggccgaggcccgggacgaacggct
tgaaagggctgcagctggacgggttggttcgtgtccgcggtgggactggctctctaccggccaccccaccttattgggag
tttcccctgtccatgccagctcgcgatgttgagcagccagtactgctgttcagagatcagatagcgggaatgtgtccggt
agaccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcataca
aaggaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgttt
aaagatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagct
ccagcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctctgttgtccgtcatggtcttttgg
cgctggtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
© 1998-2022Legal notice