Dataset for CDS BAX-like of Organism Chlorocebus sabaeus

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A0D9R0C9_BOK-01       atggaggtgctgcggcgc---tcctcggtcttcgccgccgagatcatgga
A0A0D9RB69_BAK1-01      ----atg-gcttcgggacaaggcccaggtcctcccaggcaggaatgcgga
A0A0D9S330_BAX-01       atggacg-ggtccggggagcagcccag----------------aggcggg
                            * * * * ***       **  *                    ** 

A0A0D9R0C9_BOK-01       tgcctttgaccgctcgcccaccgacaaggagctggtggcccaggccaagg
A0A0D9RB69_BAK1-01      gagcctgccctgccc-tctgcttctgaggagcaggtagcccgggacacag
A0A0D9S330_BAX-01       gggcccacca-gctc-t-----------gagcagat---catgaagacag
                           *       ** *             **** * *   *  *   *  *

A0A0D9R0C9_BOK-01       ------------------------------------cgctgggccgggag
A0A0D9RB69_BAK1-01      aggaggttttccgcagctacgttttttaccgccatcagcaggaacaggag
A0A0D9S330_BAX-01       gggccctttt--gcttcagggtttcatccaggatcgagcag-----ggcg
                                                             ** *     ** *

A0A0D9R0C9_BOK-01       tacgtgcacgcgcggctactgcgcgccggcctctcc-tgga----gcgcg
A0A0D9RB69_BAK1-01      gc--tgaaggggcggctgcc-cctgccgacccagagatggacaccttgcc
A0A0D9S330_BAX-01       aa--tggggggggagacacc-cgagctggccc-----tggacccggtgcc
                            **   * *  *   *  *  ** * **      ****      ** 

A0A0D9R0C9_BOK-01       cccgagcgcgccgcgcctgtcccgggacgcctggccgaggtgtgcgcggt
A0A0D9RB69_BAK1-01      cc----tgcaacctagcagcaccatggggc-------aggtgggacggca
A0A0D9S330_BAX-01       tcaggatgcgtc-------caccaagaggc----------tgagcgagtg
                         *     **  *         **  *  **          ** *   *  

A0A0D9R0C9_BOK-01       gctcctgcgcctgggggacgagctgga--gatgatccggcccagcgtcta
A0A0D9RB69_BAK1-01      gctcgccatcatcggggacgacatcaaccgacgctatgactcagagtt--
A0A0D9S330_BAX-01       tctcaagcgcatcggggacgaactggacag------taacatggagct--
                         ***     * * ********  *  *  *         *   * *    

A0A0D9R0C9_BOK-01       ccgcaacgtggctcgtcagctgcacatctccctgcagtctgagcctgtgg
A0A0D9RB69_BAK1-01      ccagaccatgctgcagcacctgcagcccacggcagaga--acgcctatga
A0A0D9S330_BAX-01       gcagaggatgat--------tgccgccgtggacacagactccccccgaga
                         *  *   **          ***            **      **   * 

A0A0D9R0C9_BOK-01       tgaccgatgcgttcctggccgtggctggccacatcttctctgcagg---c
A0A0D9RB69_BAK1-01      gtac-------ttcaccaagattgcctccagcctgtt---tgagagtggc
A0A0D9S330_BAX-01       ggtc-------tttttccgagtggcagctgacatgttttctgacggcaac
                           *       **        * **      * * **   **   *   *

A0A0D9R0C9_BOK-01       atcacgtggggcaaggtggt-gtccctgtatgcggtggccgcggggctgg
A0A0D9RB69_BAK1-01      atcaactggggccgtgtggtggctcttctgggcttcggctac-cgtctgg
A0A0D9S330_BAX-01       ttcaactggggccgtgttgtcgcccttttctactttgccagc-aaactgg
                         ***  ******   ** ** *  * * *   *   * *  *    ****

A0A0D9R0C9_BOK-01       ccgt--ggactgtgtgaggcaggcccagcctgccatggtccacgccctcg
A0A0D9RB69_BAK1-01      ccct-----acacgtctaccagcac--ggcctgactgg-------cttcc
A0A0D9S330_BAX-01       tgcttaaggccctgtgtaccaaggt--gcccgaactgatcagaaccatca
                           *         **    **      * *     **        * ** 

A0A0D9R0C9_BOK-01       tggactgcctaggggagtttgtgcgcaa--gac-----------------
A0A0D9RB69_BAK1-01      tgggc----cacgtgacccgcttcgtggttgacttcatgctgcatcactg
A0A0D9S330_BAX-01       tgggctggacactggacttcctccgggagcggc----tgttg--------
                        *** *     *   **     * **     * *                 

A0A0D9R0C9_BOK-01       cctggcaacctggctgcggagacgcggtggatggactgatgtcc---tca
A0A0D9RB69_BAK1-01      cattgcccggtggattgcacagaggggtggctggg-tggcagcc---ctg
A0A0D9S330_BAX-01       -------ggctggatccaagaccagggtggttgggacggcctcctctcct
                                  *** *          ***** ***   *    **      

A0A0D9R0C9_BOK-01       agtgtgtcgtcagca-----cagaccctggcctccgttcccactggct--
A0A0D9RB69_BAK1-01      aacttggg-----caatggtcccatcctgaac----gtgctggtggttct
A0A0D9S330_BAX-01       actttgggacgcccacgtggcagaccgtgacc----atcttggtggct--
                        *   **       **     *  * * **  *     *     *** *  

A0A0D9R0C9_BOK-01       ---ggtagccgcactctgcagctttggccgcttcctgaaggctgccttct
A0A0D9RB69_BAK1-01      gggtgtggt-----tctgt----tgggccagtttgtggtacgaagattct
A0A0D9S330_BAX-01       -ggagtactcaccgcctcc----ctcaccatct----ggaagaagat---
                            **         **          **   *             *   

A0A0D9R0C9_BOK-01       tcgtgctgctgccagagagatga
A0A0D9RB69_BAK1-01      tc------------aaatcatga
A0A0D9S330_BAX-01       ----------------gggctga

© 1998-2020Legal notice