Dataset for CDS BCL-2-like of organism Zonotrichia albicollis

[Download (right click)] [Edit] [Sequences] [Repertoires]

4 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8D2QAC0_BCL2A1-      atg----------------gaaactgct--------------gagttcta
A0A8D2N8C6_BCL2-01      atggctcatccggggagaagaggctacgataaccgggagatagtgctgaa
A0A8D2M680_BCL2L1-      atg------------------tacagcagtaaccgggagttagtgattga
A0A8D2MBY7_MCL1-01      atg------------------cat---------------------tctgc
                        ***                                               

A0A8D2QAC0_BCL2A1-      ctacgtttattac-------------------------------------
A0A8D2N8C6_BCL2-01      gtacatccactataaactctctcagaggggatac----------------
A0A8D2M680_BCL2L1-      ctttgtttcctacaagctctcacagaaaggatacagctggagtcagctgg
A0A8D2MBY7_MCL1-01      ctgtg-ctcctgcac-ccctccctga------------------agctg-
                         *        *                                       

A0A8D2QAC0_BCL2A1-      ---------------------ctggctc-------------agga----c
A0A8D2N8C6_BCL2-01      -------------------gactggcctgccagcgaggacagggcatccc
A0A8D2M680_BCL2L1-      aggaggaggatgagaacaggactgactttgcaggggag--gagga--cga
A0A8D2MBY7_MCL1-01      ---------------------ttggttttgcagggatgctgagga-----
                                              **                  **      

A0A8D2QAC0_BCL2A1-      tatctacagtatgtgctccaggaatcacacctggcaccagcccag-----
A0A8D2N8C6_BCL2-01      tgtctccaggtctctctgctcctgctgctgctgctgcggttgctgctgct
A0A8D2M680_BCL2L1-      gatggacggggtcctcaacgggagcccctcctggcacgcagccagcagcc
A0A8D2MBY7_MCL1-01      --------------------------------------------------
                                                                          

A0A8D2QAC0_BCL2A1-      ------------------------------------accagggttgc---
A0A8D2N8C6_BCL2-01      gggactntcttttccttatggacgaag---cggggtcccggggctgc---
A0A8D2M680_BCL2L1-      a------------catagtgaacggagccaccgtgcaccagagcagcctc
A0A8D2MBY7_MCL1-01      -----------------------------------------agctgc---
                                                                  *  **   

A0A8D2QAC0_BCL2A1-      -----------------------------------tcgtgtcctgagaac
A0A8D2N8C6_BCL2-01      --------cggggccgagcccggggcgagcggcggccgctgggtggcaac
A0A8D2M680_BCL2L1-      gaagtgcacgagatccgtcgagcagccgacgtgaggcaggcgctgagaga
A0A8D2MBY7_MCL1-01      ----------agatccagcaggaggaggacctgcagtgcgtggtggaggt
                                                                   **     

A0A8D2QAC0_BCL2A1-      catggcatcctcgctgcaagaacaaaccgaggaggctctcaggccgctcc
A0A8D2N8C6_BCL2-01      agcgggggacgagttctcccgacgctaccagagggacttcgcccagatgt
A0A8D2M680_BCL2L1-      ggcgggggacgagttcgagctgagataccggcgggcgttcagcgacctca
A0A8D2MBY7_MCL1-01      ggc--------------agcccagat----------gttcagcga-----
                                                              **          

A0A8D2QAC0_BCL2A1-      tggacaggattgacatcacctctgtagctgttgccaagagaattttcaat
A0A8D2N8C6_BCL2-01      ccggccagctgcacctgacgcccctcac---ggccaggagccgcttcgtg
A0A8D2M680_BCL2L1-      cctcccagctccacatcacccccagcac---ggcgtatcagagctttgag
A0A8D2MBY7_MCL1-01      ----------cggcgtcacc------------------------------
                                     * * **                               

A0A8D2QAC0_BCL2A1-      ggagtcatggatgaaaagtttgctgatggaaatactaactggggacgaat
A0A8D2N8C6_BCL2-01      gcggtggtggaggagctcttccgagatggg---gttaactggggcaggat
A0A8D2M680_BCL2L1-      caggtagtgaacgaactgttccgcgatgga---gtgaactggggccgcat
A0A8D2MBY7_MCL1-01      ------------------------------------aactggggccgggt
                                                            ********  *  *

A0A8D2QAC0_BCL2A1-      tatgaccatatttacatttgga------ggtgtcctcaccaagaagcttc
A0A8D2N8C6_BCL2-01      tgtggccttcttcgagtttggc------ggtgtgat-------gtgcgtg
A0A8D2M680_BCL2L1-      cgtggctttcttctccttcgga------ggagccct-------gtgcgtg
A0A8D2MBY7_MCL1-01      ggtgaccctcatcgccttcggggccttcgtggccaa-------gcacctc
                          ** *  *  *    ** **       *  *              * * 

A0A8D2QAC0_BCL2A1-      aagagcatggggttcagctgactgcagaggagaag-----------gagc
A0A8D2N8C6_BCL2-01      gagagcgt--------------caaccgggagatgtctcacctcgtggac
A0A8D2M680_BCL2L1-      gagagcgt--------------tgttaaggagatgagggtattggtgaaa
A0A8D2MBY7_MCL1-01      aagagcat--------------ccagcaggagcagagcgt---------c
                         ***** *                    ****  *               

A0A8D2QAC0_BCL2A1-      ag-atctcttatttcatcacagagtacatcataaacaacaaagccgactg
A0A8D2N8C6_BCL2-01      agcatcgccgcctggatgaccgagtacctgaaccggcagctgcacaactg
A0A8D2M680_BCL2L1-      cgcatcgtgtcttggatgaccacgtacttgaccgaccacttagacccctg
A0A8D2MBY7_MCL1-01      agcagcctggctgggatcatcaccga------cgccctggtgaactccaa
                         * * *         ** *      *                  *  *  

A0A8D2QAC0_BCL2A1-      gattgatgcgaatggtggctgggaaaatggcttcctaacgaagttt----
A0A8D2N8C6_BCL2-01      gatccaggacaacggaggctgggatgc------ctttgtggagttgtatg
A0A8D2M680_BCL2L1-      gatccaggagaatggcggatgggagcg------ctttgtggacctctatg
A0A8D2MBY7_MCL1-01      ga-----gggagtggc----tggagag------ccaggggggc-----tg
                        **     *  *  **      ***         *     *          

A0A8D2QAC0_BCL2A1-      -----gaaagaagatcactactgtccttctc--caaaatcacag------
A0A8D2N8C6_BCL2-01      gcaatggtatgaggcctttgttcgatttctcctggatctctctgaagact
A0A8D2M680_BCL2L1-      -----ggaacgatgctgctgccgagatga----ggaaaggccaggagacc
A0A8D2MBY7_MCL1-01      -----ggtgagtcaccattcctgggattc----cggagg--cagcagccc
                             *            *       *              * *      

A0A8D2QAC0_BCL2A1-      -------------ccctgttcatagccgtcgtttcc-------ttgttca
A0A8D2N8C6_BCL2-01      atcctgagtctggttctggtgggagcttgcatcact------------ct
A0A8D2M680_BCL2L1-      ttcaacaaatggctcctgacgggggcgacagtggctggagtgcttctgct
A0A8D2MBY7_MCL1-01      t-----------------gggagggctggggtggctggaatggggctg-g
                                                **     *  *               

A0A8D2QAC0_BCL2A1-      gagagtactac------------tga
A0A8D2N8C6_BCL2-01      tggcgcttatctcggacataag-tag
A0A8D2M680_BCL2L1-      gggatccctgctgagccgcaag-tga
A0A8D2MBY7_MCL1-01      gggagcacaggggatgtgcaggatga
                          *                    *  

© 1998-2023Legal notice