Dataset for CDS BCL-2-like of organism Zonotrichia albicollis

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A8D2M680_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Zonotrichia albicollis GN=BCL2L1 (length=693 residues).
atgtacagcagtaaccgggagttagtgattgactttgtttcctacaagctctcacagaaaggatacagctggagtcagct
ggaggaggaggatgagaacaggactgactttgcaggggaggaggacgagatggacggggtcctcaacgggagcccctcct
ggcacgcagccagcagccacatagtgaacggagccaccgtgcaccagagcagcctcgaagtgcacgagatccgtcgagca
gccgacgtgaggcaggcgctgagagaggcgggggacgagttcgagctgagataccggcgggcgttcagcgacctcacctc
ccagctccacatcacccccagcacggcgtatcagagctttgagcaggtagtgaacgaactgttccgcgatggagtgaact
ggggccgcatcgtggctttcttctccttcggaggagccctgtgcgtggagagcgttgttaaggagatgagggtattggtg
aaacgcatcgtgtcttggatgaccacgtacttgaccgaccacttagacccctggatccaggagaatggcggatgggagcg
ctttgtggacctctatgggaacgatgctgctgccgagatgaggaaaggccaggagaccttcaacaaatggctcctgacgg
gggcgacagtggctggagtgcttctgctgggatccctgctgagccgcaagtga
>gnl|bcl2dbcds|A0A8D2MBY7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Zonotrichia albicollis GN=MCL-1 (length=396 residues).
atgcattctgcctgtgctcctgcacccctccctgaagctgttggttttgcagggatgctgaggaagctgcagatccagca
ggaggaggacctgcagtgcgtggtggaggtggcagcccagatgttcagcgacggcgtcaccaactggggccgggtggtga
ccctcatcgccttcggggccttcgtggccaagcacctcaagagcatccagcaggagcagagcgtcagcagcctggctggg
atcatcaccgacgccctggtgaactccaagagggagtggctggagagccaggggggctgggtgagtcaccattcctggga
ttccggaggcagcagccctgggagggctggggtggctggaatggggctgggggagcacaggggatgtgcaggatga
>gnl|bcl2dbcds|A0A8D2N8C6_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Zonotrichia albicollis GN=BCL-2 (length=675 residues).
atggctcatccggggagaagaggctacgataaccgggagatagtgctgaagtacatccactataaactctctcagagggg
atacgactggcctgccagcgaggacagggcatccctgtctccaggtctctctgctcctgctgctgctgctgcggttgctg
ctgctgggactntcttttccttatggacgaagcggggtcccggggctgccggggccgagcccggggcgagcggcggccgc
tgggtggcaacagcgggggacgagttctcccgacgctaccagagggacttcgcccagatgtccggccagctgcacctgac
gcccctcacggccaggagccgcttcgtggcggtggtggaggagctcttccgagatggggttaactggggcaggattgtgg
ccttcttcgagtttggcggtgtgatgtgcgtggagagcgtcaaccgggagatgtctcacctcgtggacagcatcgccgcc
tggatgaccgagtacctgaaccggcagctgcacaactggatccaggacaacggaggctgggatgcctttgtggagttgta
tggcaatggtatgaggcctttgttcgatttctcctggatctctctgaagactatcctgagtctggttctggtgggagctt
gcatcactcttggcgcttatctcggacataagtag
>gnl|bcl2dbcds|A0A8D2QAC0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Zonotrichia albicollis GN=BCL2A1 (length=525 residues).
atggaaactgctgagttctactacgtttattacctggctcaggactatctacagtatgtgctccaggaatcacacctggc
accagcccagaccagggttgctcgtgtcctgagaaccatggcatcctcgctgcaagaacaaaccgaggaggctctcaggc
cgctcctggacaggattgacatcacctctgtagctgttgccaagagaattttcaatggagtcatggatgaaaagtttgct
gatggaaatactaactggggacgaattatgaccatatttacatttggaggtgtcctcaccaagaagcttcaagagcatgg
ggttcagctgactgcagaggagaaggagcagatctcttatttcatcacagagtacatcataaacaacaaagccgactgga
ttgatgcgaatggtggctgggaaaatggcttcctaacgaagtttgaaagaagatcactactgtccttctccaaaatcaca
gccctgttcatagccgtcgtttccttgttcagagagtactactga
© 1998-2023Legal notice