Dataset for CDS BAX of Organism Dicentrarchus labrax

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A8C4H3M6_BAX-01 BCL2-associated X gene OS=[Eukaryota] Dicentrarchus labrax GN=BAX (length=618 residues).
atggcatcacacccgggaggaggcgataaagtgagtatacagttgggcttctcattattgagctgggtaaagagcgagat
catacttatattactatgcgtttgtctctcgcttcctagtttcatttacgagcgggtgcggcgacatggagacagcaata
ctgaagtgaccagggcacagctgggtggaggagagctgtgtgacccgaaccagaagaagcttgcccagtgtctgcagcag
attggagatgagctggatggcaatgttgagctccaaagaatgttaaacgactctgcgctcagtccctcaaaagaagtgtt
tctgaaagttgccgttgagatcttttcagatggaaagttcaactggggcagggtggtggcactgttctattttgcctgtc
gactcgtcatcaaagctcttgtgactcaagttcctgatattatcagaacaattatcagctggaccatggactacctccgg
gaacatgtgatcaactggataagagatcaaggtggctgggagggtattcgttcctactttggcacacccacatggcagac
ggtgggagttttcttggctggagttctcaccactgttctcgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A8C4H3M6_BAX-02 BCL2-associated X gene OS=[Eukaryota] Dicentrarchus labrax GN=BAX (length=579 residues).
atggcatcacacccgggaggaggcgataaaggaaatggaaaagatcagatactggaagtaggagctgttttgttaaaaga
tttcatttacgagcgggtgcggcgacatggagacagcaatactgaagtgaccagggcacagctgggtggaggagagctgt
gtgacccgaaccagaagaagcttgcccagtgtctgcagcagattggagatgagctggatggcaatgttgagctccaaaga
atgttaaacgactctgcgctcagtccctcaaaagaagtgtttctgaaagttgccgttgagatcttttcagatggaaagtt
caactggggcagggtggtggcactgttctattttgcctgtcgactcgtcatcaaagctcttgtgactcaagttcctgata
ttatcagaacaattatcagctggaccatggactacctccgggaacatgtgatcaactggataagagatcaaggtggctgg
gagggtattcgttcctactttggcacacccacatggcagacggtgggagttttcttggctggagttctcaccactgttct
cgtcattcgcaagatgtga
>gnl|bcl2dbcds|A0A8C4NTD7_BAX-01 BCL2-associated X gene OS=[Eukaryota] Dicentrarchus labrax GN=BAX (length=618 residues).
atggcggacagccgagaagaggagaaaaaagaaagagaccaggagcctcagggcgccgttggaggggaagatgtcatcga
tgatcccatcctggagcaaggagcagtggtcctcagagggtatgtgattgagcgtataaacacagaggaccctgatcgac
atgtctcctctgaggatctgggaggaaggcctaatgaacaacaggatccacatatcaaagacgtggtggaacaactgatc
aagattgcagacgagctgaacaggaatgctgagctccaacgactggtcaaccaggttcaggacaattgtgctaaggaagt
cttcatgacggtggccaggagcatctttgctgatggcatcaactggggtcgagtggtggctctcttccatctggcctata
gactcatatacaaggcactgaccagcaaccatctagagaacatcagaaccgtcatcagctgggttctccagatcatcaga
gagaagatctactcctggatcatacagcagggaggctgggaaggggtgatccatggtttttctcggtggaggacagtagc
catagtagcatcagtagtattggtagcatctattgtttactacaggaagactcgctga
© 1998-2023Legal notice