Dataset for CDS BAK1 of Organism Lynx canadensis

[Download (right click)] [Edit] [Sequences] [Repertoires]

2 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment

A0A667FZZ3_BAK1-01      atggcatccgggcaaggcccaggtcctcccaggcaggagtgtgaagagac
A0A667FZZ3_BAK1-02      atggcatccgggcaaggcccaggtcctcccaggcaggagtgtgaagagac

A0A667FZZ3_BAK1-01      tgccccgtctgctacttctgaggagcaggtagcccgggacaccgaggagg
A0A667FZZ3_BAK1-02      tgccccgtctgctacttctgaggagcaggtagcccgggacaccgaggagg

A0A667FZZ3_BAK1-01      ttttccgcagctatgtttttcaccgttatcagcaggagcaggaggctgag
A0A667FZZ3_BAK1-02      ttttccgcagctatgtttttcaccgttatcagcaggagcaggaggctgag

A0A667FZZ3_BAK1-01      ggggcagctgcgcctactgacccagaaatagtcaccttgcccctagaacc
A0A667FZZ3_BAK1-02      ggggcagctgcgcctactgacccagaaatagtcaccttgcccctagaacc

A0A667FZZ3_BAK1-01      tagcagcaccatggggcaggtgggtcggcagctcgccatcattggggaca
A0A667FZZ3_BAK1-02      tagcagcaccatggggcaggtgggtcggcagctcgccatcattggggaca

A0A667FZZ3_BAK1-01      acatcaaccagcgctacgattcagagttccaggccatgctgcagcgcctg
A0A667FZZ3_BAK1-02      acatcaaccagcgctacgattcagagttccaggccatgctgcagcgcctg

A0A667FZZ3_BAK1-01      caacccacagcagagaacgcctatgaacttttcaccaagattgcctcg--
A0A667FZZ3_BAK1-02      caacccacagcagagaacgcctatgaacttttcaccaagattgcctcgag

A0A667FZZ3_BAK1-01      ------------------agtctatttgagagcggcatcaactggggccg
A0A667FZZ3_BAK1-02      gccagcagcaacacccacagtctatttgagagcggcatcaactggggccg

A0A667FZZ3_BAK1-01      agtggtggctctcctgggctttggctaccgcctggctctacacatctacc
A0A667FZZ3_BAK1-02      agtggtggctctcctgggctttggctaccgcctggctctacacatctacc

A0A667FZZ3_BAK1-01      agcacggcctgaccggcttcctgggccaggtgaccaaactggtggtcgac
A0A667FZZ3_BAK1-02      agcacggcctga--------------------------------------

A0A667FZZ3_BAK1-01      gtcatgctgcgtcactgcattgcccggtggattgcgcagaggggcggctg
A0A667FZZ3_BAK1-02      --------------------------------------------------

A0A667FZZ3_BAK1-01      ggtggcagccctgaacttgggaaatggccccatcgtgaacgtgctgatag
A0A667FZZ3_BAK1-02      --------------------------------------------------

A0A667FZZ3_BAK1-01      ttctgtctgtggttctgttgggccagtttgtggtacgaagattcttcaaa
A0A667FZZ3_BAK1-02      --------------------------------------------------

A0A667FZZ3_BAK1-01      tcatga
A0A667FZZ3_BAK1-02      ------

© 1998-2023Legal notice