Dataset for CDS BCL-2-like of organism Dromaius novaehollandiae

[Download (right click)] [Edit] [Sequences] [Repertoires]

3 sequence(s)

CLUSTAL W (1.81) multiple sequence alignment


A0A8C4K2K9_MCL1-01      ----------------------------------------cctg------
A0A8C4JDK2_BCL2L1-      atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagct
A0A8C4JDK2_BCL2L1-      atgtccagcagtaaccgggaattagtgattgactttgtttcctacaagct
                                                                ***       

A0A8C4K2K9_MCL1-01      -------------------tggggaggcctctggggggggtgtgtgggc-
A0A8C4JDK2_BCL2L1-      ctcacagaaggactacagctggagtcagctcgaggaagaggatgagaaca
A0A8C4JDK2_BCL2L1-      ctcacagaaggactacagctggagtcagctcgaggaagaggatgagaaca
                                           *** *    ***  **  * *  ** *  * 

A0A8C4K2K9_MCL1-01      ---------------------ctggcctgtgtggggccctcgaggtgggt
A0A8C4JDK2_BCL2L1-      ggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagc
A0A8C4JDK2_BCL2L1-      ggactgattttgcggtagaggccgggatggccggtgtcctcaacgggagc
                                             * **  **   ** * **** * * * * 

A0A8C4K2K9_MCL1-01      gggcaccggctctgccccg-cggc-------tgcaggcagctctgggggc
A0A8C4JDK2_BCL2L1-      ccgtcctggcacccccctgccagccacgtagtgaacggagccgccgtgca
A0A8C4JDK2_BCL2L1-      ccgtcctggcacccccctgccagccacgtagtgaacggagccgccgtgca
                          *  * *** *  *** * * **       ** * * ***    * *  

A0A8C4K2K9_MCL1-01      tgggggcgacctgggcccccac----cagctttgggggctggagcgaggc
A0A8C4JDK2_BCL2L1-      caggagcagcctcgaggtccatgaaactgttcaagcagccgatgtgaggc
A0A8C4JDK2_BCL2L1-      caggagcagcctcgaggtccatgaaactgttcaagcagccgatgtgaggc
                          ** **  *** *    ***     * * *   *  ** *  * *****

A0A8C4K2K9_MCL1-01      ---tgcagatcgcctctcccgcagggatgctgcgga----agctggacat
A0A8C4JDK2_BCL2L1-      aggcgctgagag----------aggcaggcgatgaatttgagctgaggta
A0A8C4JDK2_BCL2L1-      aggcgctgagag----------aggcaggcgatgaatttgagctgaggta
                            ** **  *          *** * **   * *    *****     

A0A8C4K2K9_MCL1-01      ccagaagg------------------------------------------
A0A8C4JDK2_BCL2L1-      ccagagagctttcagtgacctcacttcccagctccacatcacccctgcca
A0A8C4JDK2_BCL2L1-      ccagagagctttcagtgacctcacttcccagctccacatcacccctgcca
                        *****  *                                          

A0A8C4K2K9_MCL1-01      aggaggacctgcagtccgtgtgcgaggtggcagcccacgttttcagtgac
A0A8C4JDK2_BCL2L1-      cggcgtatcagagcttcgagc---aggtggtgaacgaactcttccgggat
A0A8C4JDK2_BCL2L1-      cggcgtatcagagcttcgagc---aggtggtgaacgaactcttccgggat
                         ** * * * *   * ** *    ******    * *  * *** * ** 

A0A8C4K2K9_MCL1-01      ggagtaacaaactggggcagagttgtgacactcatctcgtttggtgcctt
A0A8C4JDK2_BCL2L1-      ggagt---gaactggggtcgcatcgtggctttcttctccttcgg------
A0A8C4JDK2_BCL2L1-      ggagt---gaactggggtcgcatcgtggctttcttctccttcgg------
                        *****    ********  *  * *** *  ** **** ** **      

A0A8C4K2K9_MCL1-01      tgttgcgaaacacctgaagagcataaaccaggagaagt--gcatcagctc
A0A8C4JDK2_BCL2L1-      aggggcgttgtgtgtggagagcgttgagaaggagatgcgggtattggttg
A0A8C4JDK2_BCL2L1-      aggggcgttgtgtgtggagagcgttgagaaggagatgcgggtattggttg
                         *  ***       ** ***** *  *  ****** *   * **  * * 

A0A8C4K2K9_MCL1-01      g-------ttagcagggatcatcacagacgcgctggtctcctctaaacgg
A0A8C4JDK2_BCL2L1-      gacgcattgtatcttggatgaccacgtacttgaccgac-catctagat--
A0A8C4JDK2_BCL2L1-      gacgcattgtatcttggatgaccacgtacttgaccgac-catctagat--
                        *        ** *  **** * ***  **  *   * * * **** *   

A0A8C4K2K9_MCL1-01      gagtggctagtgagccaggga------ggctgggagggcttcgtcgactt
A0A8C4JDK2_BCL2L1-      ------ccctggatccaagaaaatggcggatgggagcggttcgtggacct
A0A8C4JDK2_BCL2L1-      ------ccctggatccaagaaaatggcggatg---gcgctgcatgggact
                              *    ** *** * *      ** **   * * * * * *   *

A0A8C4K2K9_MCL1-01      cttccgcgtggaggacctggaagggagcatcaggaacgtcctgatggctt
A0A8C4JDK2_BCL2L1-      ct---acgggaataatgctgctgctgagataaggaagggccaggagacct
A0A8C4JDK2_BCL2L1-      ct---gc----------ccgtgggaggtatatgg----------------
                        **    *            *  *     **  **                

A0A8C4K2K9_MCL1-01      tc-gcgggcgtcgccggactgggcgcgagcttggcctacatgatccgg--
A0A8C4JDK2_BCL2L1-      tcaacaaatggctcctgaccggg-gcgaccgtggcaggcgtgcttctgc-
A0A8C4JDK2_BCL2L1-      cctacagatgtct--------ga-gttttctt------cttgcttctgct
                         *  *    * *         *  *    * *      * ** * * *  

A0A8C4K2K9_MCL1-01      ------------------------tga
A0A8C4JDK2_BCL2L1-      -tgggatctctgctgagccgcaagtga
A0A8C4JDK2_BCL2L1-      ttgggatc----------------tga
                                                ***

© 1998-2022Legal notice