Dataset for CDS BCL-2 of organism Serinus canaria

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A8C9MG30_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Serinus canaria GN=BCL-2 (length=891 residues).
atgaagtgtgatggtctttatttcaaagcatttactcaaaaaagtgttttcccccctttttactttaagaaattttacag
gtgtaataaaagtttaagaatcagagatggatgttcctgtttgtctagaagactgtttggatcacctattccttcgtgca
gaacctgcctgctttgctcctctgcagtttcatctgagaagttgctgtccaatcctttttcacagagcagaaagacaggg
catgggcggcactgcctcagtcacaagcacagaggctacgataaccgggagatagtgctgaagtacatccactataaact
ctctcagaggggatacgactggcctgccagcgaggacagggcatccctgcctccaggtctctctgctcctgctgctgctg
cggttgctgctgctgctgggacttcctctgatcacactgggctggtgtctccgcaccccgagccccctggctcggccgct
gctagccacgcgcccccagcagaggggctgcgccccgcaccccaggtcgtccaccttgtcctgcgccaggcgggggacga
gttctcccgacgctaccagagggacttcgcccaaatgtctggccagctgcacctgacgcccttcacggccaggagccgct
tcgtggcggtggtggaggagctcttccgagatggggttaactggggcagaattgtggccttcttcgagtttggcggtgtg
atgtgcgtggagagcgtcaaccgggagatgtctcaccttgtggacagcattgccacctggatgactgagtacctgaaccg
gcagctgcacaactggatccaggacaacggaggctgggtaagtcccccgactgctcggttcctctgccggctccggcccc
tggctggtggg
© 1998-2023Legal notice